ID: 1106023570

View in Genome Browser
Species Human (GRCh38)
Location 13:25936879-25936901
Sequence GAACTCTGTGGGCTATGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106023564_1106023570 6 Left 1106023564 13:25936850-25936872 CCAAGACACTCTCAGAGGTCTGA 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1106023570 13:25936879-25936901 GAACTCTGTGGGCTATGAAAGGG 0: 1
1: 0
2: 1
3: 18
4: 145
1106023561_1106023570 20 Left 1106023561 13:25936836-25936858 CCTCAGCTACCTGTCCAAGACAC 0: 1
1: 0
2: 1
3: 13
4: 175
Right 1106023570 13:25936879-25936901 GAACTCTGTGGGCTATGAAAGGG 0: 1
1: 0
2: 1
3: 18
4: 145
1106023562_1106023570 11 Left 1106023562 13:25936845-25936867 CCTGTCCAAGACACTCTCAGAGG 0: 1
1: 0
2: 1
3: 14
4: 133
Right 1106023570 13:25936879-25936901 GAACTCTGTGGGCTATGAAAGGG 0: 1
1: 0
2: 1
3: 18
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106023570 Original CRISPR GAACTCTGTGGGCTATGAAA GGG Intronic
902339017 1:15770641-15770663 GGACTGTGTGGGGAATGAAATGG - Intronic
902605977 1:17569615-17569637 GGACCCTGTGGGCTTTGAAAGGG + Intronic
904169607 1:28582178-28582200 GAACCCTGTGTGCTGGGAAAGGG + Intergenic
904335267 1:29793230-29793252 GAGCTCTGTGGACCATGAAAAGG - Intergenic
904920086 1:34000533-34000555 GAACTCTGGGGCCTGGGAAAGGG - Intronic
905743751 1:40395185-40395207 GGACTTTGTTGGCTTTGAAAAGG - Intronic
908812972 1:68003035-68003057 CAACTCTGGGGGCTTTCAAATGG - Intergenic
915475926 1:156152891-156152913 GAACTCTGTGGCCTACAAAGTGG - Intronic
915943913 1:160136227-160136249 GACCTGTGTGGGGTAGGAAATGG - Exonic
916491091 1:165303288-165303310 AAACACTGTGGGCTATGGAATGG - Intronic
921303739 1:213774574-213774596 GAACTCTCTTACCTATGAAAAGG - Intergenic
923829507 1:237539402-237539424 AAATATTGTGGGCTATGAAAAGG - Intronic
1068107017 10:52631212-52631234 GAACCCTGTGGGGCATAAAAAGG - Intergenic
1074203328 10:111258954-111258976 GAACTCTGTCTGCTAGGAACTGG + Intergenic
1075730443 10:124632397-124632419 GAACCCTGTGTGCTTTGGAAAGG - Intronic
1081086658 11:38810531-38810553 GAATTCTCTGGGTTATGAGAAGG - Intergenic
1082090529 11:48085751-48085773 GAGCCCTGTGGACTATGGAAGGG + Intronic
1082653560 11:55824711-55824733 GATCTCTGTGGGATATCAAATGG - Intergenic
1083856470 11:65395589-65395611 GTACTCTGTGGGCTGTGGACCGG - Intronic
1086028339 11:82322425-82322447 GAATTCAATGGGTTATGAAAAGG + Intergenic
1087487721 11:98778368-98778390 AAACTATGGGCGCTATGAAATGG - Intergenic
1087879281 11:103395804-103395826 GAACTCTGTGGACTAAGACTTGG + Intronic
1088711274 11:112511137-112511159 GAACTCTCGGGGCTTTGAATTGG - Intergenic
1091569235 12:1670075-1670097 GGGCTCTTTGGGCTGTGAAAGGG - Intergenic
1093173856 12:15888958-15888980 GAACACAGTGGGCAATAAAATGG - Intronic
1097023086 12:56034617-56034639 GAACTCGGGTGGCTATGAAAAGG + Exonic
1098048515 12:66427659-66427681 GATCTCTGAGGTCTATGTAATGG - Intronic
1099111434 12:78566961-78566983 CAACTCTGTGGGGTAGGAAAGGG - Intergenic
1100710890 12:97255723-97255745 GAAATCTGAGGGCTATCCAATGG + Intergenic
1101347492 12:103899981-103900003 CACCTCTGTGGGCTCTGACAGGG - Intergenic
1101626351 12:106446139-106446161 GAACCCTGTGTGTCATGAAAGGG + Intronic
1106023570 13:25936879-25936901 GAACTCTGTGGGCTATGAAAGGG + Intronic
1106770874 13:32959484-32959506 AAACTCTGTAGCCTATGAATGGG + Intergenic
1107899658 13:44999287-44999309 CAATTCTGTGTGATATGAAAGGG + Intronic
1111640792 13:90966927-90966949 CTACTCTGTGGGTTGTGAAAGGG + Intergenic
1115758112 14:36549786-36549808 GCACTTGGTGGGCTCTGAAAAGG + Intergenic
1116913656 14:50499207-50499229 AAACTCTCAGGGATATGAAAGGG + Intronic
1116944327 14:50822053-50822075 GAGCACTGTGGGCTATGGGATGG - Exonic
1119494388 14:75066118-75066140 GAACTCTGTGGCTTATTAAGGGG + Intronic
1120134895 14:80856226-80856248 GAAGTCTGTGGGATAGGCAAGGG - Intronic
1121571611 14:94950866-94950888 GATCTCTGTTGGCTCTGCAAGGG + Intergenic
1124043365 15:26125358-26125380 GAACACTGTGGGCTTTGAGGGGG + Intergenic
1126407895 15:48340562-48340584 TAACTCTCTGGGCTATGTCAGGG + Intronic
1126558173 15:50013771-50013793 GAACTCTGAGTTCTAAGAAAAGG + Intronic
1130283471 15:82537004-82537026 GAACCCTGTTGGCTCTTAAAGGG - Intronic
1132214964 15:100055680-100055702 GAACTGTCCTGGCTATGAAAAGG + Intronic
1132462509 16:62437-62459 CACCTCTGTGGGCGATGGAAGGG - Intronic
1133486635 16:6226032-6226054 GAACTCTGTGATCTTTGGAAAGG - Intronic
1135384665 16:22026756-22026778 GAACTCTATGTCCTTTGAAAAGG + Intronic
1138022331 16:53495963-53495985 GAACTCTGTGGGCCTTGCCAGGG + Intronic
1138421702 16:56903272-56903294 GGACTCTAAGGGCTAAGAAAGGG + Intronic
1138833018 16:60398723-60398745 GAAGTCTGTAGTCTTTGAAATGG - Intergenic
1146707340 17:35010786-35010808 AAAATCAGTGGGCTAGGAAAGGG + Exonic
1146931059 17:36778411-36778433 GAGCTCTCTGGGCCATGAAGTGG - Intergenic
1149016307 17:51912667-51912689 GCACTGTGTGTGCAATGAAAGGG + Intronic
1149161004 17:53692902-53692924 GATCTCTGTGTGTAATGAAAAGG - Intergenic
1149421283 17:56512680-56512702 GAACTCTGTGGACAAGGATAGGG - Intergenic
1152555174 17:81049508-81049530 AAAGTCTGTGGGCTTTAAAAGGG - Intronic
1155716314 18:28948151-28948173 TAACTCTCTGGGTTATAAAATGG + Intergenic
1162493712 19:11010935-11010957 GAGCTCTGTGTGGTGTGAAACGG + Intronic
1162774420 19:12970307-12970329 GAAATTTGTGGGCTGTGAAGAGG - Intronic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1164687414 19:30176679-30176701 GAAATGTGTGGGTTATGATAAGG - Intergenic
1167852979 19:52215986-52216008 GAACTCTGTGGGCAGGGAGAGGG - Exonic
925623772 2:5821317-5821339 GAACTCTGTGAGAAAGGAAATGG - Intergenic
926396840 2:12452033-12452055 GACGTCTCTGGGTTATGAAAGGG - Intergenic
928692872 2:33819229-33819251 GAACTTTGTGTGCTAGAAAAAGG - Intergenic
930045515 2:47168260-47168282 GAAATCTGTGGTCTAGGAAAAGG + Intronic
931695311 2:64866477-64866499 GGACCCTGTGTGCTATGGAAGGG - Intergenic
935305400 2:101732127-101732149 AAACTCTGTGGGAGATGAAATGG + Intronic
936156689 2:110051558-110051580 GAACCCTGGGGGCTGTGAATGGG - Intergenic
936188003 2:110319886-110319908 GAACCCTGGGGGCTGTGAATGGG + Intergenic
936921490 2:117693332-117693354 GGACACTGTGGGCTCTGGAAGGG - Intergenic
939417477 2:141918582-141918604 AAACTCTGTGGTTTGTGAAATGG - Intronic
939924636 2:148157771-148157793 GAAGTAAGTGTGCTATGAAATGG + Intronic
940713827 2:157195461-157195483 GAACTCAGTTGGCTATATAAAGG - Intergenic
941591404 2:167424743-167424765 GAACCCCGTTGGCTATAAAAGGG - Intergenic
941628726 2:167860335-167860357 TAACTATTTGTGCTATGAAATGG - Intergenic
1170242418 20:14182926-14182948 AAACTCGGTGGGGTATGAAAGGG - Intronic
1171542347 20:25972489-25972511 GATCTCAATGGGCTCTGAAATGG + Intergenic
1172192724 20:33071644-33071666 GGGCTCTGTGAGCTCTGAAATGG - Intronic
1173349801 20:42234163-42234185 GAACCCTGTGGTTTCTGAAAGGG + Intronic
1176092943 20:63326952-63326974 GAAGTCTGTGGGCTGTCAACAGG - Intronic
1177883340 21:26719734-26719756 GAACTCTGAGGGCACTGAGATGG + Intergenic
1178282788 21:31297814-31297836 GAACTCAGAGGGCTATGAAGAGG + Intronic
950140402 3:10611295-10611317 GAACTGTGAGGGCTATGAGCAGG + Intronic
952552104 3:34490509-34490531 CAATACTGTGGGCTATGAAGAGG - Intergenic
953795590 3:45983447-45983469 GTGCTCTGTGGCCTATGTAAAGG + Intronic
954364531 3:50139027-50139049 CAACTCTGTGGGGTGTGAATAGG + Intergenic
956768844 3:72507383-72507405 GAACCCTGTGGGGGATCAAAAGG - Intergenic
956775781 3:72564459-72564481 GAACCCTCTGGGTGATGAAATGG + Intergenic
964085148 3:152808255-152808277 GAACTCTGAGGGTTAGGAAATGG - Intergenic
964733054 3:159887699-159887721 GAACTCTGTTTGCTCTGCAAAGG - Exonic
966642491 3:182206208-182206230 GAACTCTGTGGGCTGGGGATGGG + Intergenic
967260657 3:187638558-187638580 GATCTCTATGGGATATGAAGTGG - Intergenic
968558221 4:1261248-1261270 GTGCTCTGTGGGCCATGAGAAGG + Intergenic
969042321 4:4308816-4308838 GAACAGTGTGGGCAAAGAAAAGG + Intronic
969687094 4:8681722-8681744 GGACTCTGTGGGCAATTAGATGG + Intergenic
969695233 4:8730462-8730484 AAACTCTGTGGTTTTTGAAAAGG - Intergenic
970081016 4:12285721-12285743 GAACTCAGTGGACTCAGAAATGG + Intergenic
970646084 4:18121831-18121853 GGACTTTGTGAGCTAGGAAAGGG + Intergenic
970675129 4:18440528-18440550 GAGCTCTGGGGGCTATTAGAGGG - Intergenic
970875516 4:20864698-20864720 GAACTCTGTGAGAATTGAAAGGG + Intronic
975814597 4:78204661-78204683 GCACTTTGTGGACTATGAAAAGG - Intronic
976959499 4:90951355-90951377 GAAATCTTTGGGGTATAAAAAGG + Intronic
976985433 4:91290037-91290059 GTACTCTGTAAGCTATGAAGTGG + Intronic
982338688 4:154270456-154270478 AAAGGCTGTGGGCTAGGAAAGGG + Intronic
982407818 4:155040162-155040184 GAACTCTGTGGTCTTTGGACTGG - Intergenic
985337997 4:188916465-188916487 GTACCCTTTGGGCTTTGAAATGG - Intergenic
985923095 5:2994845-2994867 GAACTCTGTGGTCTAAGCCACGG - Intergenic
987176977 5:15322537-15322559 GAAGTCTGTGTGCTATGCCAAGG - Intergenic
990164551 5:52979885-52979907 GAACCCTGTGCGGTAAGAAATGG - Intergenic
990803176 5:59628752-59628774 GGACTGTGTGTGCTAGGAAAGGG + Intronic
991433760 5:66574714-66574736 GAACTTTGTGAGCTATGATAAGG + Intergenic
992426942 5:76667587-76667609 GAACCCTGTGGGCTCTGATGAGG - Intronic
993606941 5:90002790-90002812 GACTTATGTGGGCTATTAAATGG - Intergenic
995036374 5:107539063-107539085 GAACTTTCTGGGGTATGAATGGG - Intronic
996217430 5:120886957-120886979 CCACACTGTGGGCAATGAAAAGG - Intergenic
997236579 5:132275476-132275498 GAGGTCTGAGGGCTATGAAAAGG - Intronic
998599676 5:143572783-143572805 GGACTCTGTGGGATATAAACTGG - Intergenic
999161473 5:149503394-149503416 GAAGTCTGTGTTCTGTGAAATGG + Intronic
1001864723 5:175093374-175093396 AAACTCTGTGGGCTTTGTTAAGG + Intergenic
1002312508 5:178323303-178323325 GCCCTTTGTGGGCAATGAAATGG - Intronic
1004096222 6:12557081-12557103 GAACTCTGTTGGCATTTAAAAGG - Intergenic
1004261366 6:14110498-14110520 CAACTCTGTGGGTTAAGAAGGGG + Intergenic
1006255270 6:32827728-32827750 GAACAGTGTGTGCTCTGAAAAGG + Intronic
1006609923 6:35288295-35288317 AACCTCAGTGGGCTATGACAAGG + Intronic
1007520226 6:42446264-42446286 GGACTCTCTGGGCTTTGAAAAGG - Intronic
1011489176 6:87872965-87872987 GGAGTCTGAGGACTATGAAATGG - Intergenic
1011667958 6:89653733-89653755 GAACTTGGTTAGCTATGAAAGGG + Intronic
1012440988 6:99262114-99262136 GAACTCTTTAGGCCGTGAAAGGG + Intergenic
1014213535 6:118731206-118731228 GCTTTCTGTGGCCTATGAAAGGG + Intergenic
1014515044 6:122367767-122367789 GAGATCAGTGGTCTATGAAATGG + Intergenic
1016067722 6:139701106-139701128 GGACTGTGAGGTCTATGAAATGG + Intergenic
1021247198 7:18278213-18278235 GAACACTGTGATCTGTGAAATGG + Intronic
1022853616 7:34293292-34293314 GAAATCTGTGGTCTATAAAAAGG - Intergenic
1026050261 7:66940685-66940707 AAACCCTGTGGGCCATGACAGGG + Intronic
1033534815 7:142302050-142302072 GAACTCTGTTGACCTTGAAATGG - Intergenic
1035048775 7:155986186-155986208 GAATTCTGTGGGCTGGGAATTGG - Intergenic
1036409345 8:8484340-8484362 GAACTCTGTGAGTTTTGTAATGG + Intergenic
1039797627 8:40928670-40928692 GGACTCTATGGTCAATGAAATGG + Intergenic
1040297412 8:46163847-46163869 GGACTCAGTGGGCTATGAAGTGG + Intergenic
1040690310 8:49929469-49929491 CAACTTTCTGGGCTGTGAAATGG + Intronic
1041929401 8:63270452-63270474 GAGGCCTGTGGGCTAAGAAATGG - Intergenic
1042241192 8:66666412-66666434 TAACACTGTGGGCTATGGCAAGG - Exonic
1042626449 8:70763141-70763163 GAAAACTGTGGACTATAAAATGG + Intronic
1046133184 8:109993495-109993517 GAACTGTGTGGGATATGATGAGG - Intergenic
1048839189 8:138550063-138550085 AAACTCTGGGGCCTATGAATTGG + Intergenic
1049827694 8:144680169-144680191 GTACTCAGTGGGATATGAAGAGG - Intergenic
1050481083 9:6087342-6087364 GAAATCTGTGGGATATGATGAGG + Intergenic
1052062461 9:23977524-23977546 GAACTCTGTGCGCTCCAAAAAGG + Intergenic
1055248325 9:74274000-74274022 GAATTGTCTGGTCTATGAAAAGG - Intergenic
1055949620 9:81718783-81718805 GAACTGTGTGGGCATTGAAGGGG + Intergenic
1056331882 9:85528161-85528183 GACCTCTCTGGGCTCTGGAAAGG + Intergenic
1056458999 9:86791280-86791302 ACACTCTGTGGGCAATGAGAAGG - Intergenic
1061894913 9:133642155-133642177 CAACTCTGGGGGCTCTGAGAGGG + Intronic
1186827511 X:13355224-13355246 CAAATCTGTTGGCTGTGAAATGG + Intergenic
1188822054 X:34787476-34787498 GAACTCTGAGGGGGATGTAAAGG - Intergenic
1189897690 X:45673024-45673046 AAACTCTCTGGGCTCTGAACAGG - Intergenic
1191151088 X:57221423-57221445 GAACTGGGTGGGCTATTTAAGGG - Intergenic
1192039713 X:67605638-67605660 CCACTCTGTGGGCTATGAAATGG + Intronic
1195559504 X:106267458-106267480 GCACTTTGTAGCCTATGAAAAGG + Intergenic
1195562457 X:106298881-106298903 GCACTTTGTAGCCTATGAAAAGG - Intergenic
1197813898 X:130476977-130476999 GAACTCTGTGTTCTCTGAAAGGG + Intergenic
1198088637 X:133305596-133305618 GAACTTTCTGGGCTAGAAAATGG + Intronic