ID: 1106027524

View in Genome Browser
Species Human (GRCh38)
Location 13:25969117-25969139
Sequence CCACTTCAGCATATCTAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106027524 Original CRISPR CCACTTCAGCATATCTAAAT GGG Intronic
906413159 1:45595849-45595871 GCGCTTCAGCATATCAAAAGTGG + Intronic
907045056 1:51295614-51295636 CAACTTCAGCATCTGTAAAATGG - Intronic
908476877 1:64497674-64497696 ACACATCAGCATATCAAAAAGGG + Intronic
915521998 1:156451657-156451679 CCACTTCAGCCTTTCTCAACAGG - Intergenic
916564647 1:165963177-165963199 CAAATTTAGCATATCAAAATGGG + Intergenic
917421394 1:174867488-174867510 CTATTTCAGGATTTCTAAATGGG + Intronic
917467547 1:175295235-175295257 TGACTCCAGGATATCTAAATGGG + Intergenic
917990503 1:180372306-180372328 CTACTTCAGCAAAGATAAATAGG - Intronic
923851779 1:237803982-237804004 TCACTTCCTCATATATAAATTGG + Intronic
924081407 1:240401910-240401932 CCACTTCGTCATATGTAAAAAGG + Intronic
1065205173 10:23350265-23350287 CCACTTTCTCATTTCTAAATTGG - Intergenic
1066282397 10:33930545-33930567 CCAATTCAGCAAATGTAACTTGG - Intergenic
1069765837 10:70858459-70858481 CCACTTCATCATATAAAATTGGG + Intronic
1075547829 10:123368739-123368761 CCACTTCAAAATACCTAAATGGG - Intergenic
1076362496 10:129899200-129899222 CCACTTCATCATTCATAAATCGG + Intronic
1078993980 11:16678479-16678501 CCACTTCAAGATAGCCAAATAGG + Intronic
1079808685 11:24967503-24967525 CCACTTCAACATATGTACACTGG - Intronic
1080417731 11:32084368-32084390 CCACTTCAACATATGAAACTTGG + Intronic
1080878343 11:36296693-36296715 CCACCTCAGTAAATCTACATGGG - Intronic
1086854932 11:91854787-91854809 CCACTCCAGCCTATAGAAATGGG + Intergenic
1088941238 11:114458996-114459018 CCACTTCAGAACATCAAAAGTGG - Intergenic
1089964758 11:122646866-122646888 CCACTTCAGCCCACCTAAAATGG - Intergenic
1090288541 11:125521436-125521458 CAACTTCATCATATCTAAATGGG + Intergenic
1090456396 11:126853441-126853463 CCATTTCTGCATTTTTAAATGGG + Intronic
1094691708 12:32775815-32775837 CAACTTCATCATCTGTAAATTGG - Intergenic
1097995592 12:65884304-65884326 CCTCTTCAGCATCTCTAATCTGG - Intronic
1098905374 12:76156205-76156227 CCACTTCTTCATATCTAAGCTGG + Intergenic
1101085342 12:101230096-101230118 CCAGTTCCGCCTTTCTAAATTGG - Intergenic
1102602180 12:114039729-114039751 ACACTTCAGTTTTTCTAAATTGG - Intergenic
1106027524 13:25969117-25969139 CCACTTCAGCATATCTAAATGGG + Intronic
1106965917 13:35067316-35067338 CCACTTCAGCATAACAAAGAAGG - Intronic
1107563240 13:41576573-41576595 CAAGTTCAGCATATCTATAATGG - Intronic
1107749856 13:43553237-43553259 CCAATTCAGCACATATGAATTGG - Intronic
1107982090 13:45743642-45743664 CCACTTCTGCATTTCTGAAATGG + Intergenic
1109689187 13:65864169-65864191 CAACTTCAGCATATATAGGTTGG + Intergenic
1109988443 13:70020710-70020732 TCACTTCAGTATATGTAAAAAGG - Intronic
1110387398 13:74929462-74929484 CCACTTCACATTTTCTAAATTGG + Intergenic
1112781094 13:102902232-102902254 CCACATCTTCATATATAAATTGG - Intergenic
1114074645 14:19151561-19151583 CCACTTCAGCATAACAAAGAAGG - Intergenic
1114087622 14:19248414-19248436 CCACTTCAGCATAACAAAGAAGG + Intergenic
1115947935 14:38684615-38684637 CCACTTGAGCAGTTCTAGATTGG + Intergenic
1116529539 14:45951905-45951927 TCACTTCAGCATATCTAAAATGG - Intergenic
1118051975 14:62038988-62039010 CCATTTCTTCATATATAAATGGG - Intronic
1119121784 14:72086061-72086083 TGACTTCAGCATATCTCAAAGGG - Intronic
1121860402 14:97312479-97312501 CAACTGCAGCATAGCTTAATAGG - Intergenic
1202941444 14_KI270725v1_random:151537-151559 ACACTTCAGAATCTCTAACTGGG - Intergenic
1124366703 15:29077106-29077128 CCATTTTAGCCTATCTGAATTGG - Intronic
1124369162 15:29093697-29093719 CCACGTCAGCAAAATTAAATGGG + Intronic
1124615043 15:31235457-31235479 CCACTTCGGCCTCTCTAAGTGGG + Intergenic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1129585461 15:76859121-76859143 CCTCTCCAGCATTTCAAAATAGG + Intronic
1136199302 16:28676868-28676890 CCACTTCAGCCTCCCTAAACTGG - Intergenic
1139316836 16:66079592-66079614 CCACTTCAGTGTGTCTAGATAGG - Intergenic
1141875099 16:86818808-86818830 CCAAAGCTGCATATCTAAATTGG - Intergenic
1144245773 17:13362757-13362779 CCACTTCAGAATTTCTACGTAGG - Intergenic
1146862826 17:36319573-36319595 CTACTTCAACATATTTAATTAGG + Intronic
1147093155 17:38123656-38123678 CTACTTCAACATATTTAATTAGG + Intergenic
1147104052 17:38196832-38196854 CTACTTCAACATATTTAATTAGG - Intergenic
1148425435 17:47591573-47591595 CTACTTCAACATATTTAATTAGG + Intronic
1150925302 17:69526329-69526351 CCACTTAAGCCTATCTAAAATGG - Intronic
1155037793 18:22039825-22039847 CAAATTCATCATATCTAAATCGG + Intergenic
1158315066 18:56203231-56203253 CTACTTCAGCATAGCCAACTGGG + Intergenic
1158556187 18:58476625-58476647 GCACATCTGCAGATCTAAATGGG + Intergenic
1159256922 18:65958659-65958681 CCTCTTGATCATATCTAATTGGG - Intergenic
925545515 2:5011514-5011536 GCACTGCAGCATTTCTAAACTGG - Intergenic
926733599 2:16056264-16056286 CAACGTCAGCTTTTCTAAATGGG + Intergenic
927249974 2:20988772-20988794 CCACTTCTGCATATATAAAACGG - Intergenic
928988324 2:37202949-37202971 CCTCTTCAGCAGATACAAATAGG + Exonic
930419330 2:51131075-51131097 CCACTTCAGCACATCTAAGAGGG - Intergenic
935548703 2:104428915-104428937 TCACTTCAGCAAATCTGAACTGG - Intergenic
938488978 2:131748055-131748077 CCACTTCAGCATAACAAAGAAGG - Intronic
938671020 2:133586953-133586975 CCAGTTCAGAATCTCTGAATTGG + Intergenic
939462823 2:142518740-142518762 ACACTTCAGCTTATCTTAAGAGG + Intergenic
940103971 2:150076562-150076584 CCACCCCAGGATATTTAAATTGG - Intergenic
940998862 2:160180205-160180227 CCACTTCAGCATTTTTAACAGGG + Intronic
941996231 2:171604425-171604447 GGACTTCAGCATATCTTACTAGG - Intergenic
947515276 2:230798300-230798322 CAAATTCAGAATATCTAAATAGG - Intronic
1169867257 20:10215498-10215520 CTACTTCACTATATATAAATGGG + Intergenic
1169874386 20:10280922-10280944 CCACATCTGCATATCTGAAAAGG - Intronic
1169974440 20:11307575-11307597 CCACTTCAGGAGAGCTAAAGTGG + Intergenic
1170299010 20:14861213-14861235 CCACTTAGGCCTACCTAAATGGG + Intronic
1172159424 20:32855771-32855793 CTACTTCAAAATATATAAATAGG - Intergenic
1172261722 20:33572667-33572689 CCACTACATTATATCTACATCGG - Intronic
1173265955 20:41481135-41481157 ACACTTCAGAATATTTATATGGG + Intronic
1173338035 20:42128978-42129000 CCACTTCCTCATCTATAAATGGG - Intronic
1176581717 21:8535397-8535419 ACACTTCAGAATCTCTAACTGGG + Intergenic
1177470073 21:21548943-21548965 CTACTTCAGCCCATTTAAATAGG - Intergenic
1177606013 21:23378833-23378855 CCACTTCAGCATGGCTAAAAGGG + Intergenic
1178798125 21:35764687-35764709 CCACTTAAGAATATCTTAATTGG + Intronic
1180264552 22:10512469-10512491 ACACTTCAGAATCTCTAACTGGG + Intergenic
1180290295 22:10844501-10844523 CCACTTCAGCATAACAAAGAAGG - Intergenic
1180493093 22:15873922-15873944 CCACTTCAGCATAACAAAGAAGG - Intergenic
1184663919 22:45977655-45977677 CCACTCCAGCAAACCTCAATGGG + Intergenic
949291981 3:2477483-2477505 TCAGTTCTGCATATGTAAATAGG - Intronic
952875764 3:37943125-37943147 TCGACTCAGCATATCTAAATGGG - Intronic
953629476 3:44600834-44600856 CCAAATCAGCATATCTACAGTGG + Intronic
955370678 3:58348983-58349005 CAATTACAGCATATCTCAATTGG + Intronic
956334016 3:68143493-68143515 CAACTTCAGCATATTTACTTTGG + Intronic
957564844 3:81871109-81871131 CAACTTCAGCAGTTCTAAAAAGG + Intergenic
958658089 3:97029041-97029063 CGACTTAAGTATATCAAAATTGG + Intronic
960348287 3:116561972-116561994 CCTTTTCAGCATCTCTAAAATGG + Intronic
960841901 3:121967564-121967586 ACATTTCAGAATATCTAAAATGG + Intergenic
962028167 3:131571058-131571080 CAACTTCAGCATAACGAGATAGG - Intronic
963473196 3:145770704-145770726 CCACTTGAGAAAGTCTAAATAGG + Intergenic
963720737 3:148859062-148859084 CAAGTTCACCATATATAAATAGG - Intronic
966046403 3:175556078-175556100 TCACTTCAGCATTTATTAATGGG + Intronic
967668875 3:192207858-192207880 CCACTTCAGCGTGTCTGAAATGG - Intronic
969506413 4:7590898-7590920 ACACATCACCATATCTATATAGG + Intronic
972574598 4:40340031-40340053 CCACCTCAGCCTATCAAAACAGG - Intronic
975427791 4:74250874-74250896 GGGCTTCAGCATATCTAAAATGG - Intronic
979523527 4:121695134-121695156 CCACACCAGCATATCAAGATAGG + Intronic
982954793 4:161750328-161750350 ACAGTACAGCATATCTCAATTGG - Intronic
983357474 4:166681959-166681981 CCACTCCAGCAGGTCTAGATTGG - Intergenic
983910576 4:173234417-173234439 GAAATTCAGCATATCTAAAAGGG + Intronic
984900026 4:184577953-184577975 CCGCTTCATAATATTTAAATTGG - Intergenic
986886176 5:12239359-12239381 CAACTTCAGCTTATAGAAATCGG - Intergenic
987025943 5:13926420-13926442 CCACATCAGCTTAACTAAAGTGG - Intronic
989383473 5:40831902-40831924 CAACTTAAGAATATGTAAATAGG - Exonic
991395816 5:66204155-66204177 CCTCTGCAGCATATTTATATGGG - Intergenic
992557736 5:77919650-77919672 CTTCTTAAGCATTTCTAAATGGG + Intergenic
994380934 5:99070430-99070452 CAACTTCATCATCTATAAATCGG - Intergenic
994611039 5:102039920-102039942 CCACTTCAGAACCTTTAAATAGG + Intergenic
999116278 5:149166471-149166493 CCTCTTCAGCATTCCAAAATGGG + Intronic
1000392541 5:160740096-160740118 CCACTTTAGCATTTATTAATGGG - Intronic
1001967565 5:175922220-175922242 CCATTTCTGCATCTCTAAAATGG + Intronic
1008003172 6:46382051-46382073 CCACATTAGCATATCAGAATTGG - Intronic
1014646641 6:123981879-123981901 CCAGATCAGCATATCTTACTAGG + Intronic
1021431607 7:20565452-20565474 CCACTTCTTCATTTCTAATTTGG - Intergenic
1023981183 7:45071128-45071150 CCACTTCCCCATCTCTAAAATGG - Intronic
1027351393 7:77315335-77315357 CCATTTCTTCATCTCTAAATTGG + Intronic
1027460813 7:78451219-78451241 CCTATTCATCATATCCAAATGGG + Intronic
1027549443 7:79572932-79572954 CCACAGCAGCATTTCTAACTGGG + Intergenic
1030377008 7:108764332-108764354 CAATTTCAGCATGTCTAAGTAGG - Intergenic
1030519879 7:110585579-110585601 CGACTTCAACATCTCTGAATTGG + Intergenic
1031406122 7:121389575-121389597 CCACTACAGCATTTCTGAGTTGG + Intronic
1031828763 7:126600441-126600463 CCAATTCCCCATATCTACATAGG + Intronic
1039631742 8:39120188-39120210 CCACTTCACAATACCAAAATCGG - Intronic
1040742198 8:50590750-50590772 TGATTTCAGCATATCAAAATAGG + Intronic
1041533732 8:58902365-58902387 CCAAGTCAGCAGTTCTAAATCGG + Intronic
1042982535 8:74546760-74546782 GCACTTCAGCATATTCAATTTGG - Intergenic
1043039617 8:75245130-75245152 TCAATTGATCATATCTAAATGGG + Intergenic
1046116696 8:109793105-109793127 TCACTTCAGCCTCTCTAGATTGG + Intergenic
1046347109 8:112944593-112944615 ACTCTTCAGCATATTTAAGTTGG + Intronic
1058601298 9:106673585-106673607 CCACTTCAACATATTAAAACTGG - Intergenic
1059644151 9:116247803-116247825 CAAATTCAGCATCTCTAAAGTGG - Intronic
1203611736 Un_KI270749v1:13434-13456 ACACTTCAGAATCTCTAACTGGG + Intergenic
1186754433 X:12655461-12655483 CCACATGAGCATCTCTAGATGGG + Intronic
1188235202 X:27720182-27720204 CCACTTCACCATATATATGTGGG + Intronic
1188259372 X:28004291-28004313 CGACTTCAGCATATATACACGGG - Intergenic
1189226832 X:39420180-39420202 CCATTTCAGCATGTCCAAACAGG + Intergenic
1189605771 X:42676291-42676313 CCACTTCAGCATCTCTCGGTGGG + Intergenic
1194956227 X:100184099-100184121 CCACCTCAGAATATCTGCATGGG - Intergenic
1195383571 X:104292792-104292814 TCACCTCAACCTATCTAAATGGG + Intergenic
1198535094 X:137577440-137577462 CCACTTTAGGATTTATAAATGGG + Intronic
1201266057 Y:12207889-12207911 CCATTTGAGCATATCTAGAAGGG - Intergenic