ID: 1106027755

View in Genome Browser
Species Human (GRCh38)
Location 13:25971495-25971517
Sequence CTGAAAGATCAGATGAGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 480}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106027755_1106027758 14 Left 1106027755 13:25971495-25971517 CCTACCCTCATCTGATCTTTCAG 0: 1
1: 0
2: 3
3: 38
4: 480
Right 1106027758 13:25971532-25971554 TCTCTAGCTGTTAACCGCACAGG 0: 1
1: 0
2: 0
3: 3
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106027755 Original CRISPR CTGAAAGATCAGATGAGGGT AGG (reversed) Intronic
901522725 1:9797703-9797725 CTGAAGGAACAGAGGAGGCTTGG + Intronic
901875756 1:12166346-12166368 CGGGAAGATCACTTGAGGGTGGG + Intergenic
902284913 1:15401442-15401464 TTGAAAGATCAGAAGAAGATTGG - Intergenic
903048924 1:20586717-20586739 CTGACAGATCACATGAGGCCAGG + Intergenic
903113623 1:21159737-21159759 CTGGAAGATCAACTGAGGCTGGG + Intronic
903222547 1:21876761-21876783 CTGAAAGAGCACATGTGGCTGGG + Intronic
903622405 1:24707523-24707545 ATGAAAGAGGAGATGAGAGTGGG + Intergenic
905420986 1:37843881-37843903 GTGCAAGATCAGATGGGGGTTGG - Intronic
905750557 1:40459417-40459439 CTGAAAGAACAGGGGAGGTTAGG - Intronic
905839969 1:41167954-41167976 CTTACAGATCAGAAGAGAGTAGG - Intronic
906097653 1:43235115-43235137 CAGAAAAATCAGATGAGGCGTGG - Intronic
906685066 1:47757820-47757842 CTGGCAGAGCAGATGGGGGTGGG + Intergenic
906738780 1:48160038-48160060 CTGAAAGATCATATGAGCTTTGG + Intergenic
906763870 1:48408913-48408935 CTGCAAGATGAGATCTGGGTAGG + Intronic
907638857 1:56165049-56165071 GTCAAAGATCAGATGACTGTAGG + Intergenic
908001273 1:59682719-59682741 CTCTAAGCTCAGAGGAGGGTGGG + Intronic
908379856 1:63586665-63586687 CTACAAGATGAGATTAGGGTGGG + Intronic
908553971 1:65238268-65238290 CTGTAAGATGAGATTTGGGTGGG + Intergenic
909267622 1:73581021-73581043 CTTAAAGATCAGATGGCTGTAGG - Intergenic
909466025 1:75974909-75974931 CTGGCAGATCAGTTGAGGTTAGG - Intergenic
909586176 1:77291280-77291302 CTGAAGGATATGATTAGGGTTGG - Intronic
910254385 1:85232838-85232860 GTCAAAGATCAGATGATTGTAGG + Intergenic
910658788 1:89647551-89647573 CTGAAAGAACACATTTGGGTTGG + Intronic
911375168 1:97043567-97043589 CAGAATGATCAGCTGTGGGTGGG + Intergenic
911380143 1:97104603-97104625 CTGAAGGATAAGGTGAAGGTAGG + Intronic
911706032 1:101014498-101014520 CTGAAGGCTCAGATGATTGTTGG - Intronic
911896717 1:103445415-103445437 TTCAAAGATCAGATGATTGTAGG - Intergenic
912307315 1:108582086-108582108 CTGAAAGCTGAGATGATTGTTGG + Intronic
914353859 1:146864636-146864658 TTCAAAGATCAGATGATTGTAGG + Intergenic
914585763 1:149060346-149060368 CTGGAAGCCCAGATGAGGGATGG - Intronic
914756198 1:150562738-150562760 CTGAGAATTGAGATGAGGGTGGG + Intergenic
915465278 1:156093975-156093997 CTTGGAGATCAGATGAGGGCAGG - Intronic
916683808 1:167126911-167126933 CTGAAACACCAGAAGAAGGTGGG + Exonic
917123088 1:171661442-171661464 CTGAAAGGTCACATGCGGGGAGG - Intergenic
917249088 1:173037823-173037845 ATGAAAGATAAAATGAGGATCGG + Intergenic
918652450 1:186982597-186982619 CTGAATGAACAAATGAAGGTAGG + Intronic
918858850 1:189795210-189795232 GTCAAAGATCAGATGGTGGTAGG + Intergenic
919009313 1:191939274-191939296 GTCAAAGATCAGATGGTGGTAGG + Intergenic
919106662 1:193161076-193161098 ATTAAAGATCAAATGAGGTTTGG - Intronic
919296421 1:195707386-195707408 GTCAAAGATCAGATGATTGTAGG - Intergenic
919519258 1:198567008-198567030 GTTAAAGATCAGATGATTGTAGG + Intergenic
919594301 1:199542876-199542898 GTGAAAGATCAGATGGCGGTAGG - Intergenic
921264157 1:213408592-213408614 CTGGAAGAGCAGATGATAGTTGG - Intergenic
921264464 1:213410909-213410931 TGAAAAGATGAGATGAGGGTTGG + Intergenic
921540574 1:216409582-216409604 CTCAAAGATCAGATGGTGGTAGG - Intronic
921681597 1:218039488-218039510 CTGAGGGATCAGATGGAGGTTGG + Intergenic
921961471 1:221039402-221039424 ATGAAAGAACAGAGGAGGGGAGG + Intergenic
922042244 1:221907822-221907844 CTCAAAAATCAGATGATGCTAGG + Intergenic
922623845 1:227017007-227017029 CTGAAACATCAGATAATAGTCGG - Exonic
922638575 1:227202835-227202857 CAGAAAGATCACATGAGCCTAGG + Intronic
922650262 1:227331841-227331863 CTGAAAGAATAGATGTGGCTGGG - Intergenic
922688640 1:227668851-227668873 CTTAAAGATCAGATGGTTGTAGG + Intronic
924746833 1:246843106-246843128 ATGAAAGATGAAATGTGGGTAGG - Intronic
924889635 1:248260502-248260524 TTCAAAGATCAGATGATTGTAGG - Intergenic
1062936603 10:1395196-1395218 CAGAAAGAACAGATTAGGCTTGG - Intronic
1063426292 10:5952728-5952750 CTGAAAGTTAGGATGAGGGACGG + Exonic
1064458026 10:15506871-15506893 ATGCAAGATCAGATTTGGGTGGG + Intergenic
1064598722 10:16972152-16972174 ATGAAAGATCAGAGGAGAGGAGG - Intronic
1064643356 10:17436234-17436256 ATTAAAGATGAGATGTGGGTGGG - Intronic
1064967629 10:21030906-21030928 CTGAAAGATCAGAGCAGGCCTGG + Intronic
1065370486 10:24980085-24980107 GTGGAAGATCAGATGAGCATGGG - Intergenic
1066040648 10:31545547-31545569 CTAAAAGATGAGATTTGGGTGGG + Intergenic
1066165090 10:32778470-32778492 CTCAAAGATCATATGATTGTAGG + Intronic
1066295715 10:34052623-34052645 AAGAAAGATGAGATGTGGGTGGG - Intergenic
1067199262 10:44152327-44152349 GTCAAAGATCAGATGGTGGTTGG - Intergenic
1068085672 10:52370520-52370542 CTCAAAGATCAGATGGTTGTAGG + Intergenic
1068399246 10:56507722-56507744 ATGCAAGATCAGATTTGGGTGGG - Intergenic
1069132987 10:64729237-64729259 CAGAAAGATGAGGTGAGGATGGG + Intergenic
1069736264 10:70656709-70656731 CTCATAGTTCAGATGAGGCTGGG + Intergenic
1071020226 10:81045284-81045306 GTCAAAGATCAGATGATTGTAGG + Intergenic
1071103293 10:82063815-82063837 CTGATAGATCAAACGATGGTGGG - Intronic
1071799736 10:89045309-89045331 GTCAAAGATCAGATGATTGTAGG + Intergenic
1071991803 10:91107026-91107048 GTCAAAGATCAGATGATTGTAGG + Intergenic
1072509585 10:96106317-96106339 GTCAAAGATCAGATGATTGTGGG + Intergenic
1072550796 10:96475765-96475787 CTGTAAGATGAGATTTGGGTGGG - Intronic
1072958078 10:99904503-99904525 CTGAAACATCCGATGAGGGAAGG - Intronic
1073503039 10:103959311-103959333 CTGAAAGATTAGAAGGGGGAAGG + Intergenic
1075706494 10:124505084-124505106 CAGAAATGTCATATGAGGGTAGG - Intronic
1076415639 10:130286203-130286225 CTCAAAGATCAGTTCAGGTTTGG + Intergenic
1076870757 10:133192350-133192372 GTCAAAGATCAGATGATTGTAGG - Intronic
1076889765 10:133277711-133277733 CTGACAGATCACATGGGGGGGGG + Intergenic
1076988162 11:254153-254175 CAGGGAGAGCAGATGAGGGTAGG - Intergenic
1077991865 11:7419387-7419409 CATAAAGGTGAGATGAGGGTGGG - Intronic
1079392501 11:20034834-20034856 CTGAAAGATGAGAGGAGGCAGGG + Intronic
1079739444 11:24038254-24038276 GTTAAAGATGAGATTAGGGTGGG + Intergenic
1080208848 11:29761727-29761749 CTTAAAGATGAGATTTGGGTGGG + Intergenic
1081010139 11:37801046-37801068 GTCAAAGATCAGATGTGTGTAGG - Intergenic
1081094245 11:38912281-38912303 CTGAAGGCTCAGATGATTGTAGG + Intergenic
1081102036 11:39014427-39014449 CTGAAAAATTATTTGAGGGTGGG + Intergenic
1081835838 11:46153248-46153270 GTCAAAGATCAGATGACTGTAGG + Intergenic
1083333210 11:61908690-61908712 CTGAATGATCAGAGGAGGTGTGG + Intronic
1084666203 11:70577657-70577679 CTGAATGCTCAGGTGGGGGTGGG - Intronic
1084829284 11:71756339-71756361 CTGACTGATCAGCTGGGGGTGGG - Intergenic
1085290119 11:75392169-75392191 CTGAAAGCTCAGATGATCATTGG + Intergenic
1085335884 11:75694851-75694873 GTCAAAGATCAGATGATCGTAGG + Intergenic
1085616908 11:78007208-78007230 GTGAAGGTTCAGATGATGGTTGG + Intergenic
1086293024 11:85332745-85332767 CTCAAAGATCAGATGACTGTAGG + Intronic
1086409968 11:86535251-86535273 CTGGAAGAACAGATGAAGGTAGG - Intronic
1086562868 11:88188276-88188298 CAGAAAGATCAGTTGAGGCCAGG - Intergenic
1086568735 11:88258434-88258456 CTTAAAGATCAGATGGTTGTAGG + Intergenic
1086597242 11:88587448-88587470 TAGAAAGATCATAGGAGGGTGGG + Intronic
1087180129 11:95133817-95133839 CTGAAGGTACAGATGAGGGTTGG + Intergenic
1087474713 11:98621166-98621188 CTACAAGATGAGATTAGGGTGGG - Intergenic
1087774135 11:102242441-102242463 CTGAAAAGTCAGCTGAGGCTGGG + Intergenic
1088856150 11:113755856-113755878 CTGAAGGCTCAGATGATCGTTGG + Intronic
1088966735 11:114730192-114730214 GTCAAAGATCAGATGACTGTAGG + Intergenic
1089237292 11:117041355-117041377 CTGAAGGGCTAGATGAGGGTGGG - Intronic
1089732699 11:120529134-120529156 CTGCAAGAGCACATGAGGGTCGG - Intronic
1089831147 11:121329299-121329321 ATGAAAGCTGATATGAGGGTGGG - Intergenic
1090306329 11:125694288-125694310 CTGGAAGATCTGATGGGGGTTGG + Intergenic
1090729960 11:129562544-129562566 GTCAAAGATCAGGTGAGTGTAGG - Intergenic
1092334125 12:7613779-7613801 GTCAAAGATCAGATGATTGTAGG - Intergenic
1092501566 12:9052598-9052620 TTGAGATATCAGATGATGGTGGG - Intergenic
1093476773 12:19564591-19564613 GTCAAAGATCAGATGATTGTAGG + Intronic
1093618530 12:21258302-21258324 GTCAAAGATCAGATGGGTGTAGG + Intergenic
1095848303 12:46771829-46771851 GTGGAAGAGCAGATGAGGCTTGG - Intronic
1096769481 12:53925605-53925627 CTGAAACAACAGATAAGGGTCGG + Intergenic
1096795246 12:54073039-54073061 CTGAAAGATAAGATTAAGTTGGG - Intergenic
1096929616 12:55192310-55192332 GTGAAAGATCAGATGATTGTAGG + Intergenic
1097229193 12:57498813-57498835 CTGAAGGAGCAGCTGAGGGAGGG + Intronic
1098489396 12:71058215-71058237 CTGCAAGATGAGATTTGGGTGGG - Intronic
1098513972 12:71352497-71352519 GTAAAAGATCAGATGATTGTAGG - Intronic
1099937971 12:89150800-89150822 CTGCAAGATGAGATTTGGGTGGG - Intergenic
1100253999 12:92862778-92862800 ATGATAAATCAGATGCGGGTAGG + Intronic
1101605451 12:106245244-106245266 GTGAAAGTTCAGAAGAGGGAGGG - Intronic
1103121934 12:118387850-118387872 GTGAAAGAACACATGAGGGCCGG - Intronic
1104033880 12:125084938-125084960 CAGGAAGATCACATGAGGTTAGG - Intronic
1105609319 13:21954394-21954416 CTACAAGATGAGATTAGGGTGGG + Intergenic
1106027755 13:25971495-25971517 CTGAAAGATCAGATGAGGGTAGG - Intronic
1106479051 13:30123306-30123328 CTGAAAGGACACATGAGGATGGG + Intergenic
1107187460 13:37540895-37540917 CTGTGAGATCAGAAGAGGATGGG + Intergenic
1107520377 13:41174742-41174764 CAGGAGGATCACATGAGGGTAGG - Intergenic
1110031495 13:70619847-70619869 TTGAAACATCAGATGTGGGGGGG - Intergenic
1110290117 13:73795852-73795874 CTAACAGATCAGATGAAGGAAGG + Intronic
1110796979 13:79650407-79650429 CTAAAATATGGGATGAGGGTTGG - Intergenic
1110810934 13:79809875-79809897 CTGAAGGATGAGATGAAGGAAGG - Intergenic
1110931984 13:81231608-81231630 CTGGAAGATCACTTGAGGTTAGG + Intergenic
1112190125 13:97168866-97168888 CTGAGAGATCAGATGAGACAAGG - Intergenic
1112296373 13:98190840-98190862 TTGAAATATCATATGAGGCTGGG - Intronic
1113064288 13:106358188-106358210 CTACAAGATGAGATGTGGGTGGG - Intergenic
1114131748 14:19800497-19800519 ATGAAAGATCAAGTGGGGGTGGG - Intronic
1115715696 14:36100478-36100500 ATGGAAGATGAGATGAGAGTGGG + Intergenic
1115766008 14:36624496-36624518 CTTAAAGATCTGGTTAGGGTAGG + Intergenic
1116170656 14:41397814-41397836 CTTCAAGATCAGATGAATGTAGG + Intergenic
1116395263 14:44440847-44440869 CTTGAAGATCAGATGATTGTAGG - Intergenic
1116403583 14:44540576-44540598 GTCAAAGATCAGATGACTGTAGG - Intergenic
1117222745 14:53621842-53621864 CTGAAAGCTCAGATGAAGTGAGG - Intergenic
1117413903 14:55476071-55476093 CAGATAGATCACCTGAGGGTAGG - Intergenic
1117419359 14:55528889-55528911 CTGAAAAATCACATGAAGATTGG - Intergenic
1118045094 14:61960968-61960990 GTCAAAGATCAGATGATTGTAGG - Intergenic
1118325973 14:64780925-64780947 GTCAAAGATCAGATGGTGGTAGG - Intronic
1120244361 14:81989097-81989119 CTGAAAGCTCAGATGATGGTCGG + Intergenic
1120444999 14:84584165-84584187 CTCAAAGATCAGATGACTGCAGG - Intergenic
1120575237 14:86173913-86173935 CTGCAAGATGAGATTTGGGTGGG - Intergenic
1121343386 14:93117898-93117920 CTGAAAGACCAGTTGAGGCTGGG + Intergenic
1122368630 14:101214597-101214619 CTGCAAGATGAGATTTGGGTGGG + Intergenic
1122474946 14:102001047-102001069 CTGAAAGGTTACATGAAGGTAGG + Exonic
1123122218 14:105921917-105921939 CTGTAAGGTCAGATGGGGGCTGG + Intronic
1123404882 15:20013482-20013504 CTGTAAGGTCAGATGGGGGCTGG + Intergenic
1123514213 15:21020130-21020152 CTGTAAGGTCAGATGGGGGCTGG + Intergenic
1124003115 15:25775893-25775915 ATGAAATGTCAGATGAGTGTTGG - Intronic
1124237910 15:28005409-28005431 CTGCAGGACCAGAGGAGGGTGGG - Intronic
1124680877 15:31729814-31729836 CTGATAGAGCAGATGTGGATAGG - Intronic
1124808104 15:32906753-32906775 CTATAGGATCAGTTGAGGGTAGG + Intronic
1124988479 15:34646714-34646736 CTGAAAGATCAGTTTATAGTAGG - Intergenic
1126472844 15:49033607-49033629 CTGAAAGATCACTTGAGGTCAGG + Intronic
1126784773 15:52168820-52168842 ATCAAAGATCAGATGATTGTAGG - Intronic
1126939921 15:53756104-53756126 CTGCAAGATGAGATTTGGGTGGG - Intronic
1127022041 15:54759194-54759216 GTCAAAGATCAGATGGGTGTAGG - Intergenic
1128740667 15:70081783-70081805 GTGAAAGATGAGATGAGGAAGGG + Intronic
1128826459 15:70722052-70722074 CTGAAAACTCAGATAAGGGATGG + Intronic
1131782914 15:95879478-95879500 TTAAAAATTCAGATGAGGGTGGG + Intergenic
1132385720 15:101398577-101398599 CTGAAAGCACAGAGGAGGCTCGG + Intronic
1132580522 16:682671-682693 CTGGAAAAGCAGGTGAGGGTGGG + Exonic
1133484331 16:6204179-6204201 GTGAAAGATGAGGTGAGGGTAGG - Intronic
1135863195 16:26076358-26076380 CTGAAAGATCACATTCAGGTAGG + Intronic
1138355240 16:56372581-56372603 CTGAAAGAACAGGCTAGGGTGGG - Intronic
1138921665 16:61537752-61537774 GTCAAAGATCAGATGGGTGTGGG - Intergenic
1139188067 16:64831448-64831470 CTTCAAGATGAGATGTGGGTAGG - Intergenic
1139266916 16:65648525-65648547 CTGACAGATCACTTGAGGTTAGG + Intergenic
1139389595 16:66598361-66598383 CTGAAAGAGGAGAAGTGGGTGGG - Intergenic
1139980162 16:70850884-70850906 TTCAAAGATCAGATGATTGTAGG - Intronic
1140504086 16:75459457-75459479 CTGAAACACAAGATGAGAGTGGG - Intronic
1142661304 17:1431406-1431428 CCCAAAGATCAGATCAGGGAAGG + Intronic
1142800829 17:2344444-2344466 ATGAAAGAACAGATAAGGGAAGG + Intronic
1143674387 17:8421229-8421251 CTGGAAGATCAGAAAGGGGTAGG + Intronic
1143721085 17:8810346-8810368 ATGCAAGATCAGATTTGGGTAGG + Intronic
1144180998 17:12752665-12752687 CTGACAGGTCAGAGGAGGCTGGG - Exonic
1144616371 17:16778391-16778413 CTAAAAGATGAGATTTGGGTGGG - Intronic
1144896328 17:18537261-18537283 CTAAAAGATGAGATTTGGGTGGG + Intergenic
1145135886 17:20406953-20406975 CTAAAAGATGAGATTTGGGTGGG - Intergenic
1145304870 17:21668275-21668297 CTGAATCTTCAGATGAGGGGAGG + Intergenic
1146822454 17:35994917-35994939 GTCAAAGATCAGATGACTGTAGG - Intronic
1149214294 17:54336097-54336119 CTGTAAGATGAGATTTGGGTGGG - Intergenic
1150529540 17:65962617-65962639 CTACAAGATTAGATGTGGGTGGG - Intronic
1150853471 17:68727950-68727972 GTCAAAGATCAGATGATAGTAGG - Intergenic
1150862172 17:68811882-68811904 CTTCAAGATCAGATTTGGGTGGG + Intergenic
1151122963 17:71813348-71813370 GTCAAAGATCAGATGATGGTAGG - Intergenic
1151852847 17:76701213-76701235 CAGAAAGATGAGAGGAGGGAGGG + Intronic
1153394316 18:4601009-4601031 GTGAAAGATCAGATCATGATGGG - Intergenic
1153597652 18:6744282-6744304 CTGAAATATGAGATGAGGGTGGG + Intronic
1154342635 18:13516940-13516962 CGGAAAGATCACTTGAGGTTAGG - Intronic
1156436503 18:37135943-37135965 CTTGAAGATCAGATGACAGTAGG + Intronic
1156747415 18:40409192-40409214 TTGAAAGATCAGATGAGACTTGG + Intergenic
1156931727 18:42652937-42652959 TTGGAAGATCAGATGATTGTAGG - Intergenic
1157078268 18:44492571-44492593 CTGCAAGATGAGATTTGGGTGGG - Intergenic
1157403887 18:47407786-47407808 TTGAAGGATCAGGTGAGGCTTGG - Intergenic
1158281977 18:55838451-55838473 CTGAGAGATAAGAAGAGGGGAGG + Intergenic
1158547732 18:58410313-58410335 CTGTAAACTCAGAGGAGGGTTGG - Intergenic
1158771436 18:60522115-60522137 GTGAAAGATCAGATGGTTGTAGG + Intergenic
1159114930 18:64103321-64103343 CTGAAAGTTCAAATGAGTGTGGG + Intergenic
1159403735 18:67972937-67972959 GTAAAAGATCAGATGATTGTAGG + Intergenic
1159641323 18:70865576-70865598 CTAAAAGATGAGATTTGGGTAGG - Intergenic
1161084800 19:2329939-2329961 CTGACAGAGCAGCTGGGGGTAGG - Intronic
1162890845 19:13732051-13732073 CAGAGAGCTCAGAAGAGGGTAGG + Intronic
1162955716 19:14096885-14096907 CTGAGGGTTCAGATGAGGGGTGG - Intronic
1163413633 19:17172460-17172482 GTGAAATATCAGATCAAGGTAGG + Exonic
1164428642 19:28167499-28167521 CTGAAAGATCACTTGAGGCCAGG - Intergenic
1164656612 19:29926507-29926529 CAGAAAGATCACTTGAGGGAAGG - Intronic
1164685548 19:30164221-30164243 CTGAAGGCTCAGTTGAGTGTTGG - Intergenic
1164933989 19:32197157-32197179 CTGAAATCTGTGATGAGGGTGGG - Intergenic
1167966792 19:53154252-53154274 CAGAAAGATCAGTTGAGGCCAGG + Intronic
925352357 2:3210342-3210364 CTGGAAAAACAGATGTGGGTGGG - Intronic
926104457 2:10141708-10141730 AGGAAAGAGCAGGTGAGGGTGGG + Intronic
926104774 2:10143255-10143277 CTGAAAGATCAGGAGCGGGTGGG - Intronic
926191349 2:10730341-10730363 CTGGAAGATCACTTGAGGTTAGG - Intronic
926450115 2:12993042-12993064 CTGAAAGCTCAGATGATTGCAGG + Intergenic
927330935 2:21863028-21863050 CTGAAAGATTTGATAAGGGGAGG - Intergenic
929756235 2:44768011-44768033 CTGAAAGACCTGAGGAGCGTTGG + Intronic
930321180 2:49856680-49856702 CTGTAAGCCCAGATGAAGGTAGG + Intergenic
931197237 2:60064307-60064329 CAGAAAGATAAGAAGATGGTGGG + Intergenic
933363110 2:81313471-81313493 CTCAAAGATCAGATGGTGGTAGG - Intergenic
933374383 2:81460834-81460856 CTGAAAGGAGAGAAGAGGGTTGG + Intergenic
933482977 2:82880610-82880632 GTCAAAGATCAGATGGGTGTAGG - Intergenic
933638639 2:84735045-84735067 CTGAAAGAGCAGATGGAGGGAGG - Intronic
933679839 2:85089898-85089920 CTGAGACATCAGCTGCGGGTGGG + Intergenic
934920859 2:98344233-98344255 CTGACAGAGCAGGTGAGAGTGGG - Intronic
935079086 2:99774442-99774464 GTCAAAGATCAGATGATTGTGGG - Intronic
935808133 2:106769115-106769137 CTTAAGGATCAGAGCAGGGTAGG - Intergenic
936633445 2:114229611-114229633 GTGGAAGATCAGATGGTGGTAGG + Intergenic
936693369 2:114919062-114919084 CTGATGGATTAAATGAGGGTTGG + Intronic
936788674 2:116124805-116124827 CTTCAAGATGAGATGTGGGTGGG - Intergenic
936878288 2:117218862-117218884 CTGGAAGAGCAGAGGAGGGTGGG + Intergenic
939255078 2:139732871-139732893 CTGCAGGTTCAGATGAGGCTAGG - Intergenic
940081207 2:149803344-149803366 GTCAAAGATCAGATGACTGTAGG + Intergenic
940936407 2:159500308-159500330 CTTGAAGATCAGATGATTGTAGG + Intronic
941077826 2:161026300-161026322 ATGAAAGATCAGATGGTTGTAGG - Intergenic
941581392 2:167300751-167300773 CTAAAATATCAGATGAAGGGAGG + Intergenic
942556659 2:177178449-177178471 CTGGAAAAGCAGGTGAGGGTGGG + Intergenic
943176483 2:184481519-184481541 CTGCAAGATGAGATTTGGGTGGG - Intergenic
943235029 2:185306742-185306764 ATTCAAGATGAGATGAGGGTGGG + Intergenic
944866960 2:203871809-203871831 CTGAAACATGAGATTAGGCTGGG + Intronic
946713265 2:222527651-222527673 CTGACAGAACAGATGGGGTTGGG - Intronic
947003615 2:225486322-225486344 CTGAAAGAATAGCTAAGGGTAGG + Intronic
1169068884 20:2709664-2709686 CTGGAAGCTCAGAGGAGAGTGGG + Intronic
1170237593 20:14124544-14124566 CTGAAATGTCAGATGCGTGTAGG + Intronic
1170691854 20:18623561-18623583 CTGATAGAGCAGATGTGGGGAGG - Intronic
1171231177 20:23487058-23487080 ATCAAAGATCAGATGGTGGTAGG + Intergenic
1171522379 20:25785715-25785737 CTGAATCTTCAGATGAGGGGAGG + Intronic
1171530128 20:25847660-25847682 CTGAATCTTCAGATGAGGGGAGG + Intronic
1171554448 20:26070168-26070190 CTGAATCTTCAGATGAGGGGAGG - Intergenic
1172029080 20:31968827-31968849 CGGAAAGGTCAGATCAGGGCTGG - Intronic
1172253973 20:33500480-33500502 CTGATGGATCAGCTGAGGTTGGG + Intronic
1173389690 20:42621103-42621125 CTGCAAGATGAGATTTGGGTGGG + Intronic
1174712065 20:52717366-52717388 GTGACAGATCAGAAAAGGGTAGG - Intergenic
1175925257 20:62468336-62468358 CTCTATGATCAGATGAGGGCCGG + Intronic
1176229772 20:64026277-64026299 CGGACAGATCACCTGAGGGTGGG + Intronic
1177760436 21:25396647-25396669 CTGAGAGATGAGATGAGGCCTGG - Intergenic
1177836729 21:26193062-26193084 CTGCAAGATGAGATTTGGGTGGG + Intergenic
1178212204 21:30548566-30548588 GTCAAAGATCAGATGACTGTAGG + Intronic
1179020815 21:37639207-37639229 GTGAAAAATCAAAGGAGGGTGGG - Intronic
1179348392 21:40583512-40583534 CTTAAAGTTGAGGTGAGGGTGGG - Intronic
1182276257 22:29190543-29190565 CAGAAAGATCACATGAGGCCGGG + Intergenic
1182913276 22:34005405-34005427 CTACAAGATGAGATGTGGGTGGG + Intergenic
1183882843 22:40850028-40850050 CTGAGAGATCAGTTGAGGTCAGG + Intronic
1184163738 22:42715068-42715090 CAGAAAGATAAGGGGAGGGTGGG + Intronic
1184297996 22:43538237-43538259 CTGAGGGATCAGATGTGGGATGG - Intronic
1184615618 22:45636227-45636249 CTGGAAGGTCAGATGGGGATGGG + Intergenic
1185261937 22:49871598-49871620 CTGAAGGCTCAGATGACTGTTGG - Intronic
949267525 3:2175775-2175797 CTGTATGATCAGATCAGGTTAGG - Intronic
949301319 3:2586940-2586962 CTGAAAAATCAAAGGAGGGAAGG - Intronic
949415891 3:3813866-3813888 TTGAATGATTAGAAGAGGGTGGG - Intronic
949633461 3:5955532-5955554 GTGAAACATCAGATGATTGTAGG + Intergenic
950102524 3:10366739-10366761 CTGAAAGCTCAGCTGTGGCTCGG + Intronic
950245167 3:11408823-11408845 CTGCAAGATGAGATTTGGGTGGG + Intronic
951175723 3:19597230-19597252 GTCAAAGATCAGATGACTGTAGG + Intergenic
951181483 3:19664406-19664428 GTCAAAGATCAGATGGCGGTAGG - Intergenic
951503269 3:23414406-23414428 CTGAAAGCTCAAATGAGGGAAGG - Intronic
952003539 3:28813971-28813993 CTGAAGGCTCAGATGATTGTTGG - Intergenic
953294646 3:41702370-41702392 CAGACAGATCACATGAGGTTGGG - Intronic
953690316 3:45112361-45112383 ATGAAAGTTCTGTTGAGGGTAGG + Exonic
955290676 3:57689764-57689786 CTTAAAGATCAGAGAAGGGCTGG + Intronic
955661897 3:61308350-61308372 CTAAAAGATCAATTGAGGGCAGG + Intergenic
956302252 3:67785068-67785090 CTGCAAGATGAGATTCGGGTGGG - Intergenic
956760846 3:72443162-72443184 CAGAAAGATCACTTGAGGTTAGG + Intronic
956877372 3:73476828-73476850 CTGAAGGCTCAGCTGAGGGTCGG - Intronic
956938473 3:74131135-74131157 CTACAAGATGAGATGTGGGTGGG + Intergenic
956960811 3:74398379-74398401 CTGAAAGCTCAGATGATTGTTGG + Intronic
957285311 3:78210040-78210062 CTGTTAGTTCACATGAGGGTGGG + Intergenic
957684472 3:83483249-83483271 CTAAAAGATGAGATTTGGGTGGG - Intergenic
958013577 3:87912789-87912811 GTCAAAGATCAGATGATTGTAGG - Intergenic
958562786 3:95769387-95769409 GTGAAAGATCAGATGGTTGTAGG - Intergenic
958823222 3:99000396-99000418 ATGAAAGATCAGATGGCTGTGGG + Intergenic
958911582 3:100000178-100000200 CTGAAGGATCAGAAGAAGGCAGG - Intronic
959159467 3:102706146-102706168 CTGAATGATCTGATGAGGTCTGG + Intergenic
959248108 3:103901748-103901770 CAAAAATATCAGATGAGGCTGGG - Intergenic
959795105 3:110417551-110417573 CTGAAAGATCAGATGGCTGTAGG - Intergenic
960416774 3:117394587-117394609 CTGAAATAGCAGATAAGTGTAGG - Intergenic
960489154 3:118290807-118290829 GTGAAAGATCAGATGGTTGTAGG + Intergenic
960804009 3:121565335-121565357 CTGAAAGTTCAGGAGAGGCTGGG + Intergenic
962257121 3:133880115-133880137 GTCAAAGATCAGATGGTGGTGGG - Intronic
962912089 3:139862248-139862270 CTGAAACCTCAGATGTGAGTTGG + Intergenic
963125890 3:141815848-141815870 CTGAAGGCTCAGCTGAGGCTGGG - Intronic
963517003 3:146321690-146321712 ATGAAAGATCAGATGTTTGTGGG - Intergenic
963703472 3:148655915-148655937 CTCAAAGATCAGATGGTTGTAGG + Intergenic
964127965 3:153256376-153256398 CTGGAAGAAAAGATGAGGGTGGG - Intergenic
964459803 3:156911793-156911815 GTCAAAGATCAGATGATTGTAGG + Intronic
965146466 3:164912153-164912175 CTAAAAGATGAGATTTGGGTAGG + Intergenic
965180491 3:165396412-165396434 GTGGAAGATCAGATGACTGTAGG - Intergenic
965850084 3:173012628-173012650 GTCAAAGATCAGATGATGTTAGG - Intronic
966632548 3:182094723-182094745 CTGACAGATCAGATGTGGGGTGG - Intergenic
967283351 3:187843885-187843907 CTGGTAGGTCAGATGAGGCTGGG - Intergenic
967508240 3:190278672-190278694 GTCAAAGATCAGATGATTGTAGG + Intergenic
967880637 3:194298878-194298900 CTGATACATCAGATGAGGCCTGG + Intergenic
968037837 3:195563273-195563295 GCGAAAGAGCAGATGTGGGTTGG + Intergenic
969751132 4:9112129-9112151 CTGACTGATCAGCTGGGGGTGGG - Intergenic
969834383 4:9828184-9828206 CTGATGGAGCAGATGTGGGTGGG - Intronic
971078375 4:23177562-23177584 GTCAAAGATCAGATGATTGTAGG - Intergenic
971305638 4:25478498-25478520 GTCAAAGATCAGATGATTGTAGG - Intergenic
971380427 4:26092215-26092237 CAAAAAAATCAGATGAGGCTGGG - Intergenic
971845007 4:31907002-31907024 CTAAAAGATGAGATTTGGGTGGG + Intergenic
971845549 4:31913771-31913793 CTGCAAGATGAGATTTGGGTGGG - Intergenic
972241700 4:37200236-37200258 GTCGAAGATCAGATGAGTGTAGG + Intergenic
973106817 4:46349052-46349074 CTGAAGGCTCAGATGATTGTTGG + Intronic
974026270 4:56736102-56736124 CTGCAAGATGAGATTTGGGTGGG + Intergenic
974525203 4:63042460-63042482 ATGAAAGATGAGATTTGGGTGGG + Intergenic
975379714 4:73685045-73685067 CTCAAAGATGAGATGATTGTTGG + Intergenic
975804189 4:78095821-78095843 CTAAAAGATGAGATTTGGGTAGG + Intronic
976392699 4:84522164-84522186 CATAAAGATCAGAAGAAGGTTGG + Intergenic
978353419 4:107844472-107844494 CTGAAAGATCACATGAGCCCAGG + Intronic
979033863 4:115686488-115686510 GTCAAAGATCAGATGACTGTAGG + Intergenic
979390001 4:120117234-120117256 CTACAAGATGAGATGTGGGTGGG + Intergenic
979576964 4:122304176-122304198 CTAAAAGCTCAGATGATTGTTGG + Intronic
979927762 4:126589148-126589170 GTGAAAGATCAGTTGACTGTAGG - Intergenic
980025286 4:127758761-127758783 GTTAAAGATCAGTTGAGTGTAGG + Intronic
980333166 4:131435819-131435841 GTGGAAGATCAGATGATTGTAGG + Intergenic
980824850 4:138060908-138060930 GTGAAAGATCAGATGGTTGTAGG + Intergenic
981198693 4:141951672-141951694 CTCAAAGATCAGATGGCTGTAGG - Intergenic
981669495 4:147271478-147271500 CTTACAGACCAGATGAGAGTGGG - Intergenic
981669577 4:147272867-147272889 CTTACAGAGCAGATGAGAGTGGG - Intergenic
983109878 4:163736525-163736547 CTGAAACTGCAGATAAGGGTTGG + Intronic
983980206 4:173986591-173986613 CTGATGGATCAGATGTGGATGGG - Intergenic
984023473 4:174515363-174515385 GTCAAAGATCAGATGATTGTAGG - Intronic
984253419 4:177361914-177361936 CTGTAAGATCAGGTGAGGTGCGG - Intronic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
987179828 5:15355984-15356006 CTGAAAAATGGGATTAGGGTAGG + Intergenic
987644648 5:20652915-20652937 CTCAAAGATCAGATGGTTGTAGG - Intergenic
987936237 5:24468836-24468858 CAGACAGATCACATGAGGTTGGG - Intergenic
989218184 5:38926668-38926690 CTGAAATATAAGATGAGATTTGG + Intronic
989466273 5:41759119-41759141 CTGAAAGGGCAGATGTGGGTGGG + Intronic
990786363 5:59424735-59424757 ATTAAAGATGAGATGTGGGTGGG + Intronic
991174572 5:63672103-63672125 GTCAAAGATGAGATGATGGTAGG - Intergenic
991439081 5:66627343-66627365 CTAAAAGATTAGATTTGGGTGGG + Intronic
992032444 5:72735578-72735600 GTCAAAGATCAGATGATTGTAGG + Intergenic
993144835 5:84080472-84080494 CTGCAAGAACAGAAGAGAGTTGG - Intronic
993286655 5:86007879-86007901 GTCAAAGATCAGATGGTGGTAGG + Intergenic
994256673 5:97604883-97604905 GTCAAAGATCAGATGACTGTAGG - Intergenic
995147529 5:108803616-108803638 ATGAAAGATCAGATGGCTGTAGG + Intronic
995270108 5:110210224-110210246 ATGGAAGATCAGATGATTGTGGG + Intergenic
995498996 5:112782340-112782362 CTGCAAGATGAGATTTGGGTGGG + Intronic
995703825 5:114964322-114964344 GTCAAAGATCAGATGGTGGTAGG + Intergenic
996899283 5:128525166-128525188 CTGAAAGATCAGTTGAGGCAAGG + Intronic
997066109 5:130561182-130561204 GTCAAAGATCAGATAATGGTAGG - Intergenic
997577092 5:134988197-134988219 CTGAAGGCTCAGATGATTGTTGG - Intronic
999380130 5:151115554-151115576 CTGGAAGATCAATTCAGGGTTGG + Intronic
1000530914 5:162418705-162418727 GTCAAAGATCAGATGACTGTAGG - Intergenic
1000624660 5:163525340-163525362 CTACAAGATGAGATGTGGGTGGG + Intergenic
1000798663 5:165696546-165696568 GTCAAAGATCAGATGATTGTAGG - Intergenic
1001058889 5:168471497-168471519 CTCAAAGCTCAGAGGAGTGTAGG - Intronic
1001095135 5:168770188-168770210 CAGCAAGATCAGTTTAGGGTTGG - Intronic
1001703692 5:173726091-173726113 GTCAAAGATCAGATGACTGTAGG - Intergenic
1001718543 5:173837355-173837377 GTGCAAGATCAGATTTGGGTGGG - Intergenic
1001878437 5:175221227-175221249 CTAAAAGGTCAGAACAGGGTAGG + Intergenic
1002952372 6:1826972-1826994 CAGAAAGATCACCTGAGCGTAGG + Intronic
1003605165 6:7553254-7553276 CTGAGCTATAAGATGAGGGTGGG - Intronic
1003706182 6:8533283-8533305 CTGAATGCTCAGATGATTGTTGG + Intergenic
1003727906 6:8786874-8786896 CAGAGAGAAGAGATGAGGGTAGG + Intergenic
1003976379 6:11348626-11348648 ATCAAAGATCAGATGATTGTAGG - Intronic
1005153708 6:22780176-22780198 ATGAAAGATAAGATTTGGGTGGG - Intergenic
1005178137 6:23071513-23071535 GTCAAAGATCAGATGATTGTAGG + Intergenic
1005251187 6:23948348-23948370 GTGGAAGATCAGATGACTGTAGG - Intergenic
1007448167 6:41922964-41922986 CTTACAGATCAGATGTGGGGAGG - Intronic
1007954695 6:45906001-45906023 GTGGAAGATCAGATGACCGTAGG + Intronic
1007986725 6:46214794-46214816 CTGAAAGAGAAGAAGAGGGATGG - Intergenic
1008248348 6:49206918-49206940 CTAAAAGATGAGATTTGGGTTGG + Intergenic
1009300409 6:62010541-62010563 CTGTAAGATGAGATTTGGGTGGG - Intronic
1009461246 6:63916237-63916259 CTGAAGGCTCAGATGATTGTTGG + Intronic
1009824905 6:68855906-68855928 CTGCAAGATGAGATTTGGGTGGG - Intronic
1010507750 6:76681194-76681216 ATGACAGATCATATGAGGGTGGG + Intergenic
1010783159 6:79969027-79969049 GTCAAAGATCAGATGATTGTAGG - Intergenic
1011334118 6:86241475-86241497 GTCAAAGATCAGATGACTGTAGG - Intergenic
1011621582 6:89248740-89248762 CCAAAAGAACAGATGAGGGCTGG - Intergenic
1011737184 6:90322849-90322871 CTGAAGGCTCAGATGATTGTTGG - Intergenic
1011985256 6:93435755-93435777 GTGAAAGATCAGATGGTTGTAGG - Intergenic
1013261190 6:108444313-108444335 CTGAAAGTTCAGATGATTATTGG - Intronic
1014179478 6:118369276-118369298 GTCAAAGATCAGATGATTGTAGG - Intergenic
1014794847 6:125713177-125713199 CTGAAAGATGAGATTTGTGTGGG + Intergenic
1015731973 6:136358214-136358236 CTGAAAGAACAGATAAGGAAAGG + Intronic
1016352678 6:143184803-143184825 CATAAAGATAAGATGAGGATGGG - Intronic
1017357909 6:153531627-153531649 CTCAAAGATCAGATTATTGTAGG + Intergenic
1019757988 7:2787553-2787575 CGGAAAGCTCAGAAGATGGTGGG - Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1021189891 7:17608060-17608082 GTAAAAGATCAGATGACTGTAGG - Intergenic
1022616107 7:31931917-31931939 CTCAAAGATCAGATGGTTGTAGG - Intronic
1022690225 7:32642893-32642915 CTGAAGGTTCAGATGATCGTTGG + Intergenic
1022876732 7:34540972-34540994 GTCAAAGATCAGATGATTGTAGG + Intergenic
1024850470 7:53709605-53709627 CTGCAAGATGAGATTTGGGTGGG - Intergenic
1025282866 7:57640892-57640914 CTGAATCTTCAGATGAGGGGAGG + Intergenic
1025301849 7:57824526-57824548 CTGAATCTTCAGATGAGGGGAGG - Intergenic
1026355296 7:69552141-69552163 CAGGAAAAGCAGATGAGGGTTGG - Intergenic
1026795767 7:73365091-73365113 CTGAAAGTGCAGCTGAGGCTGGG + Intergenic
1027340044 7:77197420-77197442 CTTAAAGCTCAGGTGAAGGTGGG - Intronic
1027506654 7:79024184-79024206 CTCAAAGATCAGATGATTGTAGG - Intronic
1027783712 7:82552791-82552813 GTCAAAGATCAGATGACTGTAGG + Intergenic
1029647468 7:101867268-101867290 CAGAAAGATCAGAGAAGGGAAGG + Intronic
1030111034 7:106027099-106027121 TTGAAAGAACAGATAAGGCTGGG + Intronic
1031282959 7:119828126-119828148 CTGAGGGATAGGATGAGGGTAGG + Intergenic
1031301721 7:120068858-120068880 CTACAAGATGAGATTAGGGTGGG - Intergenic
1031868450 7:127065588-127065610 ATGAAAGATAAGAAGAGTGTTGG + Intronic
1032860644 7:135876085-135876107 CTGAGAGGTCAGATGAAGGCAGG - Intergenic
1033524078 7:142193065-142193087 TTGAAAGATTAGATGATGGTTGG - Intronic
1033707590 7:143903979-143904001 CTGCAAGATGAGATTTGGGTGGG + Intergenic
1034114557 7:148572228-148572250 CTGCAAAGTAAGATGAGGGTGGG + Intergenic
1035016358 7:155769842-155769864 CTTAAAGAACAGATGTGTGTGGG + Intronic
1035660220 8:1342103-1342125 CAGAAAAATCAGCTGGGGGTAGG - Intergenic
1036009393 8:4704505-4704527 CTGAAACATCAGATTAGGAAGGG - Intronic
1036657031 8:10683375-10683397 CTGAGAAATCAGATGTGGGAAGG - Intronic
1037811867 8:22091200-22091222 CTGTTAGATCAGAAGAGGGCGGG - Intronic
1038311272 8:26448287-26448309 CTGTAAGATCTGAAGGGGGTGGG + Intronic
1038326217 8:26574834-26574856 CAGAAAGATCAGTTGAGGCTGGG - Intronic
1038518659 8:28209900-28209922 CTCAAAGATCAGATGGTTGTAGG - Intergenic
1039211459 8:35220021-35220043 CTGAAAGATCACTTGAGGCCTGG - Intergenic
1039598261 8:38810371-38810393 CAGAAAGATCAGTTGAGGCCAGG + Intronic
1039781994 8:40794957-40794979 CTGGAAGCTCAGAAGAGGGAGGG + Intronic
1039946612 8:42134850-42134872 CAGAAAGATCATTTGAGGGCAGG - Intergenic
1040091109 8:43399830-43399852 GTCAAAGATCAGATGGTGGTAGG + Intergenic
1041371649 8:57167154-57167176 CTGAAAGAAAAAATGAGGGAGGG - Intergenic
1041580154 8:59449416-59449438 GTCAAAGATCAGATGATTGTAGG - Intergenic
1041865658 8:62570683-62570705 CTGCAAGATGAGATTTGGGTGGG + Intronic
1042227004 8:66521977-66521999 ATGAAAGATCAGAAGAGAGCTGG + Intergenic
1043080459 8:75759583-75759605 CTAAAAGATAAGATTTGGGTGGG - Intergenic
1043574188 8:81638691-81638713 CTGACAGATCACATGAGGCCAGG + Intergenic
1044640473 8:94375283-94375305 CTGCAAGATGAGATTTGGGTGGG - Intronic
1045037870 8:98190548-98190570 CTGACAGATCATCTGAGGTTAGG - Exonic
1046096948 8:109573820-109573842 CAGAATGATAGGATGAGGGTGGG - Intergenic
1046662905 8:116967955-116967977 CTGCACAAACAGATGAGGGTTGG + Intronic
1046697707 8:117360514-117360536 ATGAAAAATCAGAAGAGGCTGGG + Intergenic
1046699824 8:117387730-117387752 ATTAAAGATCAGGTGAGGGGAGG + Intergenic
1046927178 8:119804400-119804422 CTGCAAGATGAGATTTGGGTGGG - Intronic
1048023166 8:130559409-130559431 TTAAAACATCAGAAGAGGGTGGG + Intergenic
1048325269 8:133434304-133434326 CTGAGAGAAGAGATGAGGGCAGG - Intergenic
1048679337 8:136822369-136822391 GTCAAAGATCAGATGGGGCTGGG - Intergenic
1050250690 9:3741174-3741196 CAGAAAGATCAGAGGAGAGGCGG + Intergenic
1050617042 9:7412361-7412383 GTGAAAGATCAGATGGCTGTAGG - Intergenic
1050617916 9:7421815-7421837 GTGAAAGATCAGATGATTGTAGG + Intergenic
1050634400 9:7595961-7595983 GTAAAAGATCAGATGATTGTAGG - Intergenic
1050648203 9:7745119-7745141 GTCAAAGATCAGATGATTGTAGG + Intergenic
1051886641 9:21899880-21899902 GTCAAAGATCAGATGATTGTAGG - Intronic
1052242333 9:26289223-26289245 GTGAAAGATCAGATGGTTGTAGG + Intergenic
1052250088 9:26388121-26388143 GTAAAAGATCAGATGATTGTGGG + Intergenic
1052660809 9:31428534-31428556 CTGAAAGAACAGATGAGAGAAGG + Intergenic
1053048677 9:34940522-34940544 CAGAAAGATCAGTTGAGGCCAGG + Intergenic
1053144818 9:35705289-35705311 CTGTAGGCCCAGATGAGGGTCGG + Intronic
1053535700 9:38923463-38923485 GTCAAAGATCAGATGGTGGTAGG + Intergenic
1054207921 9:62147868-62147890 GTCAAAGATCAGATGGTGGTAGG + Intergenic
1054630432 9:67440485-67440507 GTCAAAGATCAGATGGTGGTAGG - Intergenic
1055133516 9:72803083-72803105 GTCAAAGATCAGATGACTGTAGG - Intronic
1055843117 9:80530326-80530348 GTCAAAGATCAGATGATTGTAGG - Intergenic
1055912270 9:81366293-81366315 GTCAAAGATCAGATGATTGTAGG - Intergenic
1055998646 9:82190759-82190781 ATTAAAGATGAGATGTGGGTGGG - Intergenic
1056273793 9:84973009-84973031 TTGAAAGCTCAGATGAAGTTTGG - Intronic
1057290568 9:93803741-93803763 GTCAAAGATCAGATGATTGTAGG - Intergenic
1057867483 9:98692964-98692986 CTCAAAGAAGAGATGGGGGTAGG + Intronic
1058325629 9:103693743-103693765 CTGATGGATCAGCTGAGGTTAGG - Intergenic
1058938655 9:109792619-109792641 CCTAAAAATCAGTTGAGGGTGGG + Intronic
1060638976 9:125222897-125222919 CTGAAGGATCACTTGAGGCTAGG - Intronic
1186223142 X:7370776-7370798 CTGAAAGAGCAGAAGAGAATTGG - Intergenic
1186269093 X:7865615-7865637 CTGAAAGATCAGATGTAGGTTGG + Intergenic
1186653396 X:11586462-11586484 GTCAAAGATCAGATGATTGTAGG + Intronic
1188298038 X:28473928-28473950 GTAAAAGATCAGATGGGGATGGG - Intergenic
1188327300 X:28821644-28821666 CTTAGAGATCAAATGAGGCTAGG - Intronic
1188384595 X:29540631-29540653 GTCAAAGATCAGATGACTGTAGG - Intronic
1189766330 X:44375983-44376005 GTGAAAGATCAGATGGTTGTAGG + Intergenic
1190135509 X:47792999-47793021 CTCAAAAATCAGTTGAGGCTGGG - Intergenic
1190879843 X:54484276-54484298 CTGCAAGAACACATGAGGGTGGG - Intronic
1191651757 X:63546185-63546207 CTTAAAGATCAGATAATTGTAGG - Intergenic
1191785937 X:64917273-64917295 CTTAAGGATGAGATGAGGGTAGG + Exonic
1192767033 X:74151124-74151146 GTCAAAGATCAGATGATTGTGGG - Intergenic
1193066702 X:77267969-77267991 GTCAAAGATCAGATGATTGTAGG - Intergenic
1193285356 X:79707649-79707671 CTGAAGGATCTGATGATCGTTGG - Intergenic
1193417895 X:81246596-81246618 GTCAAAGATCAGATGACTGTAGG + Intronic
1193917486 X:87382994-87383016 CTGCAAGATGAGATTTGGGTGGG - Intergenic
1194194753 X:90879128-90879150 GTCAAAGATCAGATGATTGTAGG + Intergenic
1194199761 X:90940216-90940238 ATCAAAGATCAGATGATTGTAGG + Intergenic
1194406708 X:93505112-93505134 CTGAAAGATTATTTGAGGTTAGG + Intergenic
1195068117 X:101255543-101255565 CTGCAACTTCAGATGAGGGAGGG - Intronic
1195121745 X:101761187-101761209 GTCAAAGATCAGATGACTGTGGG + Intergenic
1195993096 X:110702713-110702735 CATAAATATCAGATGGGGGTTGG - Intronic
1196010649 X:110884117-110884139 GTCAAAGATCAGATGATTGTTGG + Intergenic
1196933604 X:120706697-120706719 GTCAAAGATCAGATGCGTGTAGG - Intergenic
1197129180 X:122984501-122984523 CTGAAAGGTTAGATGATTGTCGG - Intergenic
1197638363 X:128941633-128941655 CTGAATGATAAGATGAGGTTTGG - Intergenic
1198895308 X:141447878-141447900 GTCAAAGATCAGATGATCGTAGG + Intergenic
1199461930 X:148094344-148094366 CTTAAAGATGAGATTTGGGTGGG + Intergenic
1200035474 X:153325862-153325884 GTCAAAGATCAGATGATCGTAGG + Intergenic
1200257508 X:154592128-154592150 CTTCAAGATCAGATGTGGGTGGG - Intergenic
1200340887 X:155394417-155394439 GTCAAAGATCAGATGATTGTAGG - Intergenic
1200541371 Y:4461539-4461561 GTCAAAGATCAGATGATTGTAGG + Intergenic
1200545751 Y:4516632-4516654 ATCAAAGATCAGATGATCGTAGG + Intergenic
1200829369 Y:7676445-7676467 TGGAAAGATCAGTTGAGGCTGGG - Intergenic
1202198615 Y:22323838-22323860 ATCAAAGAGCTGATGAGGGTGGG - Intronic