ID: 1106030418

View in Genome Browser
Species Human (GRCh38)
Location 13:25997104-25997126
Sequence CCACCGTGCCCCCACCTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 107}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106030408_1106030418 21 Left 1106030408 13:25997060-25997082 CCTCCTGCCTTGGCCTCCCAAAG 0: 25113
1: 73031
2: 147530
3: 156446
4: 127492
Right 1106030418 13:25997104-25997126 CCACCGTGCCCCCACCTTATAGG 0: 1
1: 0
2: 0
3: 8
4: 107
1106030411_1106030418 14 Left 1106030411 13:25997067-25997089 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1106030418 13:25997104-25997126 CCACCGTGCCCCCACCTTATAGG 0: 1
1: 0
2: 0
3: 8
4: 107
1106030413_1106030418 8 Left 1106030413 13:25997073-25997095 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1106030418 13:25997104-25997126 CCACCGTGCCCCCACCTTATAGG 0: 1
1: 0
2: 0
3: 8
4: 107
1106030409_1106030418 18 Left 1106030409 13:25997063-25997085 CCTGCCTTGGCCTCCCAAAGTGC 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036
Right 1106030418 13:25997104-25997126 CCACCGTGCCCCCACCTTATAGG 0: 1
1: 0
2: 0
3: 8
4: 107
1106030416_1106030418 4 Left 1106030416 13:25997077-25997099 CCAAAGTGCTGGGATTACAGGTG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
Right 1106030418 13:25997104-25997126 CCACCGTGCCCCCACCTTATAGG 0: 1
1: 0
2: 0
3: 8
4: 107
1106030415_1106030418 5 Left 1106030415 13:25997076-25997098 CCCAAAGTGCTGGGATTACAGGT 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
Right 1106030418 13:25997104-25997126 CCACCGTGCCCCCACCTTATAGG 0: 1
1: 0
2: 0
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106030418 Original CRISPR CCACCGTGCCCCCACCTTAT AGG Intronic
900154842 1:1199760-1199782 CCAGCGTGCACCCTCCTCATGGG - Intergenic
901434688 1:9239973-9239995 CCCCCTGGCCCCCACCTTCTGGG + Intronic
901456999 1:9368700-9368722 CCACCCTGCCCCCGGCTTCTCGG - Exonic
902633219 1:17718217-17718239 CCACCGTGCCCACATCTTCAGGG - Intergenic
904341137 1:29835694-29835716 CCACCTGGTCCCCACCTAATGGG - Intergenic
909011545 1:70340823-70340845 CCACCGTGCCCGCCCCCAATAGG - Intronic
910318593 1:85917993-85918015 ATACCGTGCCCAAACCTTATTGG + Intronic
912689569 1:111794348-111794370 CAGCCGTGCCCCCACCTGAGAGG - Intronic
913496655 1:119433798-119433820 GCTCCTTGCCCCCACCTTCTGGG + Intergenic
921261452 1:213388432-213388454 CCACCAGGCCCCCACCTGAGTGG - Intergenic
924702207 1:246465544-246465566 CCACCGTGCCCCGCCCCGATAGG - Intronic
1064944202 10:20770240-20770262 CCACCCTGCTCCCACCTTCAAGG - Intergenic
1069358355 10:67613787-67613809 CCACGGTTCCCCAACCTTTTTGG + Intronic
1076332071 10:129677604-129677626 CCACCATGTCCCCACCTGACAGG + Intronic
1077471938 11:2767929-2767951 CCACTGGGCCCCCACCCTGTTGG + Intronic
1077490132 11:2857277-2857299 CTACCATGCCCCCAGCTGATGGG + Intergenic
1077516469 11:3004776-3004798 CCACCGTGCCCTCACCTGAGTGG - Intronic
1079300433 11:19274228-19274250 CCACCATGCCCGCGCCATATGGG - Intergenic
1082814248 11:57497865-57497887 TCACGGTGTCCCCACCTCATGGG - Intronic
1084569079 11:69948881-69948903 TCACCGTCACCCCTCCTTATTGG - Intergenic
1088774799 11:113071710-113071732 CCACCATGCCCCCAGCCTGTTGG + Intronic
1091172328 11:133530076-133530098 CCCCCCTGCCCCCATCTTCTGGG - Intronic
1096192722 12:49630890-49630912 CCACCCTGCCCTCACATTAATGG - Intronic
1099289772 12:80762114-80762136 CCACCCTGCCCCCACATTCAGGG - Intergenic
1100708908 12:97232354-97232376 CCACAGTGCCCCGACTGTATTGG + Intergenic
1101051260 12:100866457-100866479 CACCCCTGCCCCCACCTTTTTGG + Intronic
1101191687 12:102340414-102340436 CCACCTTACCCCCACTTAATAGG - Intergenic
1105578227 13:21672247-21672269 CCACCCGGCCACCACCTTCTTGG - Intronic
1106030418 13:25997104-25997126 CCACCGTGCCCCCACCTTATAGG + Intronic
1111924395 13:94447196-94447218 CCACCGGTCCCCAACCTTTTTGG + Intronic
1117285169 14:54279689-54279711 CCTCCTTGCCCCCAGGTTATAGG - Intergenic
1121105230 14:91275018-91275040 CCACCGCGCCCCCACTCTCTGGG - Intronic
1124557141 15:30736485-30736507 CAACCCTGCCCCCACCTGATGGG + Intronic
1124674123 15:31669262-31669284 CAACCCTGCCCCCACCTGATGGG - Intronic
1127090003 15:55457433-55457455 TAACCTTGCCCCCACCTGATGGG + Intronic
1128980843 15:72184447-72184469 CAGCCGTGCCCCCACCTGCTGGG + Intronic
1131552299 15:93367800-93367822 CCACCGCGCCCCCAGCCTAAAGG - Intergenic
1132754462 16:1475793-1475815 CCACCCTGTCCCCACCTTCTGGG + Intergenic
1133054437 16:3138482-3138504 CCTCCGTGCCCCCACCGTCGGGG - Exonic
1135516938 16:23143872-23143894 CCACCCTGCCCCCACCCCCTGGG - Intronic
1138921398 16:61533885-61533907 CCATCTTGCCCCCACTTTCTTGG - Intergenic
1140410398 16:74737602-74737624 CCACTCTGTCCCCACCTTCTAGG + Intronic
1143103329 17:4515698-4515720 CCACCTGGCTCCGACCTTATCGG - Intronic
1143660336 17:8320796-8320818 GCTCCCTGCCCCCACCTCATTGG + Intronic
1143772612 17:9178321-9178343 CCACCCTCCTCCCACCTGATGGG + Intronic
1144831561 17:18134273-18134295 CCACCGTGCCCCGGCCTGTTGGG + Intronic
1145005707 17:19336570-19336592 CCATCGTGCTCCCTCCTGATGGG + Exonic
1145064465 17:19752783-19752805 CCACTGTGTCCACACCTTCTGGG + Intergenic
1145942221 17:28748555-28748577 CCACAGTGCCCACACCACATTGG - Exonic
1146020722 17:29276354-29276376 TCACCTTGCCCCCATCTTAGGGG + Intronic
1151091872 17:71449500-71449522 CCACAGTGTCCACACCTTCTGGG + Intergenic
1151956850 17:77384417-77384439 CCACCCTGCCCCCACCTCCCCGG - Intronic
1155202985 18:23533791-23533813 CCACCGTGGCCAGCCCTTATGGG + Intronic
1160754199 19:749206-749228 CCACAGTGCCCCCAGCTCATGGG + Intergenic
1161886118 19:6997169-6997191 CCACCATGGCACCACCTTAGTGG - Intergenic
1161954050 19:7483098-7483120 CCACCGTGACCCCGCCCCATCGG + Intronic
1162760767 19:12887025-12887047 CCACCTAGACCCCACCTTCTAGG + Intronic
1163074705 19:14879546-14879568 CCACCGTGCCTGCACTTGATAGG + Intergenic
1163248500 19:16111812-16111834 GCACCGAGCCCGCCCCTTATTGG - Exonic
1163681457 19:18684611-18684633 TCACCTGGCCCCCACCATATGGG - Intronic
1164872357 19:31656616-31656638 CCACCGTGCCGCCTCCTTCCCGG - Intergenic
1168408938 19:56126510-56126532 CCACCGTGCCCAGACGGTATTGG - Intergenic
927939372 2:27094110-27094132 CCACGGTGCCCCCACATGCTTGG + Intronic
929622423 2:43368964-43368986 CCACCCTGCCCCTATCTTTTAGG + Intronic
936009549 2:108916703-108916725 CCATCTTGCCCCCACCTCCTCGG - Intronic
936174800 2:110210344-110210366 CCACCGTCCCCCCATTTTAGTGG - Intergenic
937253047 2:120536119-120536141 CCACCGTGCAGCCCCCTTAAAGG + Intergenic
949037478 2:241822483-241822505 CCACCCTGCTCCCGCCTTCTGGG + Intergenic
1168944432 20:1739914-1739936 CTGCCGTGCTCTCACCTTATAGG + Intergenic
1168966470 20:1901499-1901521 ACACACTGCCCCCACCTCATAGG - Intronic
1172297665 20:33824833-33824855 CCACCCTCCCCCCACCCTTTTGG - Intronic
1173497306 20:43528907-43528929 CCACCCTGCCAGCCCCTTATGGG - Intronic
1176365925 21:6032820-6032842 CCACTGTGCACCCACCAGATTGG + Intergenic
1179757591 21:43505725-43505747 CCACTGTGCACCCACCAGATTGG - Intergenic
1180073325 21:45449534-45449556 CCACCCTGCCCCCACCGTGGGGG + Intronic
1182507117 22:30791612-30791634 CCACCGTGCCCCGCTCATATTGG + Intronic
1182698088 22:32209788-32209810 TCACCCTGCCCTGACCTTATGGG - Intergenic
1184731006 22:46371128-46371150 CCAACCTGCCCCCACCTCAGTGG + Intronic
950097133 3:10336982-10337004 CCAGCCTGCCCCCACCTCCTGGG - Intronic
951925668 3:27906513-27906535 CCACCGTGGCCCCAGCTGCTAGG - Intergenic
952203719 3:31158046-31158068 GCACCGTGCTCTCACCTTGTTGG - Intergenic
954095000 3:48319265-48319287 ACACAGTGCCCTCACCTTAGTGG + Intronic
955719005 3:61862245-61862267 CCAGCGGTCCCCCACCTTTTGGG - Intronic
961871166 3:129989175-129989197 CCACCATGCCCGGCCCTTATGGG + Intergenic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
968149441 3:196325485-196325507 CCACCGTGCCCGGCCCATATTGG + Intronic
968480085 4:829396-829418 CCACCCTGCTCCCATCTTCTGGG + Intergenic
970418604 4:15883441-15883463 CCATCCTGCCCCCACGTTGTTGG - Intergenic
973567741 4:52205334-52205356 CCACCCTGCCCCCACCTTTGGGG - Intergenic
979633431 4:122929404-122929426 CCACCGCGCCCAGCCCTTATTGG - Intronic
982451049 4:155552580-155552602 TAACCCTGCCCCCACCTGATGGG + Intergenic
982730319 4:158948889-158948911 CCACCGTGCCCCACCATTAATGG + Intronic
985534110 5:453611-453633 CCGCCGTGACCCCACCTTGCTGG + Exonic
987817871 5:22927455-22927477 CCACCATGCCCAGCCCTTATAGG + Intergenic
988076689 5:26363180-26363202 CCATCTTGGCCCCACCTAATTGG + Intergenic
998604231 5:143617182-143617204 CCACCGTGCCCTCCCCTGACAGG - Intergenic
1006806673 6:36793575-36793597 CCAACCTGCTCCCACCTTCTTGG + Intronic
1007664935 6:43508524-43508546 CCACCTTACCCCCACCATAGAGG + Intronic
1009713664 6:67358763-67358785 CCAACGTGCACCCATCTTTTGGG - Intergenic
1018090994 6:160347389-160347411 CCCCCACGCCCCCACGTTATCGG - Intergenic
1019547224 7:1584322-1584344 CTACAGAGCCCCCACCTCATTGG + Intergenic
1019653224 7:2172101-2172123 CAACAGTGCCCCCACCTCAAAGG + Intronic
1020036464 7:4966261-4966283 CCACCATGCCCCGCCCTTCTTGG - Intergenic
1026066198 7:67075328-67075350 CCACCCTGCCCCCACTTCACAGG - Intronic
1036578609 8:10052430-10052452 CCAGCGGTCCCCCACCTTTTTGG - Intergenic
1036648518 8:10626867-10626889 CCACTGTGCTCCAACCTGATAGG + Intronic
1038533811 8:28339504-28339526 TCTCCTTGCCCCCAGCTTATTGG - Intronic
1048142222 8:131805441-131805463 CCACCCTGCCCCCAGCTGACAGG + Intergenic
1055026386 9:71726864-71726886 CCACTCTGCCCTCAGCTTATGGG - Intronic
1057905979 9:98983885-98983907 CCAACTTGCCACCATCTTATTGG - Intronic
1061195878 9:129106853-129106875 CACCCGTGCCCCCACCTCATTGG + Intronic
1190032059 X:46983450-46983472 CCACCTAGCCCCCAACTCATGGG - Intronic
1190063744 X:47226622-47226644 CCACAGTGTCACCACCTCATTGG - Exonic
1190453341 X:50602377-50602399 CCACCGTGCCCAGCCCTTGTTGG + Intronic
1197713325 X:129687777-129687799 CCACCGTGCCCAGCCCTTATTGG + Intergenic
1200127283 X:153821831-153821853 CCACCTGGCCCCCACCTTTCCGG + Intronic