ID: 1106030665

View in Genome Browser
Species Human (GRCh38)
Location 13:25999295-25999317
Sequence TCAGTCTACCAGCTCTCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106030663_1106030665 6 Left 1106030663 13:25999266-25999288 CCAGGGATCACTAGGCACAGTGC 0: 1
1: 0
2: 2
3: 11
4: 105
Right 1106030665 13:25999295-25999317 TCAGTCTACCAGCTCTCCATGGG 0: 1
1: 0
2: 0
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106030665 Original CRISPR TCAGTCTACCAGCTCTCCAT GGG Intronic
907878994 1:58525978-58526000 TGAGTCTATTAGCTATCCATAGG + Intronic
909261838 1:73500023-73500045 TATGTCTACCACCTCTCCACTGG - Intergenic
909818076 1:80022226-80022248 TCAGCTTACCAGTTCTCCATAGG - Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
915574923 1:156769152-156769174 TCAGACTCCCAGCTCTGCCTAGG + Intronic
917850460 1:179059146-179059168 TCAGTCTCCATGCTCTCCTTGGG - Intronic
918903594 1:190459831-190459853 TCAGTCTTTCAGTTTTCCATGGG - Intronic
922417360 1:225433600-225433622 TCAGCCATCCAGCTCTCCAGAGG + Intergenic
1068449150 10:57164340-57164362 TCACTCTTCCTTCTCTCCATGGG - Intergenic
1072274003 10:93804421-93804443 ACAGTCTGCCAGCTCCCCACTGG + Intergenic
1072309539 10:94141324-94141346 TCAGTCTCCCAGCTCAAAATGGG - Intronic
1074935522 10:118175984-118176006 TCAGTTTACCAGCACACCATTGG - Intergenic
1074961426 10:118449321-118449343 TCAGTTTACCAGCTCTGAAATGG + Intergenic
1077464377 11:2726593-2726615 TCAGTCCACCAGATCTTCACCGG - Intronic
1079547939 11:21657397-21657419 TCAGGCCTCCACCTCTCCATTGG - Intergenic
1083663529 11:64262965-64262987 TCAGTCTCCCTGCCCTCCTTAGG + Intronic
1085712517 11:78842820-78842842 TCTGCCTACCACCCCTCCATAGG - Intronic
1086492456 11:87369260-87369282 TCATTCTGCCAGATCTCCCTGGG - Intergenic
1086700506 11:89896346-89896368 TCAGTCTTCATGCTGTCCATAGG + Intergenic
1086705663 11:89948180-89948202 TCAGTCTTCATGCTGTCCATAGG - Intergenic
1089492369 11:118892073-118892095 TCAGGAGACCATCTCTCCATGGG - Intronic
1090734113 11:129596413-129596435 TCACTCTACCCACTCTCCATTGG - Intergenic
1096583826 12:52606272-52606294 TCTGTCTGCCAGTTCTCCTTTGG + Intergenic
1096605017 12:52758521-52758543 TCTGTATACCTGCTCTCCAGTGG - Intergenic
1100819133 12:98414776-98414798 TCCTTCCACCAGCTCTCCTTTGG + Intergenic
1101606220 12:106248624-106248646 TCACTCTCCCAGCCCGCCATGGG + Intronic
1106030665 13:25999295-25999317 TCAGTCTACCAGCTCTCCATGGG + Intronic
1107197187 13:37666850-37666872 TCATTCTACCAATTCTCCCTGGG + Intronic
1108213228 13:48159016-48159038 TCTGTCAACCATCTCTCCCTTGG - Intergenic
1109378079 13:61524091-61524113 TCAGTCTCCCATCTCATCATTGG + Intergenic
1115979838 14:39038398-39038420 TTAGACTACAAGCTCTCCAAAGG + Intronic
1116790511 14:49335186-49335208 TGATCCTCCCAGCTCTCCATGGG + Intergenic
1116941960 14:50799291-50799313 TCAGTCTAGCAGCTCTGCCCAGG + Intronic
1117253799 14:53958064-53958086 TCAGTCTTCCAGCACTCCTCTGG - Intronic
1118756617 14:68849554-68849576 TAGGTCTCCCAGCTCTCCAGAGG - Intergenic
1124905704 15:33866634-33866656 CCAGTCTTCCAGCTCTTCCTCGG + Exonic
1125018775 15:34964332-34964354 TCTGTCTTCCAGCTCTACAATGG - Intronic
1127715598 15:61646126-61646148 CCAGTCTTCCAGCTCACCAAAGG + Intergenic
1129054847 15:72811879-72811901 TCTCTCTACCAGCTCTCCTAGGG + Intergenic
1130135128 15:81176139-81176161 TCAGTGTGGCAGCTCTCCATGGG + Intronic
1130733574 15:86524598-86524620 TCTGTCTCCCATCTCTCCAGAGG + Intronic
1131089973 15:89616623-89616645 GCATTCTATAAGCTCTCCATGGG + Intronic
1133109078 16:3534964-3534986 TCATTCTACTTGCTCTCCCTAGG - Intronic
1135244695 16:20845437-20845459 TTAGTCTTCCAGATCTCCAAGGG + Intronic
1141714960 16:85721620-85721642 TCAATCTGGCAGCTCTACATGGG + Intronic
1144677626 17:17172036-17172058 TCAGTTTACAAGCTCTCAAAAGG - Intronic
1149771926 17:59329379-59329401 TCATTTCACCAACTCTCCATTGG + Intergenic
1151279955 17:73066036-73066058 GCTGTCTACCACCTCTCCTTTGG - Intronic
1156958839 18:42998311-42998333 TCAGTTTACCACATCTCTATAGG + Intronic
1157896686 18:51475649-51475671 TCAGTCCACCAGCTCCCTGTGGG - Intergenic
1159649882 18:70965589-70965611 TCAATCTACCACATCTCCTTAGG - Intergenic
1168114040 19:54211030-54211052 ATAGTCTACCAGCTCTGCAGAGG + Intronic
926672792 2:15591552-15591574 TCAGTCCCCCAGCTTTCCAAAGG - Intronic
928282705 2:29963396-29963418 TCTTTCTACCAGTTCTCCAGAGG + Intergenic
939564204 2:143767309-143767331 TTGGTATTCCAGCTCTCCATAGG + Intronic
940460497 2:153958227-153958249 TCAGTCTCCCAACTCTCAGTGGG - Intronic
946882464 2:224190469-224190491 TCAGTCTAAAATCTCTTCATTGG - Intergenic
1169852341 20:10065859-10065881 TCACACTACGAGCTCTCCCTAGG + Intergenic
1170531950 20:17302074-17302096 TTTGTCTAACATCTCTCCATAGG + Intronic
1176677018 21:9788371-9788393 TCAGTCTCCCAGTTCTACCTGGG + Intergenic
1179566403 21:42251747-42251769 TGAGTCTCCCAGCTCTCTCTGGG - Intronic
1181168443 22:20995374-20995396 TCATTCCCCCAGCTCTCCCTGGG + Intronic
949587817 3:5459922-5459944 TCAGTCATCCATCTGTCCATGGG + Intergenic
953046126 3:39295299-39295321 TCTGTGTGCCAGCTGTCCATGGG - Intergenic
953619283 3:44518923-44518945 TAAGTCCAACAGCTCTTCATAGG + Intergenic
954041036 3:47887478-47887500 TCAGCCTCCCACCCCTCCATGGG + Intronic
956738313 3:72255856-72255878 TCTGTCTGCCAGCTCTCATTAGG + Intergenic
959403863 3:105936754-105936776 TCAGTCAACCAAATCTTCATGGG - Intergenic
959454665 3:106543909-106543931 TCACTCTACCAAATCTGCATCGG + Intergenic
960496466 3:118381714-118381736 GCTGTCTACCAGATCTCCATGGG - Intergenic
961759661 3:129157071-129157093 TCATTCTACAATCTCTCCTTAGG + Intronic
967905713 3:194498030-194498052 TCAGTCAACCAGCTGTAGATGGG - Exonic
974852674 4:67422383-67422405 GAAGTCTACTAGCTCTCCTTGGG + Intergenic
976396629 4:84562717-84562739 TCACTGTAACAGCTCTCCAAAGG + Intergenic
977846417 4:101773063-101773085 ACAGTCTGTCATCTCTCCATAGG + Intronic
978908984 4:114043756-114043778 TCAGTGTACCAATTCTCAATAGG - Intergenic
981077648 4:140607172-140607194 TCAGTTTACAAACTCACCATTGG - Intergenic
981509814 4:145543660-145543682 TCATTCTTCCAGCTCTACATAGG + Intronic
983933403 4:173477480-173477502 AGAGTATCCCAGCTCTCCATAGG - Intergenic
984278560 4:177639350-177639372 GCATTCTCCCAGCTCTTCATGGG + Intergenic
984278766 4:177641463-177641485 GCATTCTCCCAGCTCTTCATGGG - Intergenic
985398526 4:189570413-189570435 TCAGTCTCCCAGTTCTACCTGGG - Intergenic
987022157 5:13885627-13885649 TCAGTCTAGAGGCTCTCCAAGGG + Intronic
989505368 5:42220713-42220735 TGACTCCACCATCTCTCCATAGG + Intergenic
992979192 5:82149822-82149844 TCATTCTACCACCTTCCCATAGG - Intronic
999687753 5:154117717-154117739 TCTGTCTTCCAGCTTTCCCTGGG + Intronic
1005823068 6:29613823-29613845 TCAGTGTCACAGCTCTTCATTGG - Intronic
1007367990 6:41408003-41408025 CTAGTCTACCAGCTCCCCAGGGG + Intergenic
1008469974 6:51873995-51874017 TCAATATACTAGCTCTCCCTGGG - Intronic
1011782035 6:90800352-90800374 TCAGTCTAGTTGTTCTCCATTGG + Intergenic
1019080790 6:169428206-169428228 CCAGTCTTCTAGCTCTCCACTGG - Intergenic
1019488524 7:1300457-1300479 TCTGTCTACCTCCTCCCCATCGG - Intergenic
1021005454 7:15389364-15389386 TCAGTGTACCATTTCTCAATTGG + Intronic
1035467846 7:159091367-159091389 TCAGTCCCCCAGCCATCCATGGG - Intronic
1040966443 8:53085989-53086011 TCAGTCTCCCAGCTATTCAAGGG + Intergenic
1042970537 8:74403450-74403472 TCAGTTTACCCGTTCTACATAGG + Intronic
1045562434 8:103278212-103278234 TTGGACTACCATCTCTCCATAGG - Intergenic
1048387744 8:133928387-133928409 TCAGTCTTCCAGGTCATCATTGG + Intergenic
1048724619 8:137368802-137368824 ACAGTCTCCCAGCTCTCCTAAGG - Intergenic
1052584630 9:30410897-30410919 TCATTCTACAAGGCCTCCATCGG - Intergenic
1059452807 9:114381314-114381336 TCAGTCTCCGAGCTGGCCATTGG + Exonic
1062627507 9:137449914-137449936 TCACTGTACCTTCTCTCCATTGG + Exonic
1197555050 X:127942741-127942763 CCAAACTACCAGCTCTTCATAGG - Intergenic
1198022657 X:132674500-132674522 TCACTCTAGCAGCTCACCACAGG + Intronic
1198078233 X:133214504-133214526 TCTGTCTACTACATCTCCATGGG + Intergenic
1200165833 X:154034552-154034574 TGAGTCTTACAGCTCTCAATGGG + Intronic