ID: 1106031474

View in Genome Browser
Species Human (GRCh38)
Location 13:26009417-26009439
Sequence GCATCTGCGCACGTGTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 86}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106031471_1106031474 -10 Left 1106031471 13:26009404-26009426 CCCTGCACTGAGGGCATCTGCGC 0: 1
1: 0
2: 1
3: 10
4: 101
Right 1106031474 13:26009417-26009439 GCATCTGCGCACGTGTGGTGTGG 0: 1
1: 0
2: 1
3: 15
4: 86
1106031466_1106031474 1 Left 1106031466 13:26009393-26009415 CCCCAGCTCTGCCCTGCACTGAG 0: 1
1: 0
2: 6
3: 75
4: 603
Right 1106031474 13:26009417-26009439 GCATCTGCGCACGTGTGGTGTGG 0: 1
1: 0
2: 1
3: 15
4: 86
1106031463_1106031474 20 Left 1106031463 13:26009374-26009396 CCCTCTCCATGCTTCAGAACCCC 0: 1
1: 0
2: 3
3: 27
4: 255
Right 1106031474 13:26009417-26009439 GCATCTGCGCACGTGTGGTGTGG 0: 1
1: 0
2: 1
3: 15
4: 86
1106031464_1106031474 19 Left 1106031464 13:26009375-26009397 CCTCTCCATGCTTCAGAACCCCA 0: 1
1: 2
2: 2
3: 21
4: 276
Right 1106031474 13:26009417-26009439 GCATCTGCGCACGTGTGGTGTGG 0: 1
1: 0
2: 1
3: 15
4: 86
1106031467_1106031474 0 Left 1106031467 13:26009394-26009416 CCCAGCTCTGCCCTGCACTGAGG 0: 1
1: 0
2: 3
3: 84
4: 654
Right 1106031474 13:26009417-26009439 GCATCTGCGCACGTGTGGTGTGG 0: 1
1: 0
2: 1
3: 15
4: 86
1106031465_1106031474 14 Left 1106031465 13:26009380-26009402 CCATGCTTCAGAACCCCAGCTCT 0: 1
1: 0
2: 2
3: 47
4: 381
Right 1106031474 13:26009417-26009439 GCATCTGCGCACGTGTGGTGTGG 0: 1
1: 0
2: 1
3: 15
4: 86
1106031461_1106031474 29 Left 1106031461 13:26009365-26009387 CCCTGGACACCCTCTCCATGCTT 0: 1
1: 1
2: 2
3: 16
4: 253
Right 1106031474 13:26009417-26009439 GCATCTGCGCACGTGTGGTGTGG 0: 1
1: 0
2: 1
3: 15
4: 86
1106031469_1106031474 -1 Left 1106031469 13:26009395-26009417 CCAGCTCTGCCCTGCACTGAGGG 0: 1
1: 0
2: 7
3: 55
4: 523
Right 1106031474 13:26009417-26009439 GCATCTGCGCACGTGTGGTGTGG 0: 1
1: 0
2: 1
3: 15
4: 86
1106031462_1106031474 28 Left 1106031462 13:26009366-26009388 CCTGGACACCCTCTCCATGCTTC 0: 1
1: 1
2: 0
3: 42
4: 384
Right 1106031474 13:26009417-26009439 GCATCTGCGCACGTGTGGTGTGG 0: 1
1: 0
2: 1
3: 15
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106031474 Original CRISPR GCATCTGCGCACGTGTGGTG TGG Intronic
900257501 1:1704705-1704727 GCATCTGCGCCCGGGTGCAGGGG - Intronic
900440152 1:2650862-2650884 TCAGCTGCTCACCTGTGGTGTGG - Intronic
900497099 1:2980713-2980735 GCAGCTGGGCCCATGTGGTGGGG + Intergenic
902186081 1:14726414-14726436 GCATCTCAGCAGGTGTGGAGCGG + Intronic
902830334 1:19008343-19008365 GTGTCTGGGCAGGTGTGGTGTGG - Intergenic
905874748 1:41425153-41425175 GTGTCTGTGCATGTGTGGTGTGG + Intergenic
907332778 1:53682124-53682146 GCATCTGTGCAGGGCTGGTGCGG - Intronic
914674702 1:149899720-149899742 GCAACTGCGTACTTGTGGTTGGG - Intronic
922712455 1:227844373-227844395 GCTTCTCCCTACGTGTGGTGGGG + Intronic
1062794922 10:337622-337644 GTGTGTGCGCACGTGTGTTGTGG + Intronic
1063463058 10:6226500-6226522 GTGTCTGTGCACGTGTGTTGTGG + Intronic
1067352382 10:45488135-45488157 GCATCTCCTCACCTGTGGTGTGG - Intronic
1068568330 10:58600118-58600140 GCTTCTGCCCATGTGTGTTGGGG + Intronic
1070480270 10:76875456-76875478 GCATCGGTGGATGTGTGGTGGGG + Intronic
1072624838 10:97104652-97104674 GTAGCTGGGCACGTGTGGTGGGG - Intronic
1073567104 10:104544348-104544370 GCATCTGCTCACTTCTGGTGAGG + Intergenic
1076090665 10:127682928-127682950 GCATATGCGCACGTGGAGCGAGG - Intergenic
1076278774 10:129227356-129227378 GCATGTGTGCCCCTGTGGTGGGG + Intergenic
1076542126 10:131220938-131220960 GCAGCTGGGCACCTGCGGTGTGG + Intronic
1083325552 11:61871267-61871289 GCATCTGCGCCAGTGTGGGGCGG - Intergenic
1086853692 11:91841121-91841143 GCATCTGCACATGTGCGCTGGGG - Intergenic
1091497907 12:988598-988620 GCATCTGCTCAGTTCTGGTGAGG + Intronic
1097955077 12:65476195-65476217 GCAGCTGCACACTTGAGGTGAGG + Intronic
1103415259 12:120738781-120738803 GCAGCTGCTGACCTGTGGTGTGG + Intronic
1105015569 12:132784771-132784793 GCACATGTGCATGTGTGGTGTGG - Intronic
1106031474 13:26009417-26009439 GCATCTGCGCACGTGTGGTGTGG + Intronic
1110694325 13:78470411-78470433 GCATCTGCAGACATGTGGTGTGG + Intergenic
1112363699 13:98739637-98739659 GCATCTGCTCACTTCTGGGGAGG - Intronic
1113363576 13:109654839-109654861 TCATGTGAGCATGTGTGGTGTGG + Intergenic
1113363578 13:109654911-109654933 GCGTGTGAGCATGTGTGGTGTGG + Intergenic
1113363581 13:109655039-109655061 GCATGTGAGCATGTGTGGTGTGG + Intergenic
1120427841 14:84373263-84373285 GCATCTGCTCACTTCTGGTGAGG + Intergenic
1120747963 14:88168655-88168677 GCATCTGCCCTCATGTGGAGTGG - Intergenic
1129413104 15:75360612-75360634 GCAGCTGTGCACGTGGGTTGGGG - Exonic
1132636477 16:952311-952333 GCATCAGGGCACCTGTGGGGGGG - Intronic
1142591562 17:1008436-1008458 CCGTGTGCGCGCGTGTGGTGAGG - Intronic
1143015335 17:3888532-3888554 GCATCTCACCACGTGCGGTGAGG - Intronic
1147747670 17:42705244-42705266 GGATGTGCACATGTGTGGTGGGG + Intronic
1148876595 17:50690945-50690967 GCAAGTGTGCACATGTGGTGCGG + Intronic
1153942233 18:9988260-9988282 GCCTCGGCGCAGGTGGGGTGAGG + Intergenic
1160389063 18:78516742-78516764 CCATCTGCCATCGTGTGGTGAGG - Intergenic
1160814967 19:1030919-1030941 GCATCTGCGTGGGTGTGGTGAGG + Intronic
925350794 2:3199726-3199748 GCATCTGGGCACGCATGGGGAGG + Intronic
925350811 2:3199789-3199811 GCATCTGGGCACGCATGGGGGGG + Intronic
926189918 2:10721144-10721166 GCACCTGCGCACCTGTTGCGCGG + Intergenic
927668227 2:25046865-25046887 GCACATGCGCACATGTGCTGTGG - Intronic
932362115 2:71117980-71118002 GCCTCTGTGCAGGGGTGGTGTGG - Intronic
935812819 2:106816891-106816913 GAATCTGTGCACTTGTGGGGAGG + Intronic
937263983 2:120604611-120604633 GCATCTACTCAGGTTTGGTGAGG - Intergenic
937823173 2:126334795-126334817 GGATCTGCCCAGGTGTGGAGTGG - Intergenic
944895874 2:204164187-204164209 ACATTTGGGTACGTGTGGTGTGG + Intergenic
946310845 2:218881736-218881758 GCATGTGCGTAAGTGTGCTGGGG + Intronic
946335270 2:219031529-219031551 GCAGCTGCCCATGTGTGCTGTGG - Exonic
948790361 2:240373599-240373621 GCATCTGCGCAGGTGCTGTGGGG + Intergenic
1168863945 20:1068207-1068229 GCATGTTCAGACGTGTGGTGAGG + Intergenic
1175188981 20:57198691-57198713 CCATCTGGCCACGGGTGGTGGGG - Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1176276013 20:64269814-64269836 GAATGTGGGCACGCGTGGTGTGG + Intronic
1178052478 21:28763294-28763316 GCATCTTCTCACTTCTGGTGAGG + Intergenic
1182121300 22:27788723-27788745 GCATGTGCGCATGCGTGGAGGGG + Intronic
1182585637 22:31343005-31343027 GCATATGTGCCTGTGTGGTGGGG - Intronic
1183263919 22:36814180-36814202 GTATCTGCCCACCTGCGGTGAGG + Intronic
1184641893 22:45877265-45877287 GCATCTTCCCATGTGTGGAGGGG + Intergenic
956537757 3:70297001-70297023 GTATGTGCGTATGTGTGGTGGGG - Intergenic
963299323 3:143581269-143581291 CTATGTGGGCACGTGTGGTGGGG + Intronic
965572916 3:170189482-170189504 GCATCTGCACACTTGTAGTGAGG - Intergenic
967948840 3:194824817-194824839 GCCTCTGCGTGCGTGTGGTGAGG + Intergenic
968660635 4:1797417-1797439 CCATCTGCCCGTGTGTGGTGGGG - Intronic
971077321 4:23164938-23164960 GCGTGTGTGCATGTGTGGTGGGG - Intergenic
972901415 4:43688972-43688994 GCCTCTGGGCACCTGTAGTGAGG + Intergenic
981400070 4:144303451-144303473 GCAGCTCCACAGGTGTGGTGGGG - Intergenic
986324804 5:6664329-6664351 GCATCTGCAAACTCGTGGTGAGG - Intronic
986806297 5:11311726-11311748 GCATATGGGCATGTGAGGTGAGG - Intronic
988560448 5:32276244-32276266 GCATGTGAGCACGTGTACTGGGG - Intronic
994652118 5:102541916-102541938 GCATCTGAGGAAGTGTAGTGTGG + Intergenic
1003563936 6:7206696-7206718 GCATCTGCACAAGTAGGGTGTGG + Intronic
1006146748 6:31963945-31963967 GCAACTGGGCACGTGTGCGGAGG - Exonic
1006981814 6:38153649-38153671 GCAACTGCGCACGCCAGGTGGGG + Exonic
1014193443 6:118524769-118524791 GCATCTGCACACTTGTGGAGTGG - Intronic
1019142398 6:169956977-169956999 GCATCTGAGGGGGTGTGGTGGGG + Intergenic
1019142410 6:169957011-169957033 GCATCTGAGGGCGTGTGGTGGGG + Intergenic
1019142438 6:169957080-169957102 GCATCTGAGGGGGTGTGGTGGGG + Intergenic
1019142452 6:169957114-169957136 GCATCTGAGGGGGTGTGGTGGGG + Intergenic
1019142466 6:169957148-169957170 GCATCTGAGGGGGTGTGGTGGGG + Intergenic
1019142515 6:169957286-169957308 GCATCTGAGGGGGTGTGGTGGGG + Intergenic
1026575237 7:71566160-71566182 GCTTCTGGCCAGGTGTGGTGTGG - Intronic
1035293295 7:157853679-157853701 GCATCTCCGCACGTGTGGCTCGG - Intronic
1036652378 8:10653590-10653612 GCGTGTGCGCACATGTGATGTGG - Intronic
1037586705 8:20281756-20281778 GCATCTGCTCAGCTCTGGTGAGG - Intronic
1037895662 8:22652505-22652527 GCATGTGCGCATGTGTGGTGGGG + Intronic
1043361344 8:79475976-79475998 GCATGTGTGCACATGTGGTGAGG - Intergenic
1048178314 8:132172498-132172520 GCATGTGTGCACATGTGGAGGGG - Intronic
1048962998 8:139595446-139595468 GCATATTAGCATGTGTGGTGGGG + Intergenic
1049024052 8:139976621-139976643 GGATCTGCGCACGGCTCGTGAGG + Intronic
1057314208 9:93958523-93958545 GCAGCTGCGCCCCTGGGGTGGGG - Intergenic
1057895378 9:98904641-98904663 GCATCTGCTCATGTGTGGCAGGG + Intergenic
1060977924 9:127776349-127776371 GCCTCTGTGCACCTGGGGTGGGG + Intronic
1061194895 9:129102290-129102312 GCACGTGGGCACGTGTGCTGGGG + Intronic
1061307515 9:129740595-129740617 GCATGTGCATATGTGTGGTGGGG + Intronic
1062294606 9:135817725-135817747 GCAGGTGTGCACGTGTGGGGTGG + Intronic
1198802837 X:140464934-140464956 GCATCTGTGAAAGTGTGGAGGGG - Intergenic