ID: 1106034041

View in Genome Browser
Species Human (GRCh38)
Location 13:26027777-26027799
Sequence TTGTAGCTTTAGTAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 421}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106034041 Original CRISPR TTGTAGCTTTAGTAGGTGGA AGG (reversed) Intergenic
901006845 1:6175959-6175981 TGGTTGGTTTTGTAGGTGGATGG + Intronic
901499292 1:9641674-9641696 TTGTGGGTTTTGCAGGTGGAGGG - Intergenic
901518527 1:9765705-9765727 TTGTATTTTTAGTAGAGGGAGGG - Intronic
902821063 1:18943805-18943827 ATGTCTCTTTTGTAGGTGGAGGG + Intronic
903684268 1:25119575-25119597 TTGTATTTTTAGTAGATGCAGGG + Intergenic
904228075 1:29041305-29041327 TTGTACCTTTAGTAGAGGCAGGG - Intronic
905558423 1:38906498-38906520 TTGTATTTTTAGTAGGGGCAGGG - Intronic
906982659 1:50648321-50648343 TTGTAGGTATTCTAGGTGGAAGG + Intronic
907195476 1:52683055-52683077 TTGTATCTTTAGTAGAGAGAGGG + Intergenic
908273446 1:62444084-62444106 TTGTATTTTTAGTAGGGGCAGGG - Intronic
909606492 1:77513665-77513687 TTGTATTTTTAGTAGGGGCAAGG - Intronic
910821810 1:91358833-91358855 ATGTACCTTTAGGAGGTGGCTGG - Intronic
911130244 1:94380526-94380548 TTGTAGTTTTAGTAGATGTGAGG + Intergenic
911156490 1:94642490-94642512 TTTTAGCTTCAGCAAGTGGATGG - Intergenic
911229952 1:95350514-95350536 TTGTAGCTTTCATAGGGGAAAGG + Intergenic
911336388 1:96585431-96585453 TTGTAGCTTTGGTAGATAAATGG - Intergenic
914354994 1:146877168-146877190 TTGTATTTTTAGTAGATGCAGGG - Intergenic
915851613 1:159330153-159330175 TTGTAGTTTTAGTAGAGAGAGGG - Intergenic
916021492 1:160796563-160796585 TTGTATTTTTAGTAGGGGCAGGG + Intronic
916911289 1:169350016-169350038 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
917695898 1:177523728-177523750 TTCTCCCTTTAGTTGGTGGATGG + Intergenic
917760075 1:178147314-178147336 TTGTATTTTTAGTAGAGGGAGGG - Intronic
918334911 1:183499160-183499182 TGGTTGCTTCAGTAGGTGAATGG + Intronic
918969171 1:191392019-191392041 TTGTATTTTTAGTAGGGGCAGGG - Intergenic
920583650 1:207136833-207136855 TTCTTGCTCTAGTAGGGGGAGGG - Intronic
920698477 1:208199913-208199935 TCATAGATTTAGTAGCTGGAGGG - Intronic
921858504 1:220015288-220015310 TTGTAGCTTTAGTAGAGGCAGGG - Intronic
923604283 1:235429159-235429181 TTGTATTTTTAGTAGATGCAGGG + Intronic
1062775145 10:138281-138303 TTGTATTTTTAGTAGGGGGCCGG + Intronic
1063879106 10:10512585-10512607 TTGTATTTTTAGTAGGGGTAGGG + Intergenic
1064327094 10:14361591-14361613 TTGTATCTTCACTTGGTGGAAGG - Intronic
1065888203 10:30097573-30097595 TTGTATTTTTAGTAGATGCAGGG - Intronic
1065911670 10:30311972-30311994 TTGTAGTTTTAGTAGGGACAGGG - Exonic
1065931720 10:30485359-30485381 TTGTAGTTTTAGTAGAGGTAGGG + Intergenic
1068178363 10:53491218-53491240 TTGTAGTTTTAGTAGAGGCAGGG - Intergenic
1068815467 10:61305540-61305562 TTGTAGTTTTAGTAGATACAGGG - Intergenic
1069214383 10:65801251-65801273 TTTTTCCCTTAGTAGGTGGAAGG + Intergenic
1070042701 10:72797396-72797418 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1070516688 10:77214629-77214651 TTGAAGCTCTAGTGAGTGGAGGG - Intronic
1070581656 10:77724997-77725019 TTGTGGCTTTTGCAGGTGCAGGG - Intergenic
1071389286 10:85154743-85154765 TTGTATTTTTAGTAGGGGCAGGG - Intergenic
1071541999 10:86493827-86493849 TTGTATTTTTAGTAGAGGGAGGG - Intronic
1072704792 10:97673334-97673356 TTGTATCTTTACTAACTGGAGGG + Intronic
1073411464 10:103345653-103345675 TTGTATTTTTAGTAGGGGCAGGG - Intronic
1074656609 10:115596276-115596298 TTGTACTTTTAGTAGATGCAGGG + Intronic
1077768681 11:5190697-5190719 TTGCAGCTTTTCTAGGTGCACGG - Intergenic
1077820805 11:5738323-5738345 CTGTAGCTGTAGCAGGTGGGTGG - Intronic
1077932264 11:6745915-6745937 TTGTAGCTCTTGTGGTTGGATGG + Intergenic
1080380944 11:31771803-31771825 TTGTATCTTTAGTAGATACAGGG - Intronic
1080824340 11:35835298-35835320 TTGTATTTTTAGTAGGGGCAGGG + Intergenic
1081176823 11:39937571-39937593 TTGTAAATTTTGTTGGTGGATGG - Intergenic
1081813154 11:45924373-45924395 TTTGCGCTTCAGTAGGTGGAGGG - Intronic
1083559857 11:63664778-63664800 TTGTATTTTTAGTAGATAGAAGG + Intronic
1084442722 11:69184368-69184390 TTGTATTTTTAGTAGATGCAGGG + Intergenic
1085083644 11:73652627-73652649 TTGTAGATTTGGGATGTGGAGGG + Intronic
1085094686 11:73750526-73750548 TTGTATTTTTAGTAGATGGGGGG + Intronic
1086300325 11:85420742-85420764 CTGAAGCTTGAGTAGGTGGTTGG - Intronic
1086968937 11:93059561-93059583 ATGTGGCTTTAGTTTGTGGAAGG + Intergenic
1088321027 11:108554747-108554769 TTGTATCTTTAGTAGATAGGGGG - Intronic
1088567169 11:111184369-111184391 CTGTAGCTTTTGCAGGTGCAGGG - Intergenic
1088606224 11:111535829-111535851 TTGTAGTTTTAGTAGATACAGGG + Intronic
1088712331 11:112519761-112519783 TTGTATTTTTAGTAGGGGGGCGG + Intergenic
1089483461 11:118826434-118826456 TTGTAGCTTTAGTAGAGATAGGG - Intergenic
1089516136 11:119032924-119032946 TTGTAATTTTAGTAGGGGTAGGG + Intergenic
1089830172 11:121320364-121320386 TTGTATTTTTAGTAGGGAGACGG - Intergenic
1090343989 11:126052648-126052670 TTGTAGTTTTAGTAGGGACAGGG - Intronic
1090499353 11:127246756-127246778 TTCTTGCTTTTGTTGGTGGAGGG + Intergenic
1091313758 11:134596273-134596295 TTGTAGTTTTAGTAGGCATAGGG + Intergenic
1091505661 12:1065171-1065193 TTGTATTTTTAGTAGAGGGAGGG + Intronic
1091930403 12:4391207-4391229 TTGTAGTTTTAGTAGGGACAGGG + Intergenic
1092059250 12:5535150-5535172 CTGTAGCTTTAGGAGAGGGATGG + Intronic
1092811395 12:12274368-12274390 TTGTATTTTTAGTAGGGGCAGGG + Intergenic
1092902146 12:13069963-13069985 TAGTAGGTATAGTAGGTTGAAGG + Intronic
1093359628 12:18207596-18207618 TTGTAGCTTGAGTGGCTGGGAGG - Intronic
1093539631 12:20265923-20265945 TTGTATTTTTAGTAGGGGCAAGG - Intergenic
1093930113 12:24947782-24947804 TTATAGCTTTAGTAAGTAAAAGG - Intronic
1094538852 12:31346040-31346062 TTGTATTTTTAGTAGGAGCAGGG - Intergenic
1094546022 12:31405388-31405410 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1094586959 12:31786440-31786462 TTGTATTTTTAGTAGATGCAGGG + Intergenic
1095801262 12:46271558-46271580 TTGGAGGGTTAGTGGGTGGAAGG + Intergenic
1098263418 12:68694727-68694749 TTGTATTTTTAGTAGGGAGAGGG - Intronic
1098866214 12:75766762-75766784 TTGTGGCATTTGTAGGGGGAGGG + Intergenic
1098910853 12:76207003-76207025 TTGAAGCTTTAGTATAAGGAAGG - Intergenic
1099669672 12:85674092-85674114 CTGTAGCTTTTCTAGGTGCATGG + Intergenic
1100337662 12:93647206-93647228 TTGTATTTTTAGTAGATGCAGGG - Intergenic
1101658898 12:106748776-106748798 TTGTATTTTTAGTAGGGAGATGG - Intronic
1102889983 12:116551188-116551210 TTGTAGAATTAGTGGATGGATGG + Intergenic
1103377998 12:120471190-120471212 TTGTATTTTTAGTAGGGGGGCGG - Intronic
1103552985 12:121749732-121749754 TTGTATTTTTAGTAGGTTTAGGG - Intronic
1106034041 13:26027777-26027799 TTGTAGCTTTAGTAGGTGGAAGG - Intergenic
1109152971 13:58867525-58867547 TTGTAGCTTTAGTAGACACAGGG - Intergenic
1110230516 13:73162696-73162718 TTGTATTTTTAGTAGGGGCAGGG - Intergenic
1111364268 13:87221209-87221231 TTGTAGTTTTAGTAGAGAGAGGG - Intergenic
1111766015 13:92530371-92530393 CTGAGGCTTTAGTGGGTGGATGG - Intronic
1113092952 13:106633876-106633898 TAGTTGCTGTAGTAGGTTGAAGG - Intergenic
1113481314 13:110623828-110623850 TTGTAGTTTTAGTAGGGACAGGG - Intronic
1113787133 13:113008087-113008109 TTGTATCTTTAGTAGGGAGGGGG + Intronic
1114452188 14:22834672-22834694 TTGTATCTTTAGTAGGGACAGGG - Exonic
1117258795 14:54007547-54007569 TTGTATTTTTAGTAGAGGGAGGG + Intergenic
1117522423 14:56564273-56564295 TTGTATTTTTAGTAGGGGCAGGG - Intronic
1118109341 14:62698357-62698379 TTGTATTTTTAGTAGAGGGAGGG + Intergenic
1120094520 14:80373870-80373892 TTTTAGCTGAAGTAAGTGGAAGG + Intronic
1120141574 14:80935376-80935398 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
1120519016 14:85504266-85504288 TTGTAGTTTTAGTAGGGACAGGG - Intergenic
1121165488 14:91792309-91792331 TTTTAGAATTAGTTGGTGGATGG - Intronic
1121201761 14:92123298-92123320 TTGTAGCTTTAGTAGAGACAGGG + Intronic
1122241336 14:100369834-100369856 TTGTATTTTTAGTAGAGGGAGGG + Intronic
1122705847 14:103620813-103620835 TTGTAGTTTTAGTAGGGACAGGG + Intronic
1122728276 14:103775445-103775467 TTGTATCTTTAGTAGAGAGAGGG + Intronic
1123874160 15:24606967-24606989 TTGTATCTTTTGTGGGTCGATGG - Intergenic
1124041076 15:26104004-26104026 TTGTAGTTTTAGTAGAGGCAGGG - Intergenic
1124146908 15:27136442-27136464 TTTTAACTTTAGAGGGTGGAAGG + Intronic
1124174222 15:27407097-27407119 TTGTAGTTTTAGTAGGGACAGGG + Intronic
1126284962 15:46999817-46999839 TTGTATCTTTAGTAGGGACAGGG + Intergenic
1126574759 15:50185801-50185823 TTGTATTTTTAGTAGGGGCAGGG + Intronic
1126810753 15:52401240-52401262 TTGTATCTTTAGTAGAGAGAGGG + Intronic
1127419026 15:58787000-58787022 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1129421856 15:75434475-75434497 TTGTATTTTTAGTAGAGGGAGGG - Intronic
1129539044 15:76336507-76336529 TTGTAGGTTTCGGAGGTGGGGGG + Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130197432 15:81793745-81793767 TAATAGCTTTAGTGGGTGGTGGG + Intergenic
1130748752 15:86686609-86686631 TTGTATCTTTAGTAGATACAAGG + Intronic
1130967957 15:88711079-88711101 TTGTACCTTTAGTAGAGGTAGGG + Intergenic
1131143322 15:89995784-89995806 TTGTATCTTTAGTAGGGACAGGG + Intergenic
1132042255 15:98535308-98535330 TTGTAGTTTTAGTAGAGGGGGGG - Intergenic
1132146055 15:99430590-99430612 TTGTAGCTTTAGTAGAGACAGGG - Intergenic
1132284879 15:100655504-100655526 TTGTATTTTTAGTAGGTACAGGG + Intergenic
1133688660 16:8191418-8191440 TTGTATTTTTAGTAGATGCAGGG - Intergenic
1133783157 16:8954784-8954806 TTGTATCTTTAGTAGAGGGGGGG - Intronic
1135337847 16:21618886-21618908 TTGTAGTTTTAGTAGGGATAGGG + Intronic
1135520372 16:23172276-23172298 TTGTAGTTTTAGTAGAGGTAGGG + Intergenic
1136359119 16:29766436-29766458 TTGTATTTTTAGTAGATGCAGGG + Intergenic
1139114811 16:63936984-63937006 TTGTATTTATAGTTGGTGGAGGG - Intergenic
1139979024 16:70838361-70838383 TTGTATTTTTAGTAGATGCAGGG + Intronic
1140461891 16:75146576-75146598 ATGTATCTTCAGTAGGTGAATGG + Intergenic
1140628472 16:76823026-76823048 TTTTAGCTTTATCAGGTCGAAGG + Intergenic
1140793557 16:78414394-78414416 TTGTATTTTTAGTAGATGCAGGG - Intronic
1141112919 16:81285010-81285032 TTGTATTTTTAGTAGAGGGAGGG + Intronic
1141477831 16:84285558-84285580 TTGTATTTTTAGTAGATGGGGGG + Intergenic
1142185456 16:88692732-88692754 TTGTATCTTTAGTAGGGGCAGGG - Intergenic
1142929301 17:3268878-3268900 TTGTATTTTTAGTAGGTACAGGG - Intergenic
1143080845 17:4380338-4380360 TTTTATTTTTAGTAGGTGGGGGG + Intergenic
1143248852 17:5507520-5507542 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
1143880175 17:10023949-10023971 TTGTATTTTTAGTAGATGCAGGG - Intronic
1143919549 17:10320038-10320060 CTCTAGCTTTAGCAGGAGGAAGG + Intronic
1144544382 17:16178930-16178952 TTGTAGTTTTAGTAGAAGCAGGG - Intronic
1144550253 17:16234590-16234612 TTGTAGTTTTAGTAGATGCGGGG - Intronic
1145029325 17:19492683-19492705 TTGTTGCTTTAGTGGAGGGATGG - Intergenic
1145393766 17:22477808-22477830 TTGTATTTTTAGTAGGGGGGGGG + Intergenic
1146583105 17:34057512-34057534 CTGGAGCTTTAGTAGGAGGACGG + Intronic
1146851345 17:36224460-36224482 TTGTATCTTTAGTAGAGGCAGGG + Intronic
1147070133 17:37948944-37948966 TTGTATCTTTAGTAGAGGCAGGG + Intergenic
1147081654 17:38028470-38028492 TTGTATCTTTAGTAGAGGCAGGG + Intronic
1147097605 17:38152440-38152462 TTGTATCTTTAGTAGAGGCAGGG + Intergenic
1147687711 17:42297108-42297130 TTGTAGTTTTAGTAGATACAGGG + Intronic
1148430388 17:47638263-47638285 TTGTATTTTTAGTAGATGCAGGG - Intergenic
1149329042 17:55562580-55562602 TTGTATCTTTAGTAGAGGCAGGG - Intergenic
1150489278 17:65563296-65563318 TTGTAGTTTTAGTAGGGACAGGG - Intronic
1150518763 17:65844510-65844532 TTGTATCTTTAGTAGGGACAAGG - Intronic
1150554988 17:66246232-66246254 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
1150668506 17:67168917-67168939 TTGTATTTTTAGTAGATGCAGGG - Intronic
1150718060 17:67588965-67588987 TTGCAGATTTTGTAGGTGGCTGG - Intronic
1151253842 17:72859812-72859834 TTGTAGCTTTAGTAGAGACAGGG - Intronic
1152576817 17:81144835-81144857 TTGTAGCTTTTGACGCTGGAAGG - Intronic
1154281923 18:13011052-13011074 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
1154939746 18:21099861-21099883 TTGTATCTTTAGTAGAGGTAGGG - Intronic
1156021147 18:32600438-32600460 TTGTATCTTTAGTAAGAGAAGGG - Intergenic
1156893958 18:42222778-42222800 TTGTAGCTTTGGCAGGAAGAGGG - Intergenic
1157317736 18:46606991-46607013 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
1160073555 18:75650129-75650151 TTGAAGCTTCAGCTGGTGGAAGG - Intergenic
1160165894 18:76512039-76512061 TTGTATCTTTAGTAGAGGCAGGG - Intergenic
1160665803 19:327639-327661 TTCTGGCTTTGGTGGGTGGAGGG - Intronic
1161193193 19:2971060-2971082 TTGTATTTTTAGTTGGTGGGGGG - Intergenic
1161784685 19:6316644-6316666 TTGTATCTTTAGTAGAGGCAAGG - Intronic
1161839085 19:6667866-6667888 TTGTAGTTTTAGTAGATACAGGG - Intronic
1162056862 19:8069756-8069778 TTTTACTTTTTGTAGGTGGAGGG + Intronic
1163137225 19:15321059-15321081 TTGTATTTTTAGTAGGGGCAGGG - Intronic
1163338759 19:16690503-16690525 TTGTAGTTTTAGTAGAGGCAGGG - Intergenic
1163578653 19:18124932-18124954 TTGTATTTTTAGTAGGGGGGGGG - Intronic
1164189047 19:22898761-22898783 TTGTAGTTTTAGTAGAGGTAGGG + Intergenic
1165170930 19:33891041-33891063 TTGTATCTTTAGTAGATGTGGGG - Intergenic
1167458471 19:49611462-49611484 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
1168006176 19:53489427-53489449 TTGTATTTTTAGTAGATAGAGGG - Intronic
1168440704 19:56364098-56364120 TTCTAGCTTTACTGGATGGATGG - Intronic
1168707544 19:58478489-58478511 TTGTATCTTTAGTAGATACAGGG - Intronic
925891281 2:8437011-8437033 GTGTAGCTTTATTAGCTTGATGG + Intergenic
927731442 2:25476239-25476261 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
930066174 2:47329335-47329357 TTGTAGTTTTAGTAGAGGCAGGG - Intergenic
930313319 2:49769559-49769581 TTGTAGTTTTAGTAGAGGCATGG + Intergenic
930539789 2:52690910-52690932 TTGTATTTTTAGTAGGGGCAGGG + Intergenic
930808636 2:55518287-55518309 TTGTAGTTTTAGTAGGGACAGGG - Intergenic
931316417 2:61136795-61136817 TTTTATTTTTAGTAGGTGCAGGG - Intronic
931382896 2:61769880-61769902 TTGTATTTTTAGTAGGTACAGGG - Intergenic
931501296 2:62870542-62870564 TTGTATTTTTAGTAGATGGGGGG - Intronic
931600664 2:64000032-64000054 TTGTATCTTTAGTAGAGGCAGGG + Intronic
933061265 2:77739916-77739938 TTGTAGTTTTAGTAGAGAGAGGG - Intergenic
933667745 2:84978167-84978189 TTGTATTTTTAGTAGATAGAGGG + Intronic
933900617 2:86847107-86847129 TTGTATCTTTAGTAGAGAGAGGG + Intronic
935031490 2:99327242-99327264 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
935189499 2:100765625-100765647 TTGTAGCTTAAGGAGGTGCTTGG - Intergenic
935442350 2:103115422-103115444 ATGTAGCTTTAGTAAGTTTAAGG + Intergenic
935779932 2:106502121-106502143 TTGTATCTTTAGTAGAGAGAGGG - Intergenic
935957189 2:108388878-108388900 TTGTAGTGTTTGTAGGAGGAAGG - Intergenic
937162074 2:119773561-119773583 TTGTATTTTTAGTAGATGCAGGG - Intronic
937615787 2:123920837-123920859 TGGTAGTTTTAGGAGGTGGGAGG - Intergenic
937738986 2:125326615-125326637 TTTTATCTTCAGTAGGTGGGAGG - Intergenic
937876988 2:126833166-126833188 TGGTAGCTTTGTTTGGTGGAAGG + Intergenic
938112121 2:128575399-128575421 TTGTATTTTTAGTAGGGGCAGGG - Intergenic
939252497 2:139700110-139700132 TTGTATTTTTAGTAGATGGGGGG + Intergenic
940232732 2:151474501-151474523 TTGTATTTTTAGTAGGTGCTGGG - Intronic
940306191 2:152229575-152229597 TTGTATTTTTAGTAGGGAGACGG - Intergenic
944665765 2:201957677-201957699 TTGTATTTTTAGTAGGTACAGGG + Intergenic
946269038 2:218574140-218574162 TTGTATTTTTAGTAGGGGCAGGG + Intronic
946941654 2:224775646-224775668 TTGTAGTTTTAGTAGAGAGAGGG + Intronic
947272614 2:228353528-228353550 TTGTCGCTTAAGTAGGTAAATGG - Intergenic
947639281 2:231697328-231697350 TTGTATCTTTAGTAGAGGCAGGG + Intergenic
948288998 2:236810443-236810465 TTGTATTTTTAGTAGGTACAGGG - Intergenic
948438559 2:237970249-237970271 TAGCTGCTTTAGGAGGTGGAGGG + Intronic
1169053520 20:2600503-2600525 TTGTATCTTTAGTAGAGGCAGGG - Intronic
1170635876 20:18103997-18104019 TTGTATCTTTAGTAGAGGTAGGG - Intergenic
1172072280 20:32266937-32266959 TTGTATTTTTAGTAGATGTAGGG + Intergenic
1172334040 20:34099194-34099216 TTGTATCTTTAGTAGGTGTGGGG - Intronic
1172420391 20:34812073-34812095 TTGTATTTTTAGTAGGTACAGGG - Intronic
1172542267 20:35727958-35727980 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1172859857 20:38039904-38039926 TTGTATCTTTAGTAGAGGTAGGG + Intronic
1173746009 20:45437488-45437510 TTGTAGCTATAGTAGGTACTTGG - Intergenic
1173884087 20:46441460-46441482 TTGTATTTTTAGTAGGGGCAGGG - Intergenic
1174841981 20:53909783-53909805 TTGTATTTTTAGTAGATGCAGGG + Intergenic
1175118417 20:56700362-56700384 TTGTATTTTTAGTAGGGGCAGGG + Intergenic
1175526493 20:59638234-59638256 TTGTAGCTATGTTAGATGGATGG + Intronic
1177386343 21:20413830-20413852 TTGTAGCTGTGGTAAGTTGATGG - Intergenic
1179000405 21:37452407-37452429 TTCTAGCTTGAGTGGATGGATGG + Intronic
1180677768 22:17599745-17599767 TTGTATTTTTAGTAGAGGGAGGG - Intronic
1180895279 22:19327209-19327231 TTGTAGTTTTAGTAGAGGCAGGG + Intergenic
1183501501 22:38182114-38182136 TGGTCGCTTTAGGAGGCGGAAGG - Intronic
1183647837 22:39136772-39136794 CTGTAGGCTTAGTATGTGGATGG + Intronic
1184503428 22:44887580-44887602 TTGTATTTTTAGTAGATGGGGGG - Intronic
1184698703 22:46154443-46154465 TTGTATTTTTAGTAGATGCAGGG - Intronic
1185081559 22:48712227-48712249 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
949335314 3:2968378-2968400 GTGTAGCTATAGTCTGTGGATGG - Intronic
949349709 3:3112957-3112979 TTGTATTTTTAGTAGGGAGAGGG + Intronic
950063533 3:10092454-10092476 TTGTGGCATAAGTAGGAGGAAGG - Intronic
950756329 3:15176056-15176078 AAGTAGCTTTACTAGCTGGAGGG - Intergenic
950871811 3:16235930-16235952 TTGTATTTTTAGTAGGGGCAGGG - Intergenic
951113964 3:18838047-18838069 TTCTGGCTTTAGTAAGTGGGTGG - Intergenic
953487974 3:43320424-43320446 TGGGAGCTCCAGTAGGTGGAAGG + Intronic
954668667 3:52275709-52275731 TTGTATCTTTAGTAGAGGCAGGG - Intronic
955109397 3:55933034-55933056 TTGTAGTTTTAGTAGAGGCAAGG - Intronic
955531149 3:59874451-59874473 TTGCAGATTTAGTAGGTCTAGGG + Intronic
955960090 3:64331648-64331670 TTGCAGCTCTAGGAGGAGGAAGG + Intronic
956566406 3:70643610-70643632 TTGTAGTTTTAGTAGATACAGGG - Intergenic
956717137 3:72088445-72088467 TTGTATCTTTAGTAGAGGCAGGG - Intergenic
958563840 3:95781866-95781888 CTGTGGCTTTTCTAGGTGGATGG - Intergenic
958598315 3:96259879-96259901 TTGGTGCTTTAGTGGATGGAGGG - Intergenic
958913033 3:100016361-100016383 TTGTATCTTTAGTAGAGGCAGGG + Intronic
959693225 3:109221619-109221641 GTTTAGATTTATTAGGTGGAAGG - Intergenic
959791988 3:110372972-110372994 TTGTTGCCTTAGTGGGTAGAAGG - Intergenic
960606656 3:119512911-119512933 TTGTATCTTTAGTAGAGGCAGGG + Intronic
963748103 3:149146246-149146268 TTGTTGCTTTAGAAAGTGGTTGG - Intronic
966532205 3:180993566-180993588 TTGAGGCTTTAGCAGCTGGAAGG + Intergenic
966770142 3:183497102-183497124 TTGTATTTTTGGTAGGTGGGGGG - Intronic
968333633 3:197893667-197893689 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
968343357 3:197978816-197978838 TTGTATCTTTAGTAGACAGAAGG - Intronic
968767925 4:2483997-2484019 TTGTATTTTTAGTAGGGGGTGGG + Intronic
969176988 4:5406322-5406344 TTGTGGCTTTTCTAGGTGCACGG + Intronic
971408371 4:26343921-26343943 TTGTATTTTTAGTAGGGAGAGGG + Intronic
971615286 4:28781540-28781562 TTGTATTTTTAGTAGGGGCAGGG - Intergenic
971771783 4:30906848-30906870 TTGTATTTTTAGTAGGTACAGGG - Intronic
972367245 4:38387707-38387729 TTGCAGCCTAAGTGGGTGGAAGG + Intergenic
974408770 4:61511183-61511205 TTGTATCTTTAGTAGAGAGAGGG - Intronic
974719001 4:65712199-65712221 TTCTAACTTTACTAGGTGGGAGG - Intergenic
975152995 4:71041382-71041404 TTGTATTTTTAGTAGATGTAGGG + Intergenic
975274693 4:72483255-72483277 TTGTAGTTTTAGTAGGTTTTTGG - Intronic
975598302 4:76071775-76071797 TTTTAGCTTGAATAGCTGGAAGG - Intronic
975679224 4:76859141-76859163 TTGTATCTTTAGTAGAGGCAGGG - Intergenic
975710004 4:77151662-77151684 TTGAAGCTTTACTATTTGGAGGG - Intergenic
977697871 4:99987005-99987027 TTGTCGTTGTGGTAGGTGGAGGG + Intergenic
978065118 4:104388442-104388464 CTGTAGCTTTAATAGGAAGAAGG + Intergenic
980137879 4:128877505-128877527 TTGTAGTTTTAGTAGATACAGGG - Intronic
981435991 4:144722678-144722700 TTGTATTTTTAGTAGATAGAGGG - Intronic
982397814 4:154930960-154930982 TTGTAGTTTTAGTAGGTACGTGG + Intergenic
982419785 4:155181628-155181650 TTGTGGCTTCACTTGGTGGAAGG - Intergenic
983095183 4:163552857-163552879 TTGTATTTTTAGTAGATGCAGGG - Intronic
983379141 4:166968851-166968873 TTGCAGCTTTTCTAGGTGCATGG - Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
983787208 4:171747991-171748013 TTGTATTTTTAGTAGGTACAGGG - Intergenic
984047797 4:174823208-174823230 TTGTTTTTTTATTAGGTGGATGG - Intronic
984232831 4:177120046-177120068 CTGTAGATTTAGAAGATGGATGG - Intergenic
985699945 5:1364914-1364936 TTGTATTTTTAGTAGATGTATGG - Intergenic
986183494 5:5415977-5415999 ATGTTCCTTTAGTAGGTGAATGG - Intergenic
986482809 5:8205626-8205648 TTGGAGATTTAGTGGTTGGAAGG + Intergenic
988368626 5:30337056-30337078 TTGCTGATTTAGTAGGTGCAAGG + Intergenic
989737143 5:44721484-44721506 TTCTAGATGTAGTAAGTGGAGGG - Intergenic
990253714 5:53943252-53943274 ATGTAACTTCAGTAGGTGAAAGG + Intronic
990863428 5:60353506-60353528 TATGAGATTTAGTAGGTGGAAGG - Intronic
991439549 5:66632489-66632511 GTGTTTATTTAGTAGGTGGAGGG + Intronic
992500005 5:77332663-77332685 TTGTATTTTTAGTAGGGGCAGGG - Intronic
992723602 5:79584414-79584436 TTGTATTTTTAGTAGATGCAGGG + Intergenic
992724467 5:79592244-79592266 TTGTATCTTTAGTAGATATAGGG + Intergenic
992738889 5:79753011-79753033 TTGGAGATTGAGGAGGTGGAAGG + Intronic
992929069 5:81622246-81622268 TTGTTAATTTAGTAGATGGAAGG - Intronic
993141668 5:84041904-84041926 TTGAACCTTTAATAGGTGGTAGG + Intronic
995678124 5:114686161-114686183 TTGTAGCTTTAGTAGAGACAGGG + Intergenic
996069552 5:119119680-119119702 TTGTATTTTTAGTAGGGAGAGGG + Intronic
996860626 5:128061743-128061765 TTGTAGTTTTAGTAGGGACAGGG - Intergenic
997056674 5:130452208-130452230 CTGTGGCTTTAGAGGGTGGAAGG - Intergenic
997167176 5:131673861-131673883 TTGTATTTTTAGTAGGTACAGGG - Intronic
997330681 5:133058953-133058975 TTGTATCTTTAGTAGAGGCAGGG - Intronic
997511138 5:134455400-134455422 TTGTATTTTTAGTAGGTAGGGGG - Intergenic
999097831 5:148996443-148996465 TTGGGGCTGTAGTGGGTGGAGGG - Intronic
999594338 5:153185443-153185465 TTCAAACTTTAGAAGGTGGAAGG - Intergenic
1000785489 5:165537932-165537954 TTGTATTTTTAGTAGGTACAGGG - Intergenic
1002275246 5:178100252-178100274 TTGTAGTTTTTGTAGATGAAGGG + Intergenic
1004774017 6:18822020-18822042 CTGTAGCCATGGTAGGTGGAAGG - Intergenic
1005133496 6:22539212-22539234 TTGTATTTTTAGTAGGGGGGTGG + Intergenic
1005296831 6:24435183-24435205 TTGTATCTTTAGTAGGGACAGGG + Intronic
1005827177 6:29640146-29640168 TTGTATTTTTAGTAGATGGGTGG - Intergenic
1005834807 6:29700580-29700602 TTGTAACTTTAGTAGAGGCAGGG + Intergenic
1005907797 6:30279908-30279930 TTGTATTTTTAGTGGGTGGGGGG + Intergenic
1006500609 6:34456684-34456706 TTGTATCTTTAGTAGAGGCAGGG + Intergenic
1007587761 6:43002335-43002357 TTGTATCTTTAGTAGAGGCAGGG + Intronic
1007884305 6:45208549-45208571 TTGTATCTTTAGTAGGGACAGGG - Intronic
1008673084 6:53793764-53793786 TTTTAGCTATAGCAGCTGGAGGG + Intergenic
1008970068 6:57357104-57357126 TTGTAGCTTTAGTAGAGACAGGG + Intronic
1009159036 6:60258919-60258941 TTGTAGCTTTAGTAGAGACAGGG + Intergenic
1009692208 6:67049746-67049768 TTGTATTTTTAGTAGGGAGAGGG + Intergenic
1011998417 6:93622556-93622578 TTGAGTCTTTAGTTGGTGGAGGG - Intergenic
1013691304 6:112648092-112648114 CTGGATTTTTAGTAGGTGGAAGG + Intergenic
1014227478 6:118864460-118864482 TTGGTGCTTTTGTGGGTGGAGGG - Intronic
1015222582 6:130821664-130821686 TTGTATTTTTAGTAGATTGATGG - Intergenic
1017211131 6:151857699-151857721 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1017526262 6:155243672-155243694 TTGTATTTTTAGTAGGGGCAGGG - Intronic
1019020997 6:168917557-168917579 TTGTATTTTTAGTAGATGCAGGG - Intergenic
1019787839 7:2989944-2989966 TTGTACTTTTAGTAGATGCAGGG - Intronic
1021105275 7:16631522-16631544 TTGCAGCTTTTGAAGGTGGTAGG + Intronic
1021154146 7:17188783-17188805 TTGTAGCATTAGGAGGTGAGTGG - Intergenic
1021416958 7:20397396-20397418 TTGTATTTTTAGTAGATGCAGGG + Intronic
1021533367 7:21674533-21674555 TTGTAGTTTTAGTAGATACAGGG + Intronic
1021706029 7:23368723-23368745 TTGTATTTTTAGTAGGTGCGAGG - Intronic
1021809992 7:24393797-24393819 TTGTAGCTTTGGTAGGTGAATGG + Intergenic
1021892865 7:25203897-25203919 TTGTGGCTCTAGTAGGAGAAGGG - Intergenic
1022279306 7:28890154-28890176 TTGTATTTTTAGTAGAAGGAGGG + Intergenic
1022826921 7:34024183-34024205 TTGTATTTTTAGTAGATGCAGGG - Intronic
1023162478 7:37310508-37310530 GTGAAGCTCTAGTAAGTGGAAGG + Intronic
1023992635 7:45138315-45138337 TTGTATCTTTAGTAGATGCGGGG + Intergenic
1024632884 7:51263617-51263639 TTGAAGCTTTAGTACCTGGGAGG + Intronic
1024791242 7:52967088-52967110 TTGTAGTTTTAGTAGAAGCAGGG - Intergenic
1025140440 7:56459141-56459163 TTATAGCTTTAGTAGATATAGGG + Intergenic
1025165895 7:56712028-56712050 TTGTAGTTTTAGTAGGGACAGGG + Intergenic
1026084317 7:67250561-67250583 TTGTAGTTTTAGTAGAGGCAGGG + Intergenic
1026210429 7:68299168-68299190 TTGTAGTTTTAGTAGAGGCAGGG + Intergenic
1026346024 7:69474908-69474930 TTGTAGTTTTAGTAGAGGCAGGG - Intergenic
1026692767 7:72563777-72563799 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
1026942004 7:74292558-74292580 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1029559478 7:101293043-101293065 TTGTATTTTTAGTAGAGGGAGGG + Intergenic
1030872824 7:114778333-114778355 TTGTAGTTTTAGTAGAGAGAGGG + Intergenic
1031992540 7:128207619-128207641 TTGTGACTTTGGGAGGTGGAGGG + Intergenic
1032213660 7:129939561-129939583 TTGTAGCATTTGTATGTAGAAGG - Intronic
1033181937 7:139188271-139188293 TTGTATTTTTAGTAGGGGCAGGG + Intronic
1033550941 7:142447210-142447232 TTGTATTTTTAGTAGATGCAGGG - Intergenic
1033938418 7:146618895-146618917 TTGTATCTTTAGTAGGGACAGGG - Intronic
1034653499 7:152711226-152711248 TTGTATTTTTAGTAGATGCAGGG + Intergenic
1034694616 7:153042734-153042756 TTGTATTTTTAGTAGGGGGCGGG - Intergenic
1034861236 7:154596619-154596641 TTGTAGTTTAAGTAGGAGGGAGG + Intronic
1036080045 8:5545206-5545228 TTGTAGCTCTAGTTAGTAGAAGG + Intergenic
1036172998 8:6508275-6508297 TTGTATTTTTAGTAGAGGGAGGG - Intronic
1036483556 8:9159547-9159569 TGCTGGCCTTAGTAGGTGGAGGG - Intronic
1036779550 8:11636045-11636067 TTGTATTTTTAGTAGATAGAGGG - Intergenic
1038100144 8:24364294-24364316 TTGTATCTTTAGTAGAGGCAGGG + Intergenic
1039045935 8:33449460-33449482 TTGTATCTTTAGTAGAAGCAGGG + Intronic
1039486127 8:37911424-37911446 TTGTAGTTTTTGTAGGTGTAGGG + Intergenic
1040894155 8:52348570-52348592 TTGTATTTTTAGTAGATAGAGGG - Intronic
1042908049 8:73794728-73794750 TTGTATTTTTAGTAGAGGGAGGG - Intronic
1043518086 8:81014885-81014907 TTGGAGCTTTTGGAGGTGGTGGG + Intronic
1043560857 8:81491579-81491601 TTGTATCTTTAGTAGATACAGGG + Intergenic
1044225803 8:89716785-89716807 TTCGAGCTTTAATAGATGGAGGG - Intergenic
1044769033 8:95609755-95609777 TTGTACTTTTAGTAGATGCAGGG + Intergenic
1044984048 8:97742423-97742445 TTGTAGTTTTAGTAGATACAGGG + Intergenic
1047011105 8:120673461-120673483 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1047781300 8:128113629-128113651 TTGTATTTTTAGTAGATGCAGGG - Intergenic
1048056935 8:130876221-130876243 TTGTATTTTTAGTAGGGGCAGGG + Intronic
1048669120 8:136696314-136696336 TTGTGGCTTTTCTAGGTGCATGG - Intergenic
1049368270 8:142251331-142251353 TTGTGGCTTTTGTGGGGGGAGGG - Intronic
1050718191 9:8554012-8554034 TTGTATCTTTAGTAGAGAGAGGG - Intronic
1051020264 9:12534689-12534711 TTGTGGCTTTTCTAGGTGCATGG + Intergenic
1053369673 9:37550353-37550375 TTGTATTTTTAGTAGGGAGATGG + Intronic
1053605103 9:39649995-39650017 TTGTATTTTTAGTAGGGGAAGGG - Intergenic
1053863023 9:42406622-42406644 TTGTATTTTTAGTAGGGGAAGGG - Intergenic
1054248438 9:62692420-62692442 TTGTATTTTTAGTAGGGGAAGGG + Intergenic
1054562552 9:66726946-66726968 TTGTATTTTTAGTAGGGGAAGGG + Intergenic
1056390638 9:86138135-86138157 TTGTATCTTTAGTAGGGAGGGGG - Intergenic
1056745625 9:89299345-89299367 TTGTATCTTTAGTAGAGGCAGGG - Intergenic
1057397619 9:94693895-94693917 ATGTATCTTTTTTAGGTGGAAGG + Intergenic
1057594240 9:96401351-96401373 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
1058354319 9:104064835-104064857 TTGTAGTTTTAGTAGGGACAGGG - Intergenic
1058660748 9:107266338-107266360 TTGTATCTTTAGTAGATACAGGG + Intergenic
1059017881 9:110541408-110541430 TTCCACCTTTAGTAGGTGCAAGG + Intronic
1060348008 9:122833661-122833683 TTGTATTTTTAGTAGGGGCAGGG + Intergenic
1061311741 9:129768069-129768091 TTGTAGTTTTAGTAGGGATAGGG - Intergenic
1061470017 9:130816874-130816896 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1061805669 9:133136463-133136485 TTGTATTTTTAGTAGATGCAGGG - Intronic
1186747995 X:12589903-12589925 ATGTGGATTTGGTAGGTGGAAGG - Intronic
1186946088 X:14569080-14569102 TTGTATTTTTAGTAGGGGCAGGG - Intronic
1187380648 X:18798794-18798816 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1187491404 X:19755193-19755215 TTGTATCTTTAGTAGAGGCAGGG - Intronic
1187868564 X:23745537-23745559 TTGTATCTTTAGTAGAGGCAGGG - Intronic
1187912843 X:24126758-24126780 TTGTAGTTTTAGTAGAGGCAGGG + Intergenic
1189445094 X:41073665-41073687 TTGTATTTTTAGTAGATGGGGGG + Intergenic
1189490401 X:41466974-41466996 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1190335475 X:49259186-49259208 TTTTAGCTTGAGCAGCTGGAAGG + Intronic
1190872108 X:54433134-54433156 TTGTGGCTTTAGTATGTGATGGG + Intergenic
1192241089 X:69329135-69329157 TTGTATTTTTAGTAGGGAGACGG + Intergenic
1192601200 X:72466177-72466199 TTCTAGCTTAAGGAGGAGGAGGG + Intronic
1194552086 X:95313385-95313407 TTTTAGCTTTTGTATTTGGAAGG - Intergenic
1194650108 X:96504180-96504202 TTGTATTTTTAGTAGGGGGGGGG + Intergenic
1194666079 X:96678894-96678916 TTGTATCTTTAGTAGGGACAGGG - Intergenic
1195041739 X:101021027-101021049 TTGTAGCTTGCGGAGGTGGTCGG - Intronic
1195133813 X:101882828-101882850 TTGTAATTTTTCTAGGTGGATGG - Exonic
1195814915 X:108874176-108874198 CTGTAGCTTGAGTATGTGGTAGG - Intergenic
1197077214 X:122366181-122366203 TTGTAGCTTTAGTAGAGACAGGG + Intergenic
1197191724 X:123654925-123654947 TTATAGGTTTATTAGGAGGAGGG + Intronic
1198400577 X:136264449-136264471 TTGTATTTTTAGTAGGTACAGGG + Intergenic
1198726802 X:139686635-139686657 TTTTGGCTTTAGCAAGTGGATGG - Intronic
1199645110 X:149901490-149901512 ATAAAGGTTTAGTAGGTGGAGGG - Intergenic
1201286986 Y:12387629-12387651 TTGTAGTTTTAGTAGATACAGGG + Intergenic
1201293053 Y:12440725-12440747 TTGTATTTTTAGTAGATGCAGGG + Intergenic
1201618524 Y:15928672-15928694 TTGTATCTTTAGTAGATATAGGG + Intergenic
1201920634 Y:19229933-19229955 TTGTATCTTTAGTAGATACAGGG + Intergenic