ID: 1106034788

View in Genome Browser
Species Human (GRCh38)
Location 13:26033764-26033786
Sequence CAAGCCCCTCCCCTTGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 1, 2: 2, 3: 36, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106034788_1106034794 19 Left 1106034788 13:26033764-26033786 CCAGGTTCAAGGGGAGGGGCTTG 0: 1
1: 1
2: 2
3: 36
4: 267
Right 1106034794 13:26033806-26033828 AAGGAGTTTGAAAGAATCTGTGG 0: 1
1: 1
2: 2
3: 47
4: 457
1106034788_1106034789 -4 Left 1106034788 13:26033764-26033786 CCAGGTTCAAGGGGAGGGGCTTG 0: 1
1: 1
2: 2
3: 36
4: 267
Right 1106034789 13:26033783-26033805 CTTGCACTCCCACTTCTCCATGG 0: 1
1: 0
2: 2
3: 32
4: 226
1106034788_1106034790 0 Left 1106034788 13:26033764-26033786 CCAGGTTCAAGGGGAGGGGCTTG 0: 1
1: 1
2: 2
3: 36
4: 267
Right 1106034790 13:26033787-26033809 CACTCCCACTTCTCCATGGAAGG 0: 1
1: 0
2: 0
3: 31
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106034788 Original CRISPR CAAGCCCCTCCCCTTGAACC TGG (reversed) Intergenic
900773261 1:4562595-4562617 CTTGCCCCTCCACTTGAATCTGG - Intergenic
902975514 1:20085424-20085446 CAAGGCTCTCTCCTTGCACCAGG - Intronic
903766615 1:25739207-25739229 ATGGCTCCTCCCCTTGAACCTGG - Intronic
904862824 1:33551742-33551764 CTTTCCCCTCCCCTTGAATCAGG + Intronic
904985457 1:34544468-34544490 TAATCCCCTCCCCTTGAATGTGG + Intergenic
908389022 1:63668737-63668759 AATTCCCCTCCCCTTGAATCTGG - Intergenic
910441095 1:87252831-87252853 TAACCACCTCCCCTTGAAGCTGG + Intergenic
912359017 1:109079086-109079108 TAATCCCCTCTCCTTGAACTTGG - Intergenic
913101541 1:115572272-115572294 CATGCCACTCCACTTCAACCTGG + Intergenic
914708139 1:150188276-150188298 CAAGCACCTGCCACTGAACCCGG - Intergenic
914737611 1:150432970-150432992 CAACCCCCTCACCTTGAGACAGG - Intronic
915238575 1:154502921-154502943 CAAGCCCCGCCCCGTGCCCCCGG + Intronic
916094577 1:161337515-161337537 TTAGCCTCTACCCTTGAACCTGG - Intronic
919423392 1:197399999-197400021 TAAGCCCCTCCCCTTGAGTCTGG - Intronic
920163338 1:204016907-204016929 CAAGCCTCTTCCCTTGAAACTGG - Intergenic
920975031 1:210777824-210777846 TAATTCCCTCCCCTTGAATCTGG + Intronic
921821709 1:219624143-219624165 CAAGCCCCTCCACTTCTATCTGG - Intergenic
922248086 1:223819847-223819869 CAAGGCACTCCCCTTGAGCTGGG + Intronic
923360125 1:233203054-233203076 AAAATCCCTCCCCTTCAACCTGG + Intronic
924635595 1:245784813-245784835 AAATTCCCTCCCCTTGAATCTGG - Intronic
1062949916 10:1491114-1491136 CATGCCACTGCCCTTCAACCTGG - Intronic
1063937075 10:11089135-11089157 CAATCCTCTCCTCTTGAATCTGG - Intronic
1064374070 10:14779872-14779894 CAGGTTCCTCCCCTGGAACCAGG - Intergenic
1064667805 10:17674696-17674718 AACAACCCTCCCCTTGAACCTGG - Intronic
1067374002 10:45710858-45710880 ATGGCCCCTCCCCATGAACCTGG + Intergenic
1067429612 10:46234421-46234443 CTGGCCCCACCCCTTGAGCCAGG - Intergenic
1068512232 10:57981373-57981395 TACGCCCCTCCCCTTGAACGTGG + Intergenic
1069646117 10:69998968-69998990 CAAGCCCCTGCACTCCAACCTGG + Intergenic
1071276018 10:84055932-84055954 AAAGCCCCAGCCCTTGAGCCTGG + Intergenic
1071555334 10:86597283-86597305 CAAGGCCCTCGCCTTGAGGCTGG + Intergenic
1072072293 10:91930473-91930495 CAAGCACCTGCCCTTACACCTGG + Intronic
1072286612 10:93921640-93921662 CAAGCCCCTCCACTCCAGCCTGG - Intronic
1072787474 10:98294042-98294064 CAAGCCCTTCCCTTTGAACTTGG - Intergenic
1072894718 10:99356969-99356991 ACAGCCCCTCCCCTTGAATCTGG - Intronic
1073458364 10:103651273-103651295 CCAGCCCCTCCCCAAGGACCTGG + Intronic
1074047091 10:109849185-109849207 CAAGCCTTTCCCCTACAACCAGG + Intergenic
1074549640 10:114430466-114430488 CATGACCCTCCCCTGGAAGCGGG - Intergenic
1074766077 10:116700915-116700937 CAAGCCTCTCCCCTGGGCCCAGG - Intronic
1075607178 10:123820377-123820399 CAAGCTCTTCCTCTGGAACCTGG - Intronic
1077485413 11:2836242-2836264 CAAGCCACCCGCCTTGAATCTGG - Intronic
1077516023 11:3002680-3002702 CAAGCCCCTCTCCTAGGGCCTGG + Intronic
1077606488 11:3616136-3616158 CAAGCCCCTCCGCTCTGACCAGG - Intergenic
1079894001 11:26095636-26095658 CAAGCCCCTCCCCTGACACGTGG + Intergenic
1080896661 11:36453880-36453902 CAAGCTCCTCCCCTTGGCCTGGG - Intronic
1083587755 11:63872807-63872829 CAAGCCCTGCCCCTAAAACCAGG - Intronic
1083659372 11:64245192-64245214 CAGCCCCCTCACCTTGACCCTGG + Exonic
1083829051 11:65219442-65219464 CAGACCCCTCCCCTCCAACCTGG - Intergenic
1084027124 11:66457904-66457926 TAAGTTCCTCCCCTTGAATCTGG + Intronic
1084713601 11:70859696-70859718 CAAGTCCCTGCCCTTGAATGTGG + Intronic
1084948560 11:72652198-72652220 CAAGCCCATCCCTTTGCACCTGG + Intronic
1085204374 11:74721676-74721698 CTAGCCCCAACCCTTGAACATGG + Intronic
1085517723 11:77121286-77121308 CAAGACCCAACCCTGGAACCAGG - Intronic
1088919690 11:114252007-114252029 CAAGACCCTCCCCGTGCCCCTGG + Intergenic
1089718940 11:120394261-120394283 CAAACCACTGCCCTTGAGCCTGG - Intronic
1091300032 11:134501933-134501955 CCAGCCCCTGCCCCTGGACCTGG - Intergenic
1091646125 12:2273784-2273806 CAACCCCCTCTCCCTGACCCCGG + Intronic
1092996203 12:13953315-13953337 CAGCCCCCTCCCCTTGTATCTGG - Intronic
1093564249 12:20583073-20583095 CAAGCCCCTGCCCAGAAACCTGG + Intronic
1095644764 12:44530521-44530543 CAATCCCCTTCCCTTGAATGTGG + Intronic
1095817175 12:46436946-46436968 TAATCCCCTCCCCTTGAATATGG + Intergenic
1096138230 12:49220606-49220628 CAAGCCCTTCCCTTGGTACCTGG - Intronic
1096286520 12:50305417-50305439 AACGCCCCTCCCCTTGAACATGG + Intergenic
1097107495 12:56634319-56634341 AAGGCCCCTCCCCCAGAACCTGG - Intronic
1099542940 12:83936726-83936748 AAAGCCCCCTTCCTTGAACCTGG + Intergenic
1100379697 12:94049969-94049991 CAATCCCTTCCCCTTGAATGTGG - Intergenic
1101802103 12:108031536-108031558 CTGTCCCCTCCCCTTGAATCTGG + Intergenic
1102502075 12:113359500-113359522 CAAGGACTTCCCCTTGGACCAGG - Intronic
1104643345 12:130481107-130481129 CACACCCCTCCCCCTGAGCCTGG - Intronic
1104643371 12:130481168-130481190 CACACCCCTCCCCCTGAGCCTGG - Intronic
1104790589 12:131479556-131479578 CAAGCACCTCCCCTTCCAGCAGG + Intergenic
1104971971 12:132534846-132534868 CCAACCCCTCCCCTAGAACCTGG - Intronic
1105405026 13:20126787-20126809 CAATCCCCTCCCAGTGATCCTGG + Intergenic
1106034788 13:26033764-26033786 CAAGCCCCTCCCCTTGAACCTGG - Intergenic
1107635075 13:42383892-42383914 CAATCCCCTCCCCTTGAGTGTGG - Intergenic
1109534989 13:63704617-63704639 CAAAGTCCTCTCCTTGAACCTGG - Intergenic
1110768701 13:79309937-79309959 CAAGCCACTGCACTCGAACCTGG + Intergenic
1111584633 13:90268554-90268576 CAGGCCTGTCCCCATGAACCTGG - Intergenic
1112318978 13:98390079-98390101 CAAGCCCGTCCTCTTTAGCCGGG + Exonic
1114859215 14:26494326-26494348 CATGCCCCTCCCCCAAAACCTGG - Intronic
1115255880 14:31401211-31401233 CAGGCCCCTCCCCTGAAACATGG - Intronic
1122054820 14:99088231-99088253 CAAACCCATCCCCTTCTACCTGG + Intergenic
1122118998 14:99541938-99541960 CCAGCCCCTCCCCCTGAGCAAGG + Intronic
1122325343 14:100878311-100878333 GTAGCCCCTGCCTTTGAACCTGG + Intergenic
1122340659 14:101026301-101026323 CATGCCCCTTCCCTTGAACTTGG - Intergenic
1122349084 14:101077410-101077432 AAACCCCCTCCCCTAGAGCCGGG + Intergenic
1122902735 14:104788502-104788524 CAGGCCACTCCCCTTCATCCTGG - Intronic
1122943972 14:104996617-104996639 CCAGCCCCTCGCCTTGCGCCCGG - Intronic
1123139607 14:106062309-106062331 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123144637 14:106116795-106116817 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123148094 14:106153788-106153810 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123156843 14:106235222-106235244 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123159972 14:106268766-106268788 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123167961 14:106344547-106344569 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123170602 14:106369260-106369282 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123175254 14:106410648-106410670 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123178349 14:106443289-106443311 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123187928 14:106537970-106537992 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123189685 14:106557102-106557124 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123193398 14:106592833-106592855 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123194275 14:106601498-106601520 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123202030 14:106675172-106675194 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123207615 14:106728320-106728342 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123214119 14:106790858-106790880 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123222225 14:106867809-106867831 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123401117 15:19987822-19987844 CTAGCCCTTTCCCTTGAGCCTGG + Intergenic
1123573644 15:21642951-21642973 CAAGCCACTGCCCTGGAGCCTGG - Intergenic
1123686606 15:22802346-22802368 CACGCCACTGCCCTTCAACCTGG + Intronic
1126437855 15:48654212-48654234 TAATCCCCTCCCCTTGAGCATGG + Intergenic
1127483966 15:59402582-59402604 CAAGCCACTGCCCTCCAACCTGG - Intronic
1128797981 15:70478798-70478820 CAGGCCCCTCTCCCTGAGCCTGG - Intergenic
1132398720 15:101491619-101491641 CAACCCCGTCCCCTTGACTCAGG - Intronic
1134673421 16:16072691-16072713 CCAGCCCATCCCCCTGAGCCAGG + Intronic
1135191251 16:20356477-20356499 CATGCCCCTCACCCTGAACCTGG - Intergenic
1136682108 16:31973847-31973869 CCAGCCCCTTCCCTGGAGCCTGG - Intergenic
1136782420 16:32915348-32915370 CCAGCCCCTTCCCTGGAGCCTGG - Intergenic
1136887373 16:33938503-33938525 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1137686475 16:50390408-50390430 GGAGACCCTCCCCTGGAACCTGG + Intergenic
1138186567 16:54982033-54982055 GAAGCCCCTTCCCTAGAGCCGGG + Intergenic
1138594778 16:58024089-58024111 CATGCCGCTGCCCTTCAACCCGG - Intergenic
1139038134 16:62972642-62972664 CACATCCCTCCCCTTGAATCTGG - Intergenic
1139952084 16:70677434-70677456 CCATCCCCTCCCCTAGACCCAGG - Intronic
1141205180 16:81927967-81927989 CAAACCCCACCCCCTGCACCAGG - Intronic
1141536336 16:84683344-84683366 CATGCCCCTCCCCTTCTCCCAGG + Intergenic
1141713363 16:85713146-85713168 CAAGCCCCTCCCCTGGCTTCTGG + Intronic
1141767914 16:86070812-86070834 TAGGTCCCTCCCCTTGGACCTGG - Intergenic
1141815975 16:86409448-86409470 CAAGTCCCTGCCCTGGATCCTGG + Intergenic
1141824579 16:86470235-86470257 CAAGCCTGTCCCCCTAAACCAGG + Intergenic
1142024757 16:87806532-87806554 CAGGCCCCTCCCTTTGCAGCCGG + Intergenic
1142333023 16:89467842-89467864 CACGCCACTCCACTTGAGCCCGG - Intronic
1203085080 16_KI270728v1_random:1179335-1179357 CCAGCCCCTTCCCTGGAGCCTGG - Intergenic
1142602589 17:1061458-1061480 CAAGCATCTCCCTTTGAACAGGG - Intronic
1142781438 17:2184317-2184339 CATGCCACTGCACTTGAACCTGG + Intronic
1143141179 17:4742615-4742637 CCAGCCCCTGCCCTTGTTCCAGG - Intronic
1144887404 17:18472691-18472713 CTTTCCCCTCCCCTTGAGCCTGG + Intergenic
1144958630 17:19032633-19032655 CCAGCCCCTCCCCCTCAACTCGG + Intronic
1144976529 17:19141891-19141913 CCAGCCCCTCCCCCTCAACTCGG - Intronic
1145144812 17:20471603-20471625 CTTTCCCCTCCCCTTGAGCCTGG - Intergenic
1146354115 17:32119779-32119801 CTTTCCCCTCCCCTTGAGCCTGG + Intergenic
1147669896 17:42170937-42170959 CCAGCCTCTCCCCTGGACCCAGG - Intronic
1147986357 17:44309493-44309515 CGATCTTCTCCCCTTGAACCTGG - Intronic
1147987162 17:44313242-44313264 CAGGCCCCTCACCTTGGCCCGGG - Exonic
1151875178 17:76863980-76864002 CCAGCCCCTCCCCTTGAGCAGGG + Intergenic
1151875247 17:76864270-76864292 CCAGCCCCTCCCCCTGCCCCTGG - Intergenic
1153675572 18:7453416-7453438 CAGGCCCCTCCCCTCCAACAAGG - Intergenic
1157391071 18:47303883-47303905 CAGGCCCCTTCCCTGAAACCAGG - Intergenic
1157475174 18:48019514-48019536 CAAGCCCCTCCCTGTGACACTGG - Intergenic
1157680209 18:49599687-49599709 CTAGCCCCTCCCCACCAACCAGG - Intergenic
1160808849 19:1004346-1004368 CAAGCCTAACCCCTTGATCCCGG - Intronic
1160851660 19:1195657-1195679 CCAGGCCCTCACCTAGAACCTGG + Intronic
1160851815 19:1196312-1196334 CCAGACCCTCACCTAGAACCTGG + Intronic
1160852084 19:1197471-1197493 CCAGGCCCTCACCTAGAACCTGG + Intronic
1160852239 19:1198126-1198148 CCAGACCCTCACCTAGAACCTGG + Intronic
1160857784 19:1225070-1225092 CAAGCCCCTTCCCTGGGATCTGG - Intronic
1160944916 19:1637173-1637195 CAAGCTCCTCCCCCAGAACCAGG + Intronic
1161025691 19:2035707-2035729 CCTTCCCCTTCCCTTGAACCTGG + Intergenic
1161065144 19:2233849-2233871 CAAGCCACTCAGCTGGAACCTGG + Exonic
1163363339 19:16861889-16861911 CATGCCACTGCCCTTGAGCCTGG + Intronic
1163685834 19:18711184-18711206 CAGGCCCCTCCCCGAGAAGCAGG - Intronic
1163714340 19:18865371-18865393 CATTCCCATCCCCTTCAACCTGG + Exonic
1163851128 19:19664088-19664110 CAAGCCCCGCCCCCCGCACCGGG - Intergenic
1165338095 19:35187336-35187358 CAAGATAATCCCCTTGAACCTGG + Intergenic
1166090039 19:40502930-40502952 CAAGCCCTACACCTTGTACCTGG - Exonic
1167583705 19:50361284-50361306 GAAGCCCCACCCCTTCACCCAGG + Intronic
1168331387 19:55571635-55571657 CAAGCCACTGCACTTGAGCCTGG + Intergenic
926087186 2:10027909-10027931 TAAGCCCCTCCACTTGAGCATGG + Intergenic
927046278 2:19282185-19282207 CAAGCTCCACTCCTTGTACCTGG + Intergenic
927279755 2:21294193-21294215 CAAGCCCTTCTCCTTGACCAGGG - Intergenic
929656066 2:43733064-43733086 CAAAGCCCTCCCCTTGCAGCCGG + Intronic
929664377 2:43822475-43822497 CAGGCCCCCCCCCATGCACCTGG + Intronic
929757318 2:44778524-44778546 CCGCCCCCTCCCCTTGCACCTGG - Intergenic
930035681 2:47083760-47083782 CAACCCCTTCCCTTTGAGCCTGG + Intronic
931474384 2:62572467-62572489 TAAGCCCCTCCCCTTTAAAAAGG + Intergenic
931656896 2:64517665-64517687 CAAGCCCCTCCCCACCAACCTGG - Intergenic
931667581 2:64621398-64621420 CTCGCCCCTCCCCAGGAACCCGG - Intergenic
932131927 2:69195379-69195401 CTACCCCCTCCCCTTGCACCTGG + Intronic
932761297 2:74440621-74440643 CAGGCCCCTCCCCCTGGTCCCGG + Intronic
933793773 2:85904148-85904170 CAAGCCCCTCCAGTGGAGCCAGG + Intergenic
934066659 2:88347899-88347921 ATTTCCCCTCCCCTTGAACCCGG - Intergenic
934511529 2:94948019-94948041 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
935285591 2:101561325-101561347 CAGGCCCCTCCCCTGGTGCCTGG - Intergenic
935712763 2:105913786-105913808 CAATCCCCTGTCCTTGAAACTGG + Intergenic
935731242 2:106066058-106066080 TGAGACCCTCCCCTTGACCCCGG - Intronic
936956668 2:118029299-118029321 CAAGCGCCTCCCCTTGACTTGGG - Intergenic
938712160 2:133984241-133984263 GAATCCCCTCCCCTTGAGCGTGG + Intergenic
940021965 2:149165287-149165309 CAATGCCCTCCCCTTGAATCTGG - Intronic
942112436 2:172695544-172695566 TAAGCCCCTCTCCTTGAGCATGG + Intergenic
942206195 2:173621977-173621999 CATACCCCTCCCCTTGAACATGG + Intergenic
944776043 2:202966216-202966238 TAATCCCCTCCCCTTGAATATGG - Intronic
946253974 2:218430100-218430122 CAGGCCCCTCCCATTGGGCCGGG - Intronic
946499309 2:220228822-220228844 TAATCCCCTCCCATTGAACTTGG - Intergenic
947218334 2:227769382-227769404 CAAGCCCCTCCCCTCCAATTTGG - Intergenic
1170131263 20:13022664-13022686 TAATCTCCTCCCCTTGAACCTGG - Intronic
1170614244 20:17936266-17936288 GATCCCCCTCCTCTTGAACCTGG - Intergenic
1171208852 20:23301713-23301735 CAGTCCCCTCCCCTTGAGTCTGG - Intergenic
1172838525 20:37888184-37888206 CAAGCCCTGCCCATTGAACCCGG - Intergenic
1173004583 20:39130040-39130062 CAAGTCCCTCCACTTTATCCAGG - Intergenic
1173978600 20:47206029-47206051 CAAGCCCCTCCCCTCCTACCTGG + Intergenic
1174214569 20:48906180-48906202 ACATCCCCTCCCCTTGAAACTGG - Intergenic
1178099321 21:29250514-29250536 TAATCCCCTCCCCTTGAATGTGG + Intronic
1179458582 21:41517343-41517365 CAAGCCACTGCACTTGAGCCTGG - Intronic
1179804219 21:43826803-43826825 CACGCCCCTCCCCTGGCACAGGG + Intergenic
1180987132 22:19911696-19911718 CAGGACCCTCCCCTTGACCCTGG + Intronic
1181407395 22:22694597-22694619 CCAGCCCCTCCCCCTGCAGCAGG - Intergenic
1181415393 22:22755364-22755386 CCAGCCCCTCCCCCTGCAGCAGG - Intronic
1183097224 22:35560175-35560197 TATGCCCCTCCCCTTGATCAGGG + Intergenic
1183981158 22:41541148-41541170 GAAGCCCCTAGCCTTGTACCTGG + Intronic
949116021 3:324680-324702 CAAGCCACTGCGCTTGAGCCTGG - Intronic
949327738 3:2886078-2886100 ATGGCCCCTCCCCTTGAATCTGG - Intronic
953512855 3:43560275-43560297 CAAGCCCCTCATCCAGAACCAGG - Intronic
956797667 3:72731211-72731233 CAAACCCCTTCTCTTAAACCAGG + Intergenic
956798404 3:72736316-72736338 CAAACCCCTTCTCTTAAACCAGG + Intergenic
957759586 3:84538037-84538059 CAAGCCCCTCCCCTGTAAAATGG - Intergenic
958017988 3:87964847-87964869 CAAGCCCCTCCCGTGACACCTGG - Intergenic
959676308 3:109039831-109039853 CAAGCCCCTCCCCTTCTAGCTGG + Intronic
959777654 3:110188002-110188024 CAAGCCCCTCCCCTGACACATGG + Intergenic
961397860 3:126609626-126609648 CATGCCCCTTCCCTTTACCCTGG - Intronic
961490839 3:127255861-127255883 CAATCACCTCCCCTGGATCCAGG + Intergenic
964323898 3:155526215-155526237 CAATCCCCTCCCTTTGAGCGTGG + Intronic
964420013 3:156492311-156492333 CAAGCCCCTCCCCTTGAATCTGG + Intronic
966219295 3:177534694-177534716 TCAGCCCTTCCGCTTGAACCTGG + Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
968269802 3:197394670-197394692 CTAGGCCCTCTCCTTGAACCTGG + Intergenic
968866908 4:3218882-3218904 CAAGCCTCTTCCCTGGGACCTGG - Intronic
969043931 4:4322832-4322854 CAATCCCCTCTCCTTGATCCAGG + Intergenic
969446783 4:7249472-7249494 ATGTCCCCTCCCCTTGAACCTGG - Intronic
969589889 4:8115748-8115770 AAAGCCCCTCACCTTGAACCTGG + Intronic
971496461 4:27271129-27271151 GAACCCCCAACCCTTGAACCTGG - Intergenic
971755659 4:30704686-30704708 CTGTCCCCTCCCCTTGAAACAGG - Intergenic
975531909 4:75408115-75408137 CAAACTCATCTCCTTGAACCTGG - Intergenic
976205167 4:82617398-82617420 CACTCCCCTCCCATGGAACCTGG - Intergenic
976320339 4:83707281-83707303 CTTGCCCCTCCCCTTGAACCTGG + Intergenic
980167425 4:129246109-129246131 AAAGCCCCTTCCCTGGAACTGGG - Intergenic
981133085 4:141180306-141180328 CATTCCCTTCCCCTTTAACCAGG + Intronic
983367793 4:166816872-166816894 CAAACCCCTCCCATTGCACTGGG - Intronic
985113369 4:186568342-186568364 CACGCCACTCCACTTCAACCTGG - Intergenic
985781803 5:1875577-1875599 CCAGCCCCTCCCCGTGGCCCTGG - Intergenic
986821973 5:11477453-11477475 CAAGCCACTCTACTTCAACCTGG - Intronic
987316409 5:16728692-16728714 CAAGCCACTCCACTTGGATCAGG - Intronic
987677533 5:21093942-21093964 CAAGGTCCCTCCCTTGAACCTGG - Intergenic
992175977 5:74148963-74148985 GAAGCCCCTTCCCGTGAATCTGG - Intergenic
993678559 5:90847555-90847577 CAAGCACCTCCCCCTGCTCCAGG - Intronic
997614873 5:135239398-135239420 CAAGCCCCTTCCCATGAGGCTGG - Intronic
999327047 5:150650048-150650070 CAAGCCCAGCTCCTTGGACCTGG + Exonic
1001581101 5:172799044-172799066 CAAGCCCCACCCGTTGGACAGGG - Intergenic
1002604460 5:180374140-180374162 CAAGCCACTGCCCTTGAGCCTGG + Intergenic
1002831664 6:827288-827310 CACGCTTCTCCCCTTGAATCAGG - Intergenic
1003399366 6:5779112-5779134 CCAGCACCCGCCCTTGAACCAGG + Intergenic
1004217429 6:13715775-13715797 TAATCCCCTCCCCTTGAATATGG - Intergenic
1004827061 6:19434257-19434279 TAAGCCCTTCCCCTAGAACCAGG + Intergenic
1006297318 6:33175644-33175666 CCATCCTCTCCCCTGGAACCAGG + Exonic
1006666637 6:35699391-35699413 TAGTTCCCTCCCCTTGAACCTGG - Intronic
1006842943 6:37042221-37042243 CAATTCCCTCTGCTTGAACCTGG + Intergenic
1007266411 6:40599667-40599689 CCTGCCCCTCCCCCTGCACCCGG - Intergenic
1007992418 6:46270584-46270606 CAAGCCCCTCCCTTTGAATATGG + Intronic
1008354509 6:50535389-50535411 CAAGATCCTCCACTTGACCCTGG + Intergenic
1013602209 6:111715442-111715464 CAAGCCCCTCCCCTTGAGTGTGG + Intronic
1014228623 6:118876907-118876929 ATATCCCCTCCCCTTGAATCAGG + Intronic
1015036277 6:128658761-128658783 CAAGCACCTCCTATTGGACCTGG - Intergenic
1017504933 6:155059687-155059709 TAAGCCCCTCTCCTTGCACATGG + Intronic
1018225992 6:161629385-161629407 CAAGCCTCTCCCCTGCACCCCGG + Intronic
1018923222 6:168189952-168189974 GAAGCCCCTTCCCATGGACCGGG + Intergenic
1019355288 7:575464-575486 TAACCCCCTCCCCTTGATGCTGG - Intronic
1019432735 7:1007010-1007032 CATGCCCCGTCCCTAGAACCCGG - Intronic
1019687913 7:2391945-2391967 CATTCTCCTCCCCTTGAACCTGG - Intergenic
1022500388 7:30878882-30878904 CAAGCCCATCCACTTTCACCAGG + Intronic
1023103588 7:36742897-36742919 CAAGCTCTTCCCCTTGAGCAAGG + Intergenic
1026887896 7:73965144-73965166 CAATCCCCTCTCCCTGTACCTGG + Intergenic
1027156477 7:75771938-75771960 CAAGCCCCTTCCCTGGACCTGGG - Exonic
1028723149 7:94057223-94057245 CCTGTCCCTCCCCTTGCACCTGG - Intergenic
1029640834 7:101817659-101817681 CACGCCGCTCACCTTCAACCTGG - Intronic
1034439114 7:151077585-151077607 CTGGCCCCTCCCCTTGCCCCAGG + Intronic
1034613821 7:152397237-152397259 CAAGCCCCTGCACTCCAACCTGG - Intronic
1035694838 8:1587310-1587332 CAAGACCATCCCCCTGAAGCTGG - Intronic
1040840828 8:51782286-51782308 TAAGCCCTTCTCCTTGAACCTGG - Intronic
1041421289 8:57669761-57669783 TTGTCCCCTCCCCTTGAACCTGG + Intergenic
1042668997 8:71240197-71240219 CAAGCCCCTTTCCTTGGCCCTGG + Intronic
1043443085 8:80294133-80294155 CATGACCCACCACTTGAACCCGG - Intergenic
1043590368 8:81825166-81825188 ATTTCCCCTCCCCTTGAACCTGG - Intronic
1044206771 8:89500041-89500063 CAATCCCCTCTCCTTGAGGCTGG - Intergenic
1048073162 8:131041604-131041626 CAAGCCACGCCCCCGGAACCGGG + Exonic
1048195957 8:132331996-132332018 CAATCCCCTCCCCTTGAATGTGG + Intronic
1048676917 8:136793840-136793862 CAAGCCCCGCCCCCTGCTCCAGG - Intergenic
1049247299 8:141569683-141569705 GAAGCCCCTCCCCTGGATCCAGG + Intergenic
1049694267 8:143975975-143975997 CAAGCCCTTCCCCTGGACACCGG + Intronic
1049708516 8:144053529-144053551 AAAGCCCCTCTCCTTGAGCCTGG + Intronic
1051083572 9:13321106-13321128 AATTCCCCTCCCCTTGAATCTGG - Intergenic
1051508114 9:17847328-17847350 CAACCCCCTCCCCCTTCACCTGG + Intergenic
1056248419 9:84722074-84722096 CAAGCCCCACACCCTAAACCTGG - Intronic
1057404154 9:94752776-94752798 TAATCCCCTCTCCTTGAATCTGG + Intronic
1057898355 9:98927722-98927744 AATTCCCCTTCCCTTGAACCCGG + Intergenic
1057898675 9:98930594-98930616 CAGGCTCCACCCCTTGAACCTGG + Intergenic
1058680180 9:107434022-107434044 CATGCCTCTCCCCTTGCTCCTGG + Intergenic
1060821586 9:126664424-126664446 ATACCCCTTCCCCTTGAACCAGG + Intronic
1062008893 9:134256540-134256562 CACCCGCCTCCCCTTGAAGCTGG - Intergenic
1062124810 9:134854411-134854433 GAGTCCCCTCCCCTTGAATCTGG - Intergenic
1062402534 9:136378792-136378814 CAAGCCCCTGCCCTGGGCCCCGG - Exonic
1186608853 X:11119103-11119125 CTGTCCCCTCCCCTTGAATCTGG - Intronic
1186682431 X:11890017-11890039 AGAGCCCTTCCCCTTGAATCTGG - Intergenic
1189281649 X:39823350-39823372 CTTTCCCCTCCACTTGAACCTGG + Intergenic
1189460182 X:41235130-41235152 CAAGCCCCTCACCTGGCACAAGG - Exonic
1189460679 X:41240191-41240213 GATGCCCCTCCCCTTGAACATGG - Intergenic
1189464291 X:41266635-41266657 CAAGCCCCTCTTCTTAAACCAGG - Intergenic
1190974888 X:55389461-55389483 CAAGCCTCACCCCTTGATCCTGG - Intergenic
1192363794 X:70455045-70455067 CATGCCCCGCCCCCTGACCCAGG + Intronic
1193111170 X:77732104-77732126 CACCCCCCTCCCCATCAACCTGG + Intronic
1194432665 X:93829228-93829250 CATGCCACTGCACTTGAACCTGG + Intergenic
1200354146 X:155530406-155530428 CATGCCCCTACCCTTGGCCCTGG - Intronic