ID: 1106039053

View in Genome Browser
Species Human (GRCh38)
Location 13:26072403-26072425
Sequence CATAGATTCTTACACAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106039051_1106039053 3 Left 1106039051 13:26072377-26072399 CCCAGATGTTTTATTATCGGCTA 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1106039053 13:26072403-26072425 CATAGATTCTTACACAGTGCAGG 0: 1
1: 1
2: 0
3: 6
4: 187
1106039052_1106039053 2 Left 1106039052 13:26072378-26072400 CCAGATGTTTTATTATCGGCTAA 0: 1
1: 0
2: 1
3: 3
4: 86
Right 1106039053 13:26072403-26072425 CATAGATTCTTACACAGTGCAGG 0: 1
1: 1
2: 0
3: 6
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106039053 Original CRISPR CATAGATTCTTACACAGTGC AGG Intergenic
904971024 1:34419562-34419584 CACAGATTCTAACAATGTGCTGG - Intergenic
908176001 1:61555649-61555671 CTAAGATTCTTACACAGCACAGG + Intergenic
910502318 1:87906979-87907001 AATATATTCTTTCACAGTTCTGG + Intergenic
910685298 1:89909907-89909929 CCAAGATTCTTACTCAGTGAGGG - Intronic
911661343 1:100505095-100505117 CATGGTTTCTAACACAGTACCGG + Intronic
915561945 1:156692773-156692795 CAGAGATTCTTATCCAGGGCAGG + Intergenic
917409846 1:174748347-174748369 GAGATATTCTCACACAGTGCTGG - Intronic
920521010 1:206626261-206626283 CATTTATTCTTTCACAGTTCTGG - Intergenic
1063237042 10:4127698-4127720 CAGAGATTCAAACACAGTGCTGG + Intergenic
1064552291 10:16515869-16515891 CATGCATTATTACATAGTGCAGG - Intronic
1067670334 10:48314648-48314670 CAGGCATCCTTACACAGTGCTGG - Intronic
1068118739 10:52762667-52762689 AATTTATTCTTACACAGTGCTGG + Intergenic
1068946189 10:62731682-62731704 CAAATATTCTTATACATTGCTGG - Intergenic
1070033165 10:72696683-72696705 CATAGACTCTAGCACAATGCTGG + Intronic
1071197796 10:83181491-83181513 CATAGATTCTTGGAAAATGCAGG - Intergenic
1073901674 10:108229546-108229568 CAGAGATTTTGACACAGTGGAGG - Intergenic
1074359786 10:112816159-112816181 CAGAGATGCTTACACAGGTCAGG - Exonic
1076380589 10:130022395-130022417 CATTTATTCTTCCACAGTTCTGG - Intergenic
1078401545 11:11032239-11032261 CAGACACTCTTACACATTGCTGG - Intergenic
1078804387 11:14682685-14682707 GATATATTCTTATACATTGCTGG + Intronic
1080235848 11:30067389-30067411 CACAGAGTCTTACTCACTGCTGG - Intergenic
1080933997 11:36842547-36842569 AATATATTCTTTCACAGTTCTGG + Intergenic
1081676972 11:44975699-44975721 CACAGATCCTAACACAGAGCAGG - Intergenic
1081863003 11:46344989-46345011 CATACCATCTTACACAGGGCTGG - Intronic
1084404694 11:68964575-68964597 CATTGATTCTCCCACAGTCCTGG + Intergenic
1085289756 11:75389380-75389402 CTTTCATTCTTACACAGAGCAGG - Intergenic
1086454029 11:86944047-86944069 AATTTATTCTTACACAGTTCTGG + Intronic
1086952304 11:92903763-92903785 AATTGATTCTTTCACAGTTCTGG - Intergenic
1088372896 11:109110864-109110886 CATTGATTCTCTCACAGTTCTGG - Intergenic
1088757539 11:112898500-112898522 CATTGATTATGACACAGTGATGG + Intergenic
1089336784 11:117730446-117730468 CATTGATTGTCACACAGTTCCGG - Intronic
1090388545 11:126371886-126371908 TATAGTTTCTCACACATTGCTGG - Intronic
1091890438 12:4049738-4049760 CATGGATTCTTACTCAGTTAAGG - Intergenic
1093801859 12:23383121-23383143 AATTTATTCTTACACATTGCTGG - Intergenic
1095015316 12:36966512-36966534 CATATAATGTTACACAGAGCCGG + Intergenic
1097449958 12:59725280-59725302 CATAGATCTTTACAAAGTGAGGG + Intronic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1099442798 12:82718275-82718297 CATCTATTCTTTCACATTGCAGG + Intronic
1099904699 12:88758421-88758443 AATTTATTCTTTCACAGTGCTGG + Intergenic
1102854897 12:116285279-116285301 CTAAGTTTCTTACACATTGCAGG + Intergenic
1103029575 12:117601700-117601722 CATTTATTCTTTCACAGTCCTGG - Intronic
1103730771 12:123026425-123026447 CATTTATTCTTTCACAGTTCTGG - Intronic
1105925648 13:25005259-25005281 CATAAATTCTTACACAGTGCAGG - Intergenic
1106039053 13:26072403-26072425 CATAGATTCTTACACAGTGCAGG + Intergenic
1108599681 13:51981660-51981682 CATTGATTCTTCCTCAGTGGGGG - Intronic
1110232218 13:73178887-73178909 CATGTATTCTTTCACAGTTCTGG - Intergenic
1110505981 13:76286679-76286701 CATTGGGTATTACACAGTGCAGG - Intergenic
1111987826 13:95082821-95082843 CATACTTTCTTACACAAAGCCGG - Intronic
1116462624 14:45195062-45195084 CAGAAATTCTTTTACAGTGCTGG - Intronic
1119016366 14:71060081-71060103 GTTAGATTCTTACACAGTCATGG + Intronic
1120132128 14:80820125-80820147 CATATATTCTTACAGAGGTCAGG - Intronic
1127373115 15:58358491-58358513 CATAGATTCTCACACATACCTGG + Intronic
1128038967 15:64552997-64553019 AATAGTTTTTTAAACAGTGCTGG - Intronic
1129173490 15:73822357-73822379 CATTGATTTTTAAACATTGCAGG - Intergenic
1130134842 15:81173932-81173954 CATTGATTCCTTAACAGTGCAGG + Intronic
1130437582 15:83916816-83916838 CATGGAGTCTAACACAGAGCAGG - Intronic
1130787784 15:87119140-87119162 CATAGATTCTTGCATCTTGCAGG - Intergenic
1134248609 16:12558599-12558621 CACAGCTGCTCACACAGTGCAGG + Intronic
1138032266 16:53569075-53569097 CATAGATATTCACACAGTCCTGG + Intergenic
1141206233 16:81935102-81935124 CATTTATTCTTGCACAGTCCTGG + Intronic
1203142582 16_KI270728v1_random:1778030-1778052 CATTGATTCTCCCACAGTCCTGG - Intergenic
1148996965 17:51719124-51719146 CATAAAATCTCACACAGTACTGG + Intronic
1152621387 17:81366591-81366613 CATAGAAGGTTATACAGTGCAGG - Intergenic
1156274206 18:35566744-35566766 CTTAAATTCTCACACATTGCTGG + Intergenic
1156359570 18:36372537-36372559 GATAGATTCTTATTCAGTGTGGG + Intronic
1156791280 18:40977196-40977218 CCTAGATGCTTCCCCAGTGCAGG - Intergenic
1157822577 18:50784519-50784541 CATGGATTCTGAAACAGTGAGGG + Intergenic
1159726442 18:71966308-71966330 AATATATTCTTAGACAGTTCAGG - Intergenic
1164461402 19:28452161-28452183 CATAGATTCTAAAACAGACCAGG + Intergenic
924993438 2:336265-336287 CATTTATGCTTACACAGTTCTGG - Intergenic
926212176 2:10879209-10879231 CATCGATTCTCTCACAGTTCTGG + Intergenic
929449420 2:42026920-42026942 CATACATTCATACACTGTCCTGG + Intergenic
932264319 2:70353845-70353867 AATTTATTCTTTCACAGTGCTGG + Intergenic
932281005 2:70491781-70491803 CATGGAATCTTGCACAGGGCAGG - Intronic
934887862 2:98040448-98040470 CATTTATTCTGCCACAGTGCAGG + Intergenic
936270838 2:111047375-111047397 CTTAGAATCTTACTTAGTGCAGG - Intronic
938121706 2:128638649-128638671 CATATATTATCTCACAGTGCAGG - Intergenic
939395361 2:141622597-141622619 AATGGATTCTTACATAGTCCTGG - Intronic
939844837 2:147230435-147230457 CTTGGATACTTACACAGGGCTGG - Intergenic
942151353 2:173078630-173078652 CACAGATTCTTCTACTGTGCTGG - Intronic
943175345 2:184466186-184466208 CATAGATTATTTCCCAGTGGAGG - Intergenic
943979438 2:194529317-194529339 CATTGAGTGTTACGCAGTGCAGG + Intergenic
945370672 2:209013007-209013029 CATATTTAATTACACAGTGCTGG - Intergenic
947485695 2:230546679-230546701 AATAGATTCTTACAGAGGCCAGG + Intergenic
1170959716 20:21014446-21014468 CACAGATTCTGACACACTGCAGG + Intergenic
1173133493 20:40417117-40417139 CAGAATTTCTTACACACTGCTGG + Intergenic
1173420293 20:42895188-42895210 CATTTATTTTTACACAGTTCTGG + Intronic
1173928096 20:46795796-46795818 CGTAGATTCTGACAAAGTGAGGG + Intergenic
1175132133 20:56797292-56797314 TATTGATTCTCTCACAGTGCTGG + Intergenic
1177146061 21:17408197-17408219 CAGAGCAACTTACACAGTGCAGG + Intergenic
1178826433 21:36020952-36020974 CATTTATTCTTGCACAGTCCTGG - Intergenic
1179802014 21:43815508-43815530 CATAGATTCTCCCACAGTCCCGG + Intergenic
1180244130 21:46534991-46535013 GATTGATTTATACACAGTGCTGG + Intronic
1182244391 22:28944114-28944136 AATAGATATTTACACACTGCTGG + Intronic
1184622648 22:45693901-45693923 CATTTATTTTTACACAGTTCTGG - Intronic
1184649064 22:45911357-45911379 CATTTATTCTCTCACAGTGCTGG - Intergenic
950876492 3:16279404-16279426 CATAGTATCTAGCACAGTGCCGG + Intronic
951936858 3:28031911-28031933 CTTAGATACTTTCACAGTGTAGG + Intergenic
956927490 3:74004915-74004937 CATAGAGCCTCACACATTGCAGG - Intergenic
957888118 3:86317274-86317296 CATAGAATCTTGCACAAAGCAGG - Intergenic
959851999 3:111098329-111098351 AATATATTCTCACACAGTTCTGG + Intronic
960442878 3:117710715-117710737 CATAGGCTCTTACAAAATGCTGG + Intergenic
962573844 3:136737663-136737685 AATAGATTCTGACACAGTAAGGG - Intronic
963117597 3:141744934-141744956 CATAGATTCTAGAACAGTGATGG + Intronic
964251333 3:154721207-154721229 CTTTGATTTTTACACAGTACTGG + Intergenic
964620337 3:158714928-158714950 TATAGATTCTTAAAAAATGCTGG + Intronic
968148987 3:196322286-196322308 AATAGATTTTCTCACAGTGCTGG + Intronic
976544381 4:86317826-86317848 CATTTATTCTCTCACAGTGCTGG + Intronic
977118762 4:93069372-93069394 CATAAACCCTTACACAGTGGGGG + Intronic
977373371 4:96169699-96169721 CATAGATTCTTGCACTGAGCAGG + Intergenic
980327919 4:131372192-131372214 CAGAGATTCTAACAGAGTGAAGG - Intergenic
982548234 4:156761172-156761194 CATAGATTCCTATTCAGGGCTGG - Exonic
988779165 5:34503496-34503518 GATAGATTACTAGACAGTGCTGG - Intergenic
990026639 5:51199726-51199748 CATATATTTTTACACAGTTAAGG + Intergenic
991612135 5:68460362-68460384 CCTGGATTCTTACACGGTGGAGG - Intergenic
991668354 5:69022495-69022517 CATTGATTCTTTCACAGTTATGG - Intergenic
994132788 5:96249771-96249793 CATAGATTCATAGACTGTGTTGG + Intergenic
994714454 5:103305120-103305142 CATTTATTCTTTCACAGTTCTGG + Intergenic
995317011 5:110786523-110786545 AAGGGATTCTTACACACTGCTGG + Intergenic
998891725 5:146753367-146753389 TATAGAACCTTACACAGAGCAGG + Intronic
998909371 5:146941842-146941864 CATTTATTCTTTCACAGTTCTGG + Intronic
999501888 5:152155270-152155292 GATAGTTTCTTTCACTGTGCAGG + Intergenic
1003113429 6:3267221-3267243 CAGAGGTTCTTAAGCAGTGCGGG + Intronic
1004573629 6:16871706-16871728 CATATATTATTATCCAGTGCTGG - Intergenic
1006174182 6:32111972-32111994 AACAGTTTCCTACACAGTGCGGG + Intronic
1007948799 6:45850995-45851017 CATAGTCTCTTACAGAGAGCTGG + Intergenic
1008004753 6:46399527-46399549 AATGTATTCTTTCACAGTGCTGG + Intronic
1008724493 6:54400456-54400478 CAGAGAGTCTAACACAGAGCAGG - Intergenic
1008872493 6:56289107-56289129 CAAAGCTCCTGACACAGTGCAGG + Intronic
1009746506 6:67823191-67823213 CGGAAATTCTTACACAGTTCCGG - Intergenic
1010799807 6:80162358-80162380 CTTACATTCTTTCAGAGTGCAGG - Intronic
1011798571 6:90983660-90983682 CATTGATTCTTTCCCAGTCCTGG + Intergenic
1012443377 6:99283527-99283549 AATAGATTTTTACATAGTGGGGG - Intronic
1013181809 6:107722652-107722674 CATGGATTCTTCCACAATGTAGG + Intronic
1013287219 6:108691890-108691912 CATTAATTCTAGCACAGTGCTGG - Intergenic
1013706607 6:112842586-112842608 AATTGATTCTTTCACAGTTCTGG + Intergenic
1013872032 6:114775794-114775816 CATAGATGCTTACACATTTTAGG + Intergenic
1022493043 7:30835529-30835551 CATAGATTCTACCACTGGGCTGG - Intronic
1023530730 7:41150659-41150681 TAGAATTTCTTACACAGTGCAGG + Intergenic
1023796634 7:43798924-43798946 CAGAGACTGTTACATAGTGCTGG + Intronic
1028768288 7:94585515-94585537 TATTCATTCTTACACATTGCAGG - Exonic
1029897680 7:104002459-104002481 CAAAAATTCTTACACATGGCTGG + Intergenic
1030394063 7:108963257-108963279 CAGGGACTCTTACACACTGCTGG + Intergenic
1037692311 8:21192457-21192479 CACAGAGTCTAGCACAGTGCTGG + Intergenic
1038086640 8:24205205-24205227 CTTACATTCTTCCACAGTGATGG + Intergenic
1045640865 8:104248804-104248826 CAGAAATTCTTACCCATTGCAGG - Exonic
1046978204 8:120307265-120307287 CATAGTTTCTGACACACTGGGGG + Intronic
1048174861 8:132142449-132142471 CATAGAGTGTGACACAGAGCAGG + Intronic
1048984037 8:139721634-139721656 GACAGTTCCTTACACAGTGCTGG - Intergenic
1050285551 9:4098053-4098075 CATAGAGTCTTCCACACAGCAGG + Intronic
1051208415 9:14714329-14714351 CATACATTCTTAAAATGTGCTGG + Intergenic
1052560695 9:30079429-30079451 CATGGATTCTCAAACATTGCTGG - Intergenic
1055563500 9:77545472-77545494 CATATTTTCTTTCACAGTGGTGG - Intronic
1058658801 9:107249945-107249967 GAAAGATTCTTGCACACTGCTGG + Intergenic
1058938563 9:109791906-109791928 CACAGATTTTAACACAGTGTAGG + Intronic
1185549962 X:975153-975175 CATTGATTCTCCCACAGTCCTGG + Intergenic
1185549994 X:975388-975410 CATTGATTCTCCCACAGTCCTGG + Intergenic
1185609981 X:1388485-1388507 CATTGATTCTCCCACAGTCCTGG - Intronic
1185616684 X:1426234-1426256 CATTGATTCTCCCACAGTCCTGG - Intronic
1185622225 X:1457141-1457163 CATCGATTCTTCCACAGTCCTGG - Intergenic
1185627924 X:1495560-1495582 CATTGATTCTCCCACAGTCCTGG - Intronic
1185627962 X:1495795-1495817 CATTGATTCTCCCACAGTCCTGG - Intronic
1185631127 X:1516428-1516450 CATTGATTCTCCCACAGTCCTGG - Intronic
1185672134 X:1821351-1821373 CATTGATTCTCCCACAGTCCTGG + Intergenic
1185672169 X:1821586-1821608 CATTGATTCTCCCACAGTCCTGG + Intergenic
1185681971 X:1896502-1896524 CATTGATTCTCCCACAGTCCTGG + Intergenic
1185682045 X:1896971-1896993 CATTGATTCTCCCACAGTCCTGG + Intergenic
1185700161 X:2225592-2225614 CATTGATTCTCCCACAGTCCTGG - Intronic
1185704724 X:2258151-2258173 CATTGATTCTCCCACAGTCCTGG - Intronic
1185714251 X:2328463-2328485 CATTGATTCTCTCACAGTCCTGG - Intronic
1185721851 X:2388563-2388585 CATTGATTCTCCCACAGTACTGG - Intronic
1185746107 X:2574722-2574744 CATTGATTCTCCCACAGTCCTGG - Intergenic
1185773903 X:2786923-2786945 CATTGATTCTCCCACAGTCCTGG - Intronic
1185773940 X:2787158-2787180 CATTGATTCTCCCACAGTCCTGG - Intronic
1185800677 X:3007752-3007774 CATTGATTCTCCCACAGTCCTGG + Intronic
1185809822 X:3097097-3097119 CATTTATTCTTTCACAGTTCTGG - Intronic
1185954276 X:4472278-4472300 CATTGATTCTTTCATAGTTCTGG + Intergenic
1186098042 X:6123552-6123574 CTTAGAATCTAACACAGTGTGGG + Intronic
1186146760 X:6632277-6632299 CATTGATTCTCCCACAGTCCTGG + Intergenic
1187629001 X:21147394-21147416 CATAGATTTGTACATAGTGATGG - Intergenic
1188629101 X:32329068-32329090 CATAGAGTCTATCACAGAGCAGG - Intronic
1189770664 X:44423149-44423171 AATATATTCTCACACAGTTCTGG + Intergenic
1189950529 X:46225783-46225805 CATAAATTATTTCACAGTTCTGG - Intergenic
1194588271 X:95764883-95764905 CATAGATACTGCCACAGTGGGGG + Intergenic
1195143570 X:101989284-101989306 TATAAACTCTTACACAGGGCTGG + Intergenic
1195239606 X:102937807-102937829 CATAGAGTCTTTCACGGAGCTGG + Exonic
1195298102 X:103500246-103500268 CATAGAGTCTTTCACGGAGCTGG - Exonic
1195987787 X:110649729-110649751 CATAGTATCTTACATAGTGGTGG + Intergenic
1198043047 X:132873557-132873579 CATTTATGCATACACAGTGCTGG - Intronic
1198977494 X:142353190-142353212 CATAGTTTCTTCCAGAGTACTGG + Intergenic
1199507059 X:148574920-148574942 CATAAATACATACATAGTGCTGG + Intronic
1199923753 X:152439481-152439503 CTGAGACTCTTACACACTGCCGG + Intronic
1201234979 Y:11900504-11900526 CATTGATTCTCCCACAGTCCTGG + Intergenic
1201299844 Y:12496111-12496133 CATTGATTCTCCCACAGTCCTGG + Intergenic
1201501980 Y:14654803-14654825 CTTAGAATCTAACACAGTGTGGG - Intronic