ID: 1106042063

View in Genome Browser
Species Human (GRCh38)
Location 13:26103094-26103116
Sequence GAGGGCAAGCAGAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2538
Summary {0: 4, 1: 88, 2: 316, 3: 677, 4: 1453}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106042054_1106042063 24 Left 1106042054 13:26103047-26103069 CCTGGCTCATCTCACTGGGACTG 0: 72
1: 556
2: 975
3: 1210
4: 932
Right 1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG 0: 4
1: 88
2: 316
3: 677
4: 1453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106042063 Original CRISPR GAGGGCAAGCAGAAGCAGGA TGG Intergenic
Too many off-targets to display for this crispr