ID: 1106048070

View in Genome Browser
Species Human (GRCh38)
Location 13:26164096-26164118
Sequence TTGAATATACAGGTTGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106048070 Original CRISPR TTGAATATACAGGTTGACAG TGG Intronic
903133040 1:21291393-21291415 GTGAATAAACAGGTTTAGAGGGG + Intronic
905979202 1:42208644-42208666 TTGAATAGAAATGGTGACAGTGG - Intronic
906793559 1:48679028-48679050 ATGGATATGCAAGTTGACAGTGG + Intronic
906933776 1:50194331-50194353 TTGAGGAAACAGGTTGAAAGTGG + Intronic
908708071 1:66982379-66982401 ATTAATATACAGGTTGATACCGG - Intronic
909459960 1:75900166-75900188 TTAATTTTACAGGTTCACAGAGG + Intronic
909531145 1:76683110-76683132 TTGAATATAAAGGTACACACTGG + Intergenic
910964233 1:92791998-92792020 TTGAATATACACATTCACAGAGG - Intronic
912248950 1:107991104-107991126 TTGGTTATTTAGGTTGACAGAGG - Intergenic
912424089 1:109571050-109571072 TTTAATATACAGATTGGCACTGG + Intronic
913007225 1:114646666-114646688 TTTAATATACAGTTTGACACTGG - Intronic
913525523 1:119688798-119688820 TTTAATTTAGAGATTGACAGGGG - Intronic
915164529 1:153941244-153941266 GTGAGGATACAGGCTGACAGAGG + Exonic
919674427 1:200367324-200367346 TTGGAAATACAGATTGAAAGAGG + Intergenic
920910917 1:210215502-210215524 TGGAAGATCCAGGATGACAGTGG + Intergenic
921311084 1:213844282-213844304 TTAAATATAAAAGTTGGCAGTGG - Intergenic
921684729 1:218076711-218076733 TTGAAAATACAGGCTGAAATGGG - Intergenic
922083478 1:222322337-222322359 TTAAAAAGACAGGTGGACAGAGG + Intergenic
1066392005 10:34984789-34984811 TTGAATAGCCATGGTGACAGCGG + Intergenic
1068855114 10:61789684-61789706 TTGAATTTTCAGGTTAACTGGGG + Intergenic
1069173266 10:65259327-65259349 TTCAGACTACAGGTTGACAGTGG + Intergenic
1070548201 10:77469462-77469484 CTGAATATAACGGTTGCCAGAGG + Intronic
1072757873 10:98032321-98032343 CTGAAGAAACAGGTTGACATTGG - Intergenic
1074614913 10:115058122-115058144 TTTAATATACACTTTGTCAGGGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075865150 10:125712225-125712247 TGTAATATACAGATTGACACAGG - Intergenic
1076286300 10:129300332-129300354 TTGAATCTACAGGTTAAGTGGGG - Intergenic
1078362878 11:10683111-10683133 TTTAATAAACAGATTGGCAGTGG + Intronic
1079482428 11:20895438-20895460 TTGAATACACAGCTAGAGAGTGG - Intronic
1079719874 11:23796842-23796864 TTGCATCTTAAGGTTGACAGAGG - Intergenic
1080138002 11:28880558-28880580 ATCAAATTACAGGTTGACAGTGG - Intergenic
1080437730 11:32261831-32261853 TTGATTTTACAGGCTCACAGCGG - Intergenic
1081448729 11:43153344-43153366 TTTAATATCCAGGTTGGGAGAGG + Intergenic
1083073816 11:60016379-60016401 TGGAATAAAAAGGTTGAGAGAGG - Intergenic
1083577729 11:63804444-63804466 TTGAACACACACGTGGACAGAGG + Intergenic
1086218496 11:84412351-84412373 TTGATTTTACAGTGTGACAGAGG + Intronic
1086502999 11:87472644-87472666 ATGAATATCCAGGTAGAGAGTGG - Intergenic
1088448362 11:109955649-109955671 TTCAAAATTCAGGTTGTCAGGGG - Intergenic
1091287013 11:134413049-134413071 TGGAATATACAGCTCCACAGAGG - Intergenic
1091982638 12:4878927-4878949 TTGATTTTACAGGTTCATAGGGG - Intergenic
1092862087 12:12727074-12727096 TTGGAAATACAGTTTCACAGGGG - Intronic
1095443386 12:42260341-42260363 TCCAATATTCAGGTAGACAGTGG - Intronic
1097478783 12:60094164-60094186 TAGATTATACAGATTGACAAAGG + Intergenic
1099242854 12:80158870-80158892 TTGAATAGACGGGGTGAGAGTGG + Intergenic
1099308464 12:80988131-80988153 ATGAATATTCAGGATGATAGTGG + Intronic
1100715393 12:97300536-97300558 TTGTATATGCAGGTTGACCGTGG + Intergenic
1101115967 12:101531612-101531634 TTAAATATTCAGGTTTTCAGTGG - Intergenic
1105062468 12:133165728-133165750 TTGAATATACCTGTTCACTGGGG - Intronic
1106048070 13:26164096-26164118 TTGAATATACAGGTTGACAGTGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107777496 13:43861866-43861888 TTGAGTATCCAGGTGGAAAGTGG - Intronic
1108050287 13:46428434-46428456 TTAAGTATACAGGTGGACAGTGG + Intronic
1109542810 13:63801750-63801772 TTAAGTATACAGGTGGACAGTGG + Intergenic
1109702629 13:66047439-66047461 TTGATTTTACAGGCTCACAGGGG - Intergenic
1110440652 13:75521770-75521792 TTGATTTTACAGGCTGATAGGGG + Intergenic
1110868830 13:80426365-80426387 ATGAATAAAGAGGTGGACAGAGG - Intergenic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1113244713 13:108382017-108382039 TTGAATATGAGTGTTGACAGAGG - Intergenic
1114228977 14:20763405-20763427 TTGAATTCCCAGATTGACAGTGG - Intergenic
1114540794 14:23456819-23456841 TGGAATATCCAGGGTGATAGAGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1118506336 14:66416270-66416292 TTGAATAGACATGGTGACAGTGG - Intergenic
1119062892 14:71494163-71494185 TTGAATAGAAATGGTGACAGTGG + Intronic
1119552778 14:75527488-75527510 TTGAATTTACAGGGAGACAGGGG - Intronic
1125488193 15:40126927-40126949 TTAAATATCCAGGTTGGGAGAGG + Intergenic
1126303994 15:47233953-47233975 TTGAATACACATGGTGAGAGAGG + Intronic
1126864712 15:52924096-52924118 TTGAATATGTGGGTTGACTGGGG + Intergenic
1127516121 15:59694944-59694966 TGGAATATGCAGATTCACAGAGG + Intergenic
1128174863 15:65546182-65546204 ATGATTCTACAGGTTGACTGGGG - Intronic
1128908122 15:71486647-71486669 ATGTATATAGAGGTGGACAGAGG - Intronic
1130188849 15:81712376-81712398 TTGAATATCCAGGTTGGGAGAGG + Intergenic
1131949552 15:97666306-97666328 GTCAATAAACAGGTTGTCAGTGG + Intergenic
1132046266 15:98565427-98565449 TTGAAAATAATGGTTCACAGAGG - Intergenic
1133199404 16:4193552-4193574 TTTAATATACAGCTCGCCAGGGG - Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1140601643 16:76483096-76483118 TAGAATTTACAGGTTTGCAGTGG - Intronic
1141696961 16:85624727-85624749 TGGAATAAACAGGTGGAGAGAGG + Intronic
1145688305 17:26701020-26701042 TTGAACATTCCTGTTGACAGAGG + Intergenic
1146436958 17:32859178-32859200 TTCAATATACAGCTAGACAGAGG - Intronic
1153102209 18:1486392-1486414 GTGAGTATGCAGGTTGTCAGTGG - Intergenic
1153461857 18:5343590-5343612 TTGATTATACAGGGTGAGAGTGG - Intergenic
1155436902 18:25822247-25822269 TTTAATATACAGGTTAATTGGGG - Intergenic
1155543024 18:26886677-26886699 TTGAATATCCAGGTTGCGTGAGG - Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1159431034 18:68354117-68354139 TTGAATATTTAGGTTTACACAGG + Intergenic
1160611870 18:80095161-80095183 TTGATTATATAGGTAGACAAAGG - Intronic
1165544118 19:36519484-36519506 TTGAATTCAGAGGTTGAGAGTGG - Intronic
1166245037 19:41519238-41519260 TTTAATATACAGGTTGGAAAAGG - Intergenic
925475834 2:4213666-4213688 TTGAATAGACATGGTGAGAGTGG + Intergenic
926456440 2:13073537-13073559 TTGATTTTACAGGATGATAGGGG - Intergenic
927140664 2:20128830-20128852 TTGAATATAAAATTGGACAGGGG + Intergenic
930380869 2:50625983-50626005 TTGAATATAAATGTTGACAGTGG - Intronic
931154306 2:59609940-59609962 TTGAATATACATGCTGAAAGAGG + Intergenic
931820666 2:65948788-65948810 TAGACTAGACATGTTGACAGTGG + Intergenic
932021493 2:68091945-68091967 TTGAGTTTACAGTTTGACAGGGG - Intronic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933551807 2:83787308-83787330 TTCAATATACAGCTGGACAATGG + Intergenic
936020028 2:108987833-108987855 TTAAAGATACATTTTGACAGAGG - Intronic
936623399 2:114123292-114123314 TTGAATATCCCAGTTGAGAGGGG + Intergenic
937556277 2:123161343-123161365 TTTAATAGCCAGGTTGACAAGGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939340624 2:140891708-140891730 TATAATATACAGGTAGGCAGAGG + Intronic
939673244 2:145039770-145039792 TAGAACATACAGATTAACAGAGG + Intergenic
939844843 2:147230462-147230484 TTGAATTTAAAGGTTGAGTGAGG + Intergenic
941533575 2:166696621-166696643 TTTAATATCCAGGTTGGGAGAGG + Intergenic
943082609 2:183273933-183273955 CTGAATATAAATGGTGACAGTGG + Intergenic
943456233 2:188110964-188110986 TTGAATATACTGCATGATAGAGG - Intergenic
943842827 2:192602267-192602289 CTAAATATACAGGTTGAAAGAGG + Intergenic
945738577 2:213632507-213632529 TTGAATAACAAGGATGACAGTGG + Intronic
947172793 2:227327934-227327956 TTGATTATAAAGGTTGCCTGTGG + Intronic
947183781 2:227436263-227436285 TTTGATATAAAGGTTGACAGAGG - Intergenic
1169692144 20:8343957-8343979 TTGGACATGGAGGTTGACAGTGG - Intronic
1171834623 20:30123746-30123768 TTGAACATATATGTTGATAGAGG + Intergenic
1171834692 20:30125113-30125135 TTGAATATTTATGTTGATAGAGG + Intergenic
1171834763 20:30126478-30126500 TTGAATATTTATGTTGATAGAGG + Intergenic
1171834834 20:30127845-30127867 TTGAACATATATGTTGATAGAGG + Intergenic
1171834971 20:30129997-30130019 TTGAACATATATGTTGATAGAGG + Intergenic
1174742168 20:53025632-53025654 AAGAAAATACAGGTTGACACTGG - Intronic
1175018393 20:55816937-55816959 TTGAATATAAGTGTTGAGAGTGG + Intergenic
1181600758 22:23950505-23950527 TTCAAAATACAGGTTTAGAGAGG + Intergenic
1181607754 22:23990814-23990836 TTCAAAATACAGGTTTAGAGAGG - Intergenic
1181742993 22:24936197-24936219 GTGAATAAATAGGTGGACAGAGG - Intronic
1182525544 22:30915584-30915606 TTGAATATAAAGGGGGAAAGTGG - Intergenic
1182792981 22:32968406-32968428 TAGAATGCACAGGCTGACAGTGG - Intronic
1183117302 22:35701901-35701923 CTAAATATACAGGTTGAAAGAGG - Intergenic
1183582420 22:38733847-38733869 TTGAATGTACAGATGGGCAGAGG + Intronic
951568071 3:24032313-24032335 TTGAATATAAATGTTGAGAGTGG + Intergenic
952714589 3:36466884-36466906 TTGAATAGAAATGTTGAAAGTGG + Intronic
953786152 3:45912793-45912815 ACGAATATGCAGGTTGACTGGGG - Intronic
954203138 3:49037260-49037282 TTGAATATACAGATTGATTCCGG - Intronic
954478595 3:50774721-50774743 TTGAATAGAAATGGTGACAGTGG + Intronic
955986457 3:64578582-64578604 TTGAATATAGATGTTTGCAGTGG - Intronic
956437809 3:69251353-69251375 TACAATAGACAGGTTCACAGAGG + Intronic
957473528 3:80693147-80693169 TTGAATAAAAATGGTGACAGTGG + Intergenic
960051499 3:113242964-113242986 TTTAATATAGGGGTTGGCAGTGG + Intronic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
961961801 3:130863299-130863321 TTGAATATAAATGGTGGCAGAGG - Intronic
962567887 3:136681977-136681999 TTGAATAGAAAGGGTGACTGTGG - Intronic
962691789 3:137906646-137906668 TTGAACATAAAGTTTGAAAGAGG + Intergenic
963054393 3:141173679-141173701 TTGGTTATTTAGGTTGACAGAGG - Intergenic
964975036 3:162607612-162607634 TTGAATACACAGATGCACAGAGG - Intergenic
965827647 3:172746934-172746956 TTAAATATAGAGGATGAGAGTGG - Intergenic
967748492 3:193086525-193086547 TAGAATAAAAAGGTTGAGAGTGG + Intergenic
969120458 4:4905220-4905242 ACAAATATACAGTTTGACAGAGG - Intergenic
970165588 4:13233919-13233941 TTGAATAGAAATGTTGAAAGTGG - Intergenic
970748212 4:19325760-19325782 TTAAATATGCAGGATGACATTGG - Intergenic
970818270 4:20183653-20183675 TTGAATACACATGTTTATAGCGG - Intergenic
971025813 4:22587289-22587311 TTGAATATCCAGGTTGGGAGAGG - Intergenic
973615774 4:52676439-52676461 TTGAATTCACTGGTTCACAGGGG - Intergenic
975443348 4:74437025-74437047 TTGAATTTCCTGGCTGACAGGGG - Intergenic
975781054 4:77840289-77840311 ATGAATAAACATGTTAACAGTGG + Intergenic
976927493 4:90517571-90517593 TTGAATATACAGATTTAAACTGG + Intronic
977239249 4:94546841-94546863 TTGAATATTCAGGTTGAAAAAGG - Intronic
978076608 4:104538995-104539017 TTCAATATTCATGTAGACAGTGG - Intergenic
978487963 4:109277570-109277592 ATGAAAATACAGGTTGTCTGGGG - Intronic
978675143 4:111304922-111304944 TTGAATAGAAGTGTTGACAGTGG + Intergenic
979096495 4:116557555-116557577 TTGAATAGACATGGTGAGAGAGG + Intergenic
980321315 4:131281261-131281283 TTGAATAGAAATGTTGACACTGG + Intergenic
980371680 4:131882192-131882214 TTGAATATACATGTTAAGATGGG + Intergenic
982231179 4:153209539-153209561 TTGAAGGCACAGGTGGACAGTGG - Intronic
982428765 4:155298084-155298106 TTGATTTTACAGGCTCACAGGGG - Intergenic
983107431 4:163706059-163706081 CTGAATATACACCTTCACAGTGG + Intronic
983752192 4:171288632-171288654 TTGATTCTACAGCTTGACAGGGG - Intergenic
984757003 4:183333613-183333635 TTAAATACACAGGATGACAAAGG + Intergenic
986096621 5:4561739-4561761 TTAAATTTACACGTTGAGAGAGG + Intergenic
986904385 5:12476220-12476242 TTGAATATAGAAGTAGACAATGG - Intergenic
987592423 5:19947448-19947470 TTGAAAATACAGGCCGAGAGTGG + Intronic
987654538 5:20789346-20789368 TAGAATATAGAGGTTTCCAGTGG - Intergenic
989498345 5:42136283-42136305 TTGAATAGACATGTTAAAAGTGG - Intergenic
990624075 5:57592218-57592240 TTGAAAAAATAGTTTGACAGAGG - Intergenic
990711721 5:58588941-58588963 TTGAATAGACGTGATGACAGCGG + Intronic
993106674 5:83607948-83607970 TTGAATATTCATGTTGAATGTGG + Intergenic
994453804 5:99979866-99979888 TTGGATATACATGCTGATAGAGG - Intergenic
994996817 5:107074490-107074512 TTGAAGACAAGGGTTGACAGAGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997831770 5:137156594-137156616 GTGAATATACATGTTGAAAAGGG + Intronic
998831071 5:146159623-146159645 TTAAATAAGTAGGTTGACAGTGG - Intronic
999740406 5:154545714-154545736 TTGGAGATACTGGTTGAAAGAGG + Intergenic
999876702 5:155814634-155814656 TTGAATATGCATGGAGACAGAGG + Intergenic
1001057279 5:168460137-168460159 TTAAATATCCATCTTGACAGTGG + Intronic
1003283236 6:4712194-4712216 TTGAGTAGACAGGCTGACAGGGG + Intronic
1005210299 6:23452996-23453018 TTGAGCATACACGTAGACAGAGG + Intergenic
1006211500 6:32399392-32399414 TTGAATATGCTGATTGAAAGAGG - Intronic
1008809232 6:55473195-55473217 TTGAAGACAGAGGTTGCCAGCGG - Intronic
1009048809 6:58256386-58256408 TTTAATATCCAGGTTGGGAGAGG - Intergenic
1009049977 6:58263893-58263915 TTTAATATCCAGGTTGAGAGAGG - Intergenic
1009050161 6:58265183-58265205 TCTAATATACAGGATGAGAGAGG - Intergenic
1009224667 6:61011132-61011154 TTTAATATCCAGGTTGGGAGAGG - Intergenic
1009225522 6:61017149-61017171 TTTAATATCCAGGTTGAGAGAGG - Intergenic
1009225907 6:61019931-61019953 TTAAATATCCAGGTTGGGAGAGG - Intergenic
1009368830 6:62877234-62877256 TTTAATATCCAGGTTGAGAGAGG + Intergenic
1009369734 6:62883562-62883584 TTTATTATCCAGGTTGAGAGAGG + Intergenic
1009643648 6:66369537-66369559 TTAAATATAAATGATGACAGAGG + Intergenic
1009871246 6:69454374-69454396 TTGAATATGAATGTTGAGAGAGG + Intergenic
1012050259 6:94332914-94332936 TTGAATAAAAGTGTTGACAGTGG - Intergenic
1012727403 6:102831904-102831926 GTAAATATAGAGGTTGACAAGGG + Intergenic
1012836672 6:104278226-104278248 TTCAAAGGACAGGTTGACAGAGG - Intergenic
1013159267 6:107525683-107525705 CTGAACCTACAGGGTGACAGTGG - Intronic
1014723230 6:124944471-124944493 TTGAATATAGATGGTGAGAGTGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017657180 6:156640985-156641007 TTTAATACACAGGTTGACATTGG + Intergenic
1018516116 6:164581615-164581637 TTGAGTCTGCAGGTTTACAGAGG - Intergenic
1020365095 7:7372466-7372488 ATGAATAAACAGGTTGATATCGG - Intronic
1023919486 7:44616283-44616305 TGGTATAAACAGGTTGACTGGGG - Intronic
1025490071 7:61105410-61105432 TTGAATATACCTGTTCATAGAGG + Intergenic
1026407125 7:70077953-70077975 TTTAATATTCAGATTGACAGTGG + Intronic
1026887265 7:73958869-73958891 TGGAATATAAGTGTTGACAGGGG + Intergenic
1027356120 7:77357392-77357414 TGGAATATCCAGGTAGACACAGG + Intronic
1028624431 7:92862528-92862550 TTGATTTTACAGGTTCAGAGGGG - Intergenic
1029343403 7:99962063-99962085 TTTAATATCCAGGTGGAGAGAGG + Intergenic
1030267626 7:107636624-107636646 TTTAATAAACAGATTGACTGAGG - Intergenic
1030651766 7:112123689-112123711 TGGAATATACAAGTTGCCATGGG - Intronic
1031160567 7:118162629-118162651 TTGAATACAAATGTTAACAGTGG + Intergenic
1032153677 7:129451318-129451340 TTGAATATGTAGGGAGACAGAGG + Intronic
1033923954 7:146433460-146433482 TTGAAAATACACATTGACAAAGG + Intronic
1034828069 7:154285070-154285092 TTGAATATAGATGTTGGCAATGG + Intronic
1036992923 8:13619664-13619686 ATGAATATACATTTTGTCAGAGG - Intergenic
1037169352 8:15873115-15873137 TTGAATATATGTGGTGACAGAGG - Intergenic
1037664563 8:20956779-20956801 TTTAATCTATAGGTTGACTGGGG - Intergenic
1038171963 8:25143263-25143285 TTGCATATAAATGTTCACAGAGG + Intergenic
1040540677 8:48351634-48351656 TTGAATACAAATGGTGACAGAGG - Intergenic
1042740978 8:72046083-72046105 TTGAATATGTAGGTGGATAGAGG + Intronic
1042756623 8:72221029-72221051 TTGAATATGCAGGTGGATAGAGG + Intergenic
1043343102 8:79266071-79266093 ATGGATCTACAGGTTTACAGTGG + Intergenic
1043592450 8:81846668-81846690 TTGAATTTCCTGGCTGACAGAGG + Intergenic
1044550836 8:93510732-93510754 TTTAATATACAGGTTGATCCTGG + Intergenic
1045114329 8:98966540-98966562 TTGAGCATACAGGTTGTCAAGGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045470524 8:102508473-102508495 TTGAGTTTAGAGGATGACAGAGG + Intergenic
1045546573 8:103134320-103134342 TTGAAGATCCAGGTTAACTGTGG + Intronic
1045612547 8:103863002-103863024 TTGAATATAAATGGTGATAGTGG + Intronic
1046284516 8:112077194-112077216 TTGAATATAAACGGTGAAAGTGG + Intergenic
1046763229 8:118042799-118042821 TTGAATGTATAGGTGGGCAGAGG - Intronic
1047566092 8:126046234-126046256 TTCAATCTACAAGTTGATAGAGG + Intergenic
1048462400 8:134632418-134632440 TTGAAAATAACTGTTGACAGTGG + Intronic
1049895578 9:108636-108658 CTGAATATCCAGGGTGAGAGAGG + Intergenic
1050584234 9:7093665-7093687 TAAAATATACAGGATTACAGAGG + Intergenic
1050902812 9:10967214-10967236 CTTAATATACAGGTTGAAAGAGG + Intergenic
1052263388 9:26543908-26543930 TTGAATAGAAATGGTGACAGTGG - Intergenic
1052322921 9:27187761-27187783 GTGAAGATACAGGGAGACAGTGG - Intronic
1052520060 9:29535288-29535310 TTGAATAGAAATGGTGACAGTGG - Intergenic
1052994602 9:34544863-34544885 CTGAATATTCAGATTGAAAGGGG - Intergenic
1055394339 9:75857991-75858013 TTGAAGTTACAGGTTGATAGAGG - Intergenic
1057422920 9:94926707-94926729 ATGAGGATACAGGGTGACAGGGG + Intronic
1058518726 9:105799461-105799483 TTTAATATCCAGGTTAAAAGAGG - Intergenic
1058521703 9:105818921-105818943 CTAAATATACAGGTTGAAAGAGG + Intergenic
1060961851 9:127686370-127686392 CTGAATATACAGAATGTCAGAGG - Intronic
1061327215 9:129871194-129871216 TTGAATGTGGAGGTTGCCAGGGG - Intronic
1190374357 X:49774733-49774755 TTGAATATACTGGTTCACACTGG + Intergenic
1191008181 X:55733339-55733361 TTGAATAGACGTGTTGAAAGTGG + Intronic
1191057729 X:56260083-56260105 GTGAAGATGCAGGCTGACAGTGG - Intronic
1193390682 X:80924820-80924842 TTGAATAACAATGTTGACAGTGG + Intergenic
1193867728 X:86756771-86756793 TTGAATAGACATGCTGAAAGTGG + Intronic
1195614777 X:106903499-106903521 TTGAATAAACATGGTGTCAGTGG + Intronic
1197583766 X:128317707-128317729 TTGAATATAAGGGATGCCAGTGG + Intergenic
1197971093 X:132115822-132115844 ATGAATAAACAGGTTCACGGTGG + Intronic
1199283684 X:146032680-146032702 TTGAATATAAGTGTTGAAAGTGG - Intergenic
1199680752 X:150222873-150222895 TGGAATATAATGCTTGACAGTGG - Intergenic