ID: 1106050116

View in Genome Browser
Species Human (GRCh38)
Location 13:26181608-26181630
Sequence TACCTACCAATGGTATAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1798
Summary {0: 1, 1: 0, 2: 8, 3: 74, 4: 1715}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106050116_1106050126 19 Left 1106050116 13:26181608-26181630 CCAAGCTATACCATTGGTAGGTA 0: 1
1: 0
2: 8
3: 74
4: 1715
Right 1106050126 13:26181650-26181672 CCTGCCCACAGAAGGAGGGGAGG 0: 1
1: 0
2: 5
3: 33
4: 343
1106050116_1106050120 14 Left 1106050116 13:26181608-26181630 CCAAGCTATACCATTGGTAGGTA 0: 1
1: 0
2: 8
3: 74
4: 1715
Right 1106050120 13:26181645-26181667 GGACCCCTGCCCACAGAAGGAGG 0: 1
1: 0
2: 1
3: 17
4: 228
1106050116_1106050122 16 Left 1106050116 13:26181608-26181630 CCAAGCTATACCATTGGTAGGTA 0: 1
1: 0
2: 8
3: 74
4: 1715
Right 1106050122 13:26181647-26181669 ACCCCTGCCCACAGAAGGAGGGG 0: 1
1: 0
2: 1
3: 36
4: 228
1106050116_1106050121 15 Left 1106050116 13:26181608-26181630 CCAAGCTATACCATTGGTAGGTA 0: 1
1: 0
2: 8
3: 74
4: 1715
Right 1106050121 13:26181646-26181668 GACCCCTGCCCACAGAAGGAGGG 0: 1
1: 1
2: 3
3: 31
4: 220
1106050116_1106050119 11 Left 1106050116 13:26181608-26181630 CCAAGCTATACCATTGGTAGGTA 0: 1
1: 0
2: 8
3: 74
4: 1715
Right 1106050119 13:26181642-26181664 CTTGGACCCCTGCCCACAGAAGG 0: 1
1: 0
2: 1
3: 24
4: 243
1106050116_1106050118 -7 Left 1106050116 13:26181608-26181630 CCAAGCTATACCATTGGTAGGTA 0: 1
1: 0
2: 8
3: 74
4: 1715
Right 1106050118 13:26181624-26181646 GTAGGTATGTCTCTGTATCTTGG 0: 1
1: 0
2: 0
3: 16
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106050116 Original CRISPR TACCTACCAATGGTATAGCT TGG (reversed) Intronic
900817557 1:4860283-4860305 TACCCAGTAATGGTATGGCTGGG + Intergenic
901241931 1:7699529-7699551 TACCTAGGAATGGAATGGCTGGG + Intronic
901523922 1:9807406-9807428 TACATCCCACTGGAATAGCTGGG + Intronic
901707323 1:11084138-11084160 TACCAAGTAATGGGATAGCTGGG + Intronic
902139675 1:14342347-14342369 TACCTAGTAATGGGATTGCTGGG + Intergenic
902559714 1:17269944-17269966 TACCTAGCAGTGGAATTGCTGGG + Intronic
903030095 1:20457808-20457830 TACATAACCATGGTATGGCTGGG - Intergenic
903890371 1:26566079-26566101 TACCTAGCAATGGAATTGCTGGG + Intronic
905154559 1:35964637-35964659 TACCTAGTAATGGGATTGCTGGG + Intronic
906176448 1:43777908-43777930 TACCTAGTAATGGGATTGCTGGG - Intronic
906599708 1:47114926-47114948 TACCTAGTAATGGGATGGCTGGG - Intronic
906600267 1:47121056-47121078 TACCCAGTAATGGGATAGCTGGG - Intergenic
906736417 1:48133372-48133394 TACCTAGTAATGGCATTGCTGGG + Intergenic
906882968 1:49612861-49612883 TACCCAGCAATGGGATTGCTAGG - Intronic
907793179 1:57688545-57688567 TACCCAGTAATGGTATTGCTGGG - Intronic
907982222 1:59494853-59494875 TACCTACTAATGGGATTGCTGGG + Intronic
908019247 1:59882836-59882858 TACCTAGGAATGGGATTGCTGGG + Intergenic
908500653 1:64740681-64740703 TACCCAGTAATGGGATAGCTGGG - Intergenic
908503762 1:64773691-64773713 TACCCAGTAATGGGATAGCTAGG + Intronic
908668371 1:66517938-66517960 TACCCAATAATGGTATTGCTGGG - Intergenic
908732796 1:67243820-67243842 TACCCAGCAATGGGATTGCTGGG + Intronic
908765417 1:67550525-67550547 TACCCAGCAATGGGATGGCTGGG - Intergenic
908922788 1:69216417-69216439 TACCTAGTAATGGGATTGCTGGG + Intergenic
909048234 1:70736558-70736580 TACCCAGCAATGGGATGGCTGGG - Intergenic
909374284 1:74922506-74922528 TACCCAGTAATGGTATTGCTGGG - Intergenic
909414705 1:75392632-75392654 TACCAAGCAATGGGATTGCTAGG - Intronic
909446845 1:75757686-75757708 TACCCAGCAATGGGATTGCTGGG - Intronic
909456205 1:75852392-75852414 TACCTAGGAATGGAATTGCTGGG + Intronic
909678566 1:78265375-78265397 TACCCACTAATGGGATGGCTGGG + Intergenic
909697143 1:78480426-78480448 TACCCAGTAATGGGATAGCTGGG - Intronic
909772813 1:79445552-79445574 TACCTAGTAATGGGATTGCTGGG - Intergenic
910282233 1:85513983-85514005 TACCCAGCAATGGGATTGCTGGG - Intronic
910335224 1:86120772-86120794 TACCTAGTAATGGGATGGCTGGG - Intronic
910502709 1:87911129-87911151 TACCTCGAAATGGGATAGCTAGG + Intergenic
910582293 1:88842024-88842046 TACCCAGTAATGGTATTGCTGGG - Intergenic
910611221 1:89144388-89144410 TACCTAGTAATGGGATTGCTGGG + Intronic
910618280 1:89224621-89224643 TACCCAGTAATGGTATTGCTGGG + Intergenic
910788458 1:91025598-91025620 TACCTAGCAATAGGATTGCTGGG + Intergenic
910811480 1:91241993-91242015 TACCCAGTAATGGGATAGCTGGG + Intergenic
910924266 1:92382280-92382302 TACCCAGTAATGGGATAGCTGGG + Intronic
910942307 1:92549979-92550001 TACCCAGCAATGGGATGGCTGGG - Intronic
911202797 1:95062810-95062832 TACCCAGCAATGGGATTGCTAGG + Intronic
911796238 1:102080106-102080128 TACCCACTAATGGGATTGCTGGG - Intergenic
911801536 1:102145113-102145135 TACCTAGTAACGGTATTGCTGGG + Intergenic
911859394 1:102928605-102928627 TACCCAGTAATGGGATAGCTGGG + Intronic
911901381 1:103510232-103510254 TACCCAGCAATGGGATTGCTAGG + Intergenic
911966301 1:104376159-104376181 TACCTAGTAATGGGATGGCTGGG - Intergenic
912299053 1:108494660-108494682 TACCCACTAATGGGATGGCTGGG - Intergenic
912344341 1:108950988-108951010 TACCTAGCAATGGAATTGCTGGG - Intronic
913399136 1:118408777-118408799 TACCTAGTAATGGGATTGCTGGG - Intergenic
914324905 1:146603145-146603167 TACCCAGTAATGGTATTGCTGGG + Intergenic
914334658 1:146703453-146703475 TACCTAGTAATGGAATTGCTGGG + Intergenic
914459207 1:147867229-147867251 TACCCAGCAATGGGATTGCTGGG - Intergenic
914924076 1:151868760-151868782 TACCTAGCAGTGGAATTGCTGGG + Intergenic
914966821 1:152266877-152266899 TACCCAGTAATGGTATGGCTGGG - Intergenic
915037127 1:152937402-152937424 TACCCAGCAATGGGATGGCTGGG + Intergenic
915072161 1:153278996-153279018 TACCCAGTAATGGGATAGCTGGG + Intergenic
915771282 1:158427526-158427548 TACCCAGCAATGGGATTGCTGGG + Intergenic
916205470 1:162312093-162312115 TACCCAGCAATGGGATGGCTGGG + Intronic
916295918 1:163219929-163219951 TACCTAGGATTGGTATTGCTGGG + Intronic
916339718 1:163718325-163718347 TACCTAGCAATGGGATTGCTTGG - Intergenic
916473265 1:165144088-165144110 TACCTAGGAATGGAATTGCTAGG - Intergenic
916500601 1:165383761-165383783 TTCCTCACAATGGCATAGCTTGG - Intergenic
916553162 1:165869437-165869459 TCCCCACAAATGGTATTGCTGGG + Intronic
916593023 1:166211739-166211761 TACCTAGTAATGGGATGGCTGGG + Intergenic
916620776 1:166494165-166494187 TACCTAGTAATGGGATGGCTGGG + Intergenic
916646168 1:166787147-166787169 TACCTAGTAATGGGATTGCTGGG + Intergenic
916840296 1:168593690-168593712 TACCTAGCAGTGGAATTGCTGGG + Intergenic
916937055 1:169640137-169640159 TACCTAGTAATGGGATGGCTGGG - Intergenic
916940333 1:169670249-169670271 TACCTAGTAATGGGATTGCTGGG - Intronic
917043898 1:170835254-170835276 TACCCAGTAATGGTATTGCTGGG + Intergenic
917058491 1:171010447-171010469 TACCTAGTAATGGGATTGCTGGG + Intronic
917139504 1:171821043-171821065 TACCTACAAGTGGAATTGCTAGG + Intergenic
917234677 1:172878145-172878167 TACCTAGTAATGGGATGGCTGGG + Intergenic
917555222 1:176079117-176079139 TACCTACTAATGGGATTGCTGGG - Intronic
917732864 1:177893542-177893564 TAACTAGCAATGGGATTGCTGGG - Intergenic
918219196 1:182420296-182420318 TACCTAGTAATGGGATTGCTGGG + Intergenic
918776412 1:188637153-188637175 TACCTAGTAATGGGATTGCTGGG - Intergenic
918841832 1:189550770-189550792 TACCTAGGAGTGGAATAGCTAGG - Intergenic
918896786 1:190358642-190358664 TACCTAGTAATGGGATGGCTGGG - Intronic
918898833 1:190385711-190385733 TACCTAGTAATGGGATGGCTGGG - Intronic
918919736 1:190693017-190693039 TACCCACTAATGGGATTGCTGGG - Intergenic
919013135 1:191991501-191991523 TACATAGCAATGGGATTGCTGGG - Intergenic
919019999 1:192093075-192093097 TACCCAGCAATGGGATGGCTGGG + Intergenic
919177502 1:194036701-194036723 TACCCACTAATGGGATGGCTGGG + Intergenic
919518758 1:198560633-198560655 TACTGACCTATGGTATACCTAGG + Intergenic
919584430 1:199418587-199418609 TACCTAGTAATGGGATTGCTGGG + Intergenic
919608387 1:199714919-199714941 TACTTAGCAATGGAATTGCTAGG - Intergenic
920018761 1:202936794-202936816 TACCTAGTAATGGGATGGCTGGG + Intergenic
920221640 1:204407858-204407880 TACCTGCCATTGGTATATATGGG - Intronic
920608205 1:207410754-207410776 TACCTAGTAATGGGATTGCTGGG - Intergenic
920639279 1:207735962-207735984 TACCTAGTAATGGGATGGCTGGG - Intronic
920996890 1:211001644-211001666 TACCTAGTAATGGGATGGCTGGG - Intronic
921107683 1:211999117-211999139 TACCTAGAAATGGAATTGCTGGG - Intronic
921332011 1:214048944-214048966 TACCTAGTAATGGGATTGCTGGG - Intergenic
921617558 1:217288149-217288171 TACCTAGTAATGGGATCGCTGGG + Intergenic
921767291 1:218987183-218987205 TACCTAGCAATGGGATTGCTGGG + Intergenic
921886303 1:220310148-220310170 TACCTAGTAATGGGATGGCTGGG - Intergenic
921919213 1:220647523-220647545 TACCTAGTAATGGGATTGCTGGG - Intronic
922402429 1:225274043-225274065 TACCCACTAATGGGATTGCTGGG + Intronic
922404028 1:225293302-225293324 TACCCACTAATGGGATTGCTGGG - Intronic
923072670 1:230580083-230580105 TATCCACCATTGGTATAGCGTGG + Intergenic
923443955 1:234050148-234050170 TACCCAGTAATGGGATAGCTGGG + Intronic
923451501 1:234122078-234122100 TACCCAGCAATGGGATCGCTGGG + Intronic
924283468 1:242461602-242461624 TACCCACTAATGGGATTGCTGGG + Intronic
924308252 1:242714186-242714208 TACCCACTAATGGGATGGCTGGG - Intergenic
924398384 1:243649924-243649946 TACCCACTAATGGGATTGCTAGG + Intronic
924411702 1:243812650-243812672 TACCCACTAATGGGATGGCTGGG - Intronic
924417863 1:243877415-243877437 TACCCACTAATGGGATTGCTGGG + Intergenic
924487479 1:244499855-244499877 TACCCACTAATGGGATTGCTGGG + Intronic
924699293 1:246434776-246434798 TACCTACTAATGGCATTGCTGGG - Intronic
924830172 1:247585725-247585747 TACCCAGCAATGGGATTGCTGGG - Intergenic
924890163 1:248269194-248269216 TACCTAGTAATGGGATGGCTGGG + Intergenic
1062780982 10:207349-207371 TACCCACTAATGGGATGGCTGGG + Intronic
1062851821 10:749582-749604 TACCCACTAATGGGATGGCTGGG - Intergenic
1063340398 10:5257768-5257790 TACCCAGCAATGGGATGGCTGGG - Intergenic
1063625354 10:7684598-7684620 TACCTAGTAATGGGATTGCTGGG - Intergenic
1063774839 10:9251095-9251117 TACCCAGCAATGGGATTGCTGGG - Intergenic
1063850808 10:10187808-10187830 TACCTACTAATGGGATTGCTGGG + Intergenic
1064122058 10:12628213-12628235 TATCTACGAATGGAATTGCTGGG + Intronic
1064564199 10:16623538-16623560 TACCCACCAATGGGATTGCTGGG + Intronic
1064572527 10:16709506-16709528 TACCCAGCAATGGGATGGCTGGG + Intronic
1064837868 10:19554905-19554927 TACCCACTAATGGGATTGCTGGG + Intronic
1064925087 10:20561053-20561075 TACCTAGTAATGGGATGGCTGGG - Intergenic
1065144012 10:22748526-22748548 TACCTAGTAATGGGATGGCTGGG - Intergenic
1065230190 10:23590289-23590311 TACCCACTAATGGGATGGCTGGG + Intergenic
1065237360 10:23666928-23666950 TACCCACTAATGGGATGGCTGGG + Intergenic
1065276782 10:24094161-24094183 TACCTAGTAATGGGATGGCTGGG + Intronic
1065449384 10:25840902-25840924 TACCCAGCAATGGGATTGCTGGG - Intergenic
1065653025 10:27913961-27913983 TACCTAATAATGGGATTGCTGGG - Intronic
1066035233 10:31474691-31474713 TACCCAGTAATGGGATAGCTGGG - Intronic
1066490969 10:35894363-35894385 TACCCAGTAATGGTATTGCTGGG - Intergenic
1066529583 10:36322040-36322062 TACCCAACAATGGGATCGCTGGG - Intergenic
1066599265 10:37086503-37086525 TACCCACTAATGGGATGGCTGGG - Intergenic
1066611593 10:37254229-37254251 TACCTAGGAATGGAATTGCTAGG + Intronic
1066613405 10:37274109-37274131 TACCCACTAATGGGATTGCTGGG + Intronic
1066684682 10:37969252-37969274 TACCTAAAAATGGAATTGCTGGG - Intronic
1066930736 10:41754826-41754848 TACCCACAAATGGGATGGCTGGG - Intergenic
1067317521 10:45181895-45181917 TACCTAGCAATGGGATTGCTGGG - Intergenic
1067484381 10:46633797-46633819 TACCTAGTAATGGAATTGCTGGG + Intergenic
1067610379 10:47707849-47707871 TACCTAGTAATGGGATTGCTGGG - Intergenic
1067853990 10:49775789-49775811 TACCCACTAATGGGATTGCTGGG - Intergenic
1068035875 10:51759207-51759229 TACCTAGAAATGGGATTGCTGGG + Intronic
1068061786 10:52077038-52077060 TACCTACGAATGGAATGGCTGGG - Intronic
1068218759 10:54016355-54016377 TACCTAAAAATGGGATTGCTGGG - Intronic
1068339004 10:55676700-55676722 TACCTAGTAATGGGATTGCTGGG + Intergenic
1068378074 10:56211139-56211161 TACCTAGTAATGGGATCGCTGGG - Intergenic
1068391812 10:56407918-56407940 TACCCAGTAATGGTATTGCTGGG + Intergenic
1068415988 10:56723518-56723540 TATCTACCAATGGAAAAGGTAGG + Intergenic
1068433905 10:56966638-56966660 TACCCACTAATGGGATTGCTGGG - Intergenic
1068493863 10:57759641-57759663 TACCCAATAATGGTATTGCTGGG - Intergenic
1068580818 10:58737609-58737631 TACCCAGCAATGGGATGGCTGGG + Intronic
1068796253 10:61083784-61083806 TACCCACTAATGGAATTGCTGGG + Intergenic
1068847272 10:61692004-61692026 TACCTAGTAATGGGATTGCTGGG + Intronic
1068848767 10:61711993-61712015 TACCTAGTAATGGGATTGCTGGG + Intronic
1069121341 10:64573410-64573432 TACCTAGGAATGGAATTGCTGGG - Intergenic
1069263791 10:66433159-66433181 TACCCACTAATGGGATTGCTGGG + Intronic
1069348440 10:67497443-67497465 TACCTAGTAATGGGATTGCTGGG + Intronic
1069600022 10:69698302-69698324 TACCCACTAATGGGATGGCTGGG - Intergenic
1070101724 10:73394341-73394363 TACCTAGTAATGGGATGGCTGGG - Intronic
1070369353 10:75767154-75767176 TACCCAGCAATGGGATTGCTGGG + Intronic
1070600432 10:77862585-77862607 TACCTAAGAATGGGATTGCTGGG - Intronic
1070709746 10:78672015-78672037 TACCCAGCAATGGGATTGCTAGG - Intergenic
1070822427 10:79368135-79368157 TACCTAGGAATGGTATTGCTGGG - Intergenic
1071060170 10:81560745-81560767 TACCTAGTAATGGGATGGCTGGG - Intergenic
1071203293 10:83245443-83245465 TACCCACTAATGGGATTGCTGGG - Intergenic
1071234477 10:83628801-83628823 TACCCAGCAATGGGATGGCTGGG - Intergenic
1071355735 10:84792195-84792217 TACCTAAGAATGGAATTGCTGGG + Intergenic
1071529130 10:86376081-86376103 TACCTAGCAGTGGAATTGCTGGG + Intergenic
1071625789 10:87168107-87168129 TACCTAGTAATGGGATTGCTGGG - Intronic
1071908902 10:90208020-90208042 TACCTACTGTTGGTGTAGCTAGG + Intergenic
1071933340 10:90498498-90498520 TACCTAGTAATGGGATTGCTGGG + Intergenic
1071991741 10:91106280-91106302 TACCCAGTAATGGTATTGCTGGG + Intergenic
1072375246 10:94808945-94808967 TACCTAGCAGTGGGATTGCTGGG + Intronic
1072404959 10:95142439-95142461 TACCTACTAATGGGATTGCTGGG - Intergenic
1072483878 10:95835451-95835473 TACCTAGTAATGGGATTGCTGGG + Intronic
1072823657 10:98584018-98584040 TACCTAGCAATGGAAATGCTGGG + Intronic
1072856770 10:98955586-98955608 TACCTAGTAATGGGATTGCTGGG - Intronic
1073717099 10:106120239-106120261 TACCTAGTAATGGGATTGCTGGG - Intergenic
1073742256 10:106421061-106421083 TACCTAGTAATGGGATTGCTAGG + Intergenic
1073745105 10:106459585-106459607 TACCTAGTAATGGGATTGCTAGG - Intergenic
1074017790 10:109551919-109551941 TACCCAGTAATGGTATTGCTGGG - Intergenic
1074030403 10:109682072-109682094 TACCCAGTAATGGTATTGCTGGG + Intergenic
1074117590 10:110468647-110468669 TACCCAGTAATGGTATTGCTGGG + Intergenic
1074195253 10:111178653-111178675 TACCCACTAATGGGATGGCTGGG - Intergenic
1074959895 10:118434108-118434130 TACCCAGCAATGGGATGGCTGGG - Intergenic
1074964796 10:118480838-118480860 TACCCAGTAATGGGATAGCTGGG - Intergenic
1075135811 10:119785220-119785242 TACCTAGCAATGGAATTGCTGGG + Intronic
1075184340 10:120241949-120241971 TACCTGCCACTGGAATAGTTTGG + Intergenic
1075245253 10:120816457-120816479 TACCCAGCAATGGGATTGCTGGG + Intergenic
1075769922 10:124924816-124924838 TACCTACAGATGGAATTGCTGGG + Intergenic
1075979671 10:126725758-126725780 TACCTAGTAATGGGATGGCTGGG + Intergenic
1076164665 10:128272083-128272105 TACCTAGCAGTGGAATTGCTAGG - Intergenic
1076390379 10:130096421-130096443 TACCTAGTAATGGGATTGCTGGG - Intergenic
1076914709 10:133416914-133416936 TACCCAGTAATGGGATAGCTGGG + Intronic
1077348730 11:2078813-2078835 TACCCAGTAATGGGATAGCTGGG - Intergenic
1077396153 11:2323463-2323485 TACCTAGCAATGGGATTGCTGGG - Intergenic
1077654441 11:4005213-4005235 TACCTAGTAATGGGATGGCTGGG - Intronic
1077828443 11:5836095-5836117 TACCTAGTAATGGGATCGCTGGG - Intronic
1077945064 11:6888089-6888111 TACCTAGTAATGGTATTTCTGGG + Intergenic
1078120423 11:8503094-8503116 TACCTAATAATGGGATTGCTGGG - Intronic
1078282183 11:9913534-9913556 TACCTAGGAATGGAATTGCTAGG - Intronic
1078285167 11:9946062-9946084 TACCTAGAAATGGAATTGCTGGG - Intronic
1078302539 11:10147198-10147220 TACCCACTAATGGGATCGCTGGG - Intronic
1078560902 11:12371569-12371591 TACCCAGTAATGGGATAGCTGGG - Intergenic
1078649926 11:13180549-13180571 TACCCACTAATGGGATGGCTGGG - Intergenic
1078680480 11:13471105-13471127 TACCTAGTAATGGGATTGCTGGG - Intergenic
1078797287 11:14605065-14605087 TACCTAGTAATGGGATTGCTAGG + Intronic
1079608881 11:22405749-22405771 TACCCAGCAATGGGATTGCTGGG - Intergenic
1079709475 11:23663711-23663733 TACCTGGCAATGGGATTGCTGGG + Intergenic
1079798253 11:24834605-24834627 TACCCAGCAATGGTATTGCTGGG + Intronic
1079825928 11:25192558-25192580 TACCCAGCAATGGGATGGCTGGG - Intergenic
1079831502 11:25275148-25275170 TACCTAGTAATGGGATGGCTGGG + Intergenic
1079915745 11:26366490-26366512 TACCTAGTAATGGGATGGCTGGG + Intronic
1080090848 11:28347256-28347278 TTCCTACCAATGGTAAAGTGAGG + Intergenic
1080167194 11:29253409-29253431 TACCTAGTAATGGGATGGCTGGG - Intergenic
1080193626 11:29581536-29581558 TACCCAGCAATGGTATAGCTGGG - Intergenic
1080303073 11:30806289-30806311 TACCCACTAATGGGATTGCTGGG + Intergenic
1080478855 11:32624654-32624676 TACCTAGTAATGGAATTGCTGGG - Intronic
1080564482 11:33495637-33495659 TACCCAGCAATGGGATGGCTGGG + Intergenic
1080827969 11:35863836-35863858 TACCCACCAATGGGATTGCTGGG + Intergenic
1080914689 11:36644479-36644501 TACCCAGTAATGGGATAGCTGGG - Intronic
1081011783 11:37821949-37821971 TACCTAGTAATGGGATTGCTAGG + Intergenic
1081042967 11:38234785-38234807 TACCTAGTAATGGGATTGCTGGG - Intergenic
1081185737 11:40040056-40040078 TACCCAGTAATGGTATGGCTGGG + Intergenic
1081228834 11:40559529-40559551 TACCTAGTAATGGAATTGCTGGG + Intronic
1081359491 11:42157197-42157219 TACCCACTAATGGGATGGCTGGG - Intergenic
1081790903 11:45783897-45783919 TACCCAGCAATGGGATTGCTGGG - Intergenic
1081958329 11:47113351-47113373 TACCTAGTAATGGGATGGCTGGG + Intronic
1082056629 11:47823080-47823102 TACCCAGCAATGGGATGGCTGGG + Intronic
1082208447 11:49467786-49467808 TACCTAGTAATGGGATTGCTAGG - Intergenic
1082249794 11:49965461-49965483 TACCCAGCAATGGGATTGCTGGG - Intergenic
1082582928 11:54895802-54895824 TACCTAGTAATGGGATGGCTGGG - Intergenic
1082612807 11:55322370-55322392 TACCCAGTAATGGTATGGCTGGG - Intergenic
1082614910 11:55347920-55347942 TACCTAGCAATGGGATGGCTGGG + Intergenic
1082627161 11:55500067-55500089 TACCCAGTAATGGTATAGCTGGG - Intergenic
1082746172 11:56965796-56965818 TACCCAGTAATGGGATAGCTGGG - Intergenic
1082875791 11:57987010-57987032 TACCCAACAATGGGATGGCTGGG + Intergenic
1082882627 11:58053079-58053101 TACCCAGTAATGGGATAGCTGGG - Intronic
1082887895 11:58107622-58107644 TACCTAGCAATGGGATCTCTGGG + Intronic
1082905448 11:58303154-58303176 TACCTAGTAATGGGATTGCTGGG - Intergenic
1082910850 11:58372704-58372726 TACCCAGTAATGGGATAGCTGGG - Intergenic
1082925500 11:58541670-58541692 TACCTAGTAATGGGATGGCTGGG - Intronic
1082957843 11:58890299-58890321 TACCTAGTAATGGCATTGCTGGG - Intronic
1082968253 11:58990647-58990669 TACCTACTAATGGCATTGTTTGG - Intronic
1082973394 11:59047915-59047937 TACCTAGTAATGGCATTGCTGGG - Intergenic
1082977803 11:59091691-59091713 TACCTAGTAATGGCATTGCTGGG - Intergenic
1083097798 11:60269395-60269417 TACCTAATAATGGGATAGCTGGG + Intergenic
1083200247 11:61116969-61116991 TACCTAGGAATGGAATTGCTGGG - Intronic
1083362410 11:62119946-62119968 TACCCAGCAATGGCATTGCTGGG + Intergenic
1083496514 11:63058941-63058963 TACCTAGTAATGGGATGGCTGGG + Intergenic
1083499721 11:63093322-63093344 TACCCAGCAATGGGATTGCTGGG - Intronic
1083501160 11:63109357-63109379 TACCTAGTAATGGGATGGCTGGG + Intronic
1083532996 11:63441965-63441987 TACCCAGTAATGGGATAGCTGGG - Intergenic
1085072366 11:73558926-73558948 TACCTAGGAATGGAATTGCTGGG - Intronic
1085116056 11:73933061-73933083 TACCTAACAGTGGAATTGCTGGG + Intergenic
1085915383 11:80881319-80881341 TACCTAGTAATGGGATTGCTAGG - Intergenic
1085946674 11:81280803-81280825 TACCTAGTAATGGGATTGCTGGG + Intergenic
1085955268 11:81385702-81385724 TACCCAATAATGGTATTGCTGGG - Intergenic
1085966527 11:81534803-81534825 TACCTAGTAATGGGATGGCTGGG + Intergenic
1086074153 11:82832225-82832247 TACCTAGGAATGGGATTGCTGGG + Intronic
1086160297 11:83714891-83714913 TACCTAGTAATGGGATTGCTGGG - Intronic
1086163163 11:83746207-83746229 TACCTAGTAATGGGATGGCTGGG - Intronic
1086196685 11:84148729-84148751 TACCTAGTAATGGGATTGCTGGG + Intronic
1086295721 11:85365563-85365585 TACCTAGTAATGGGATTGCTGGG - Intronic
1086298899 11:85402972-85402994 TACCTAGTAATGGGATTGCTGGG - Intronic
1086472296 11:87127688-87127710 TACCTACCAGTGTTAGGGCTAGG + Intronic
1086516419 11:87618661-87618683 TACCCACTAATGGGATGGCTGGG + Intergenic
1086517232 11:87626840-87626862 TACCCACTAATGGGATGGCTGGG - Intergenic
1086517549 11:87630355-87630377 TACCCAGTAATGGGATAGCTGGG + Intergenic
1086537200 11:87862141-87862163 TACCCAGTAATGGTATTGCTGGG - Intergenic
1086610814 11:88753552-88753574 TACCTAGTAATGGGATTGCTGGG - Intronic
1086641171 11:89157724-89157746 TACCTAGTAATGGGATTGCTAGG + Intergenic
1086660740 11:89413308-89413330 TACCTACCAATAGGATTGCTGGG - Intronic
1086796629 11:91112714-91112736 TATCTACTAATGGGATGGCTGGG + Intergenic
1086815077 11:91359986-91360008 TACCTAGTAATGGGATGGCTGGG - Intergenic
1086985695 11:93246799-93246821 TACCTAGTAATGGGATTGCTGGG - Intergenic
1087058877 11:93959321-93959343 TGCCTACCAGTGGCACAGCTGGG - Intergenic
1087079616 11:94157238-94157260 TACCTAGTAATGGGATGGCTGGG + Intronic
1087179281 11:95125954-95125976 TACCTAGTAATGGGATGGCTGGG + Intronic
1087186917 11:95209529-95209551 TACCCACTAATGGGATTGCTGGG - Intronic
1087488302 11:98787808-98787830 TACCCAGTAATGGTATTGCTAGG + Intergenic
1087514024 11:99133887-99133909 TACCCACTAATGGGATTGCTGGG - Intronic
1087725654 11:101713315-101713337 TACCTAGTAATGGGATTGCTGGG - Intronic
1087733038 11:101799956-101799978 TACCCAGCAATGGGATGGCTGGG - Intronic
1087830477 11:102814389-102814411 TACCCAGCAATGGGATTGCTGGG + Intergenic
1087942242 11:104112501-104112523 TACCTAGTAATGGGATTGCTTGG - Intronic
1088411918 11:109543788-109543810 TACCTAGTAATGGGATGGCTGGG - Intergenic
1088419041 11:109621894-109621916 TACCTAGTAATGGGATGGCTGGG + Intergenic
1088523232 11:110722459-110722481 TACCTAGTAATGGGATTGCTGGG + Intergenic
1088942153 11:114470206-114470228 TACCTACGAATGGAATGGCTGGG + Intergenic
1089230956 11:116975717-116975739 TACCTACCAGTGGAATTGCTGGG + Intronic
1089854061 11:121525452-121525474 TACTTAGGAATGGAATAGCTGGG + Intronic
1090223790 11:125056116-125056138 TACCTAGTAATGGGATTGCTGGG - Intergenic
1090540878 11:127702500-127702522 AACCTACCAATGGTATTGCTAGG + Intergenic
1090689373 11:129161776-129161798 TACCTAGTAATGGGATTGCTGGG - Intronic
1090777763 11:129980174-129980196 TACCTAGCAGTGGAATTGCTTGG - Intronic
1091040235 11:132271409-132271431 TACCTAGGAGTGGAATAGCTGGG + Intronic
1092167411 12:6351022-6351044 TACCTAGGAATGGAATTGCTAGG - Intronic
1092399759 12:8164846-8164868 TACCTAGTAATGGGATTGCTGGG + Intronic
1092550546 12:9494501-9494523 TACCCAGTAATGGGATAGCTGGG + Intergenic
1092594733 12:9988843-9988865 TACCCAGCAATGGGATGGCTGGG - Intronic
1092722386 12:11454567-11454589 TACCCAGCAATGGGATTGCTAGG - Intronic
1092746974 12:11682080-11682102 TACCTAGTAATGGGATTGCTGGG + Intronic
1093248257 12:16767517-16767539 TACCTAGCAATGAGATTGCTGGG - Intergenic
1093270260 12:17051673-17051695 TACCCACTAATGGGATGGCTGGG - Intergenic
1093350297 12:18091708-18091730 TACCTAGTAATGGGATGGCTGGG + Intronic
1093398331 12:18711014-18711036 TACCTAGTAATGGGATGGCTGGG - Intronic
1093476719 12:19563820-19563842 TACCCAGCAATGGGATTGCTGGG + Intronic
1093502905 12:19832656-19832678 TACCTAGTAATGGGATTGCTGGG + Intergenic
1094007179 12:25767413-25767435 TACATACCACTGGTACAGCAAGG - Intergenic
1094128855 12:27053117-27053139 TACCCATCAATGGGATTGCTGGG + Intronic
1094224529 12:28030295-28030317 TACCTAGTAATGGGATTGCTGGG - Intergenic
1094248423 12:28330126-28330148 TACCCAGTAATGGGATAGCTGGG + Intronic
1094262219 12:28513973-28513995 TACCTAGCAATGGGATTTCTGGG + Intronic
1094448156 12:30555417-30555439 TACCCAGCAATGGGATTGCTGGG - Intergenic
1094454292 12:30614926-30614948 TACCCAGTAATGGTATTGCTGGG + Intergenic
1094466636 12:30760840-30760862 TACCTAGGAATGGAATTGCTGGG - Intergenic
1094472003 12:30811460-30811482 TACCTAAAAATGTAATAGCTTGG - Intergenic
1094707100 12:32924706-32924728 TACCTAGTAATGGGATTGCTGGG + Intergenic
1094727976 12:33142274-33142296 TACCCAGCAATGGGATTGCTGGG + Intergenic
1094730318 12:33167026-33167048 TACCTAGTAATGGGATTGCTGGG + Intergenic
1094790024 12:33902096-33902118 TACCTAGTAATGGGATGGCTGGG - Intergenic
1094817093 12:34198723-34198745 TACCCAGCAATGATATTGCTGGG - Intergenic
1094859568 12:34446851-34446873 TACCCAGCAATGGGATGGCTGGG - Intergenic
1094874964 12:34630039-34630061 TACCCAGCAATGGGATGGCTGGG + Intergenic
1095065507 12:37767083-37767105 TACCTAGCAATGGGATGGCTGGG - Intergenic
1095119859 12:38404414-38404436 TACCTAGCAATGGGATTGCTGGG + Intergenic
1095133294 12:38568286-38568308 TACCTGGCAATGGTACAGCAAGG - Intergenic
1095403609 12:41842872-41842894 TACCTAGTAATGGGATTGCTGGG - Intergenic
1095576992 12:43751708-43751730 TACCCAGTAATGGTATGGCTGGG + Intronic
1095680057 12:44963705-44963727 TACCTATTAATGGGATTGCTGGG - Intergenic
1095779309 12:46041553-46041575 TACCTACTAATGGGATTGCTTGG - Intergenic
1095834558 12:46623114-46623136 TACCTAGTAATGGGATGGCTGGG - Intergenic
1095918808 12:47508204-47508226 TACCCAGTAATGGTATGGCTGGG - Intergenic
1096753388 12:53778183-53778205 TACCTAGCAGTGGGATTGCTGGG + Intergenic
1097302914 12:58037133-58037155 TACCTAATAATGGGATTGCTAGG + Intergenic
1097311598 12:58124845-58124867 TACCCAGTAATGGTATGGCTGGG + Intergenic
1097365221 12:58704843-58704865 TACCCAGTAATGGTATGGCTGGG + Intronic
1097488936 12:60240228-60240250 TACCTAGTAATGGGATGGCTGGG - Intergenic
1097529161 12:60777270-60777292 TACCTAGTAATGGGATGGCTGGG + Intergenic
1097605411 12:61747345-61747367 TACCCAGTAATGGGATAGCTGGG - Intronic
1097653898 12:62337991-62338013 TACCTAGTAATGGGATTGCTGGG + Intronic
1097785787 12:63757388-63757410 TACCTAAAAATGGTAGATCTTGG - Intergenic
1097857178 12:64475875-64475897 TACCCAGCAATGGGATTGCTGGG + Intronic
1098073947 12:66706496-66706518 TACCCAGTAATGGTATTGCTGGG - Intronic
1098447899 12:70586158-70586180 TACCTAGTAATGGGATGGCTGGG + Intronic
1098732875 12:74061178-74061200 TACCTAGTAATGGGATGGCTGGG - Intergenic
1098780658 12:74682005-74682027 TACCTAGTAATGGGATTGCTGGG - Intergenic
1098830485 12:75355608-75355630 TACCTAGCGATGGGATTGCTGGG - Intronic
1098992961 12:77085403-77085425 TACCTAGTAATGGGATCGCTGGG + Intergenic
1099049090 12:77761907-77761929 TACCCAGCAATGGGATGGCTGGG - Intergenic
1099261778 12:80391421-80391443 TACCCAACAATGGGATGGCTGGG - Intergenic
1099436555 12:82652941-82652963 TACCTAGTAATGGGATGGCTGGG + Intergenic
1099501676 12:83420873-83420895 TACCTAGTAATGGGATGGCTGGG + Intergenic
1099524277 12:83699988-83700010 TACCTAGTAATGGGATTGCTGGG - Intergenic
1099678360 12:85791029-85791051 TACCCAGTAATGGAATAGCTGGG - Intergenic
1099730469 12:86493277-86493299 TACCCAGTAATGGGATAGCTGGG - Intronic
1099788163 12:87294662-87294684 TACCCAGTAATGGGATAGCTGGG + Intergenic
1099898034 12:88673077-88673099 TACCCAGCAATGGGATTGCTGGG - Intergenic
1100590500 12:96023726-96023748 TACCTACCAAGGGAATAAGTTGG + Intronic
1100637856 12:96452953-96452975 TACCCAGTAATGGTATTGCTGGG - Intergenic
1100931329 12:99613333-99613355 TACCCAGCAATGGGATTGCTGGG - Intronic
1100952904 12:99872207-99872229 TATCTAAAAATGGTATTGCTAGG - Intronic
1100960989 12:99962560-99962582 TACCCAGTAATGGTATTGCTGGG + Intronic
1101028548 12:100637332-100637354 TACCCAGTAATGGTATGGCTGGG + Intergenic
1101121092 12:101580768-101580790 TACCCACTAATGGGATTGCTGGG + Intronic
1101175549 12:102147196-102147218 TACCCAGCAATGGGATGGCTGGG - Intronic
1101258448 12:103004004-103004026 TACCCAGTAATGGTATTGCTGGG + Intergenic
1101264770 12:103072619-103072641 TACCCAGTAATGGTATTGCTGGG + Intergenic
1101313540 12:103607897-103607919 TACCTAGTAATGGGATGGCTGGG + Intronic
1101360686 12:104024030-104024052 TACCTAGAAGTGGTATTGCTGGG + Intronic
1101498114 12:105275274-105275296 TACCCAGCAATGGGATGGCTGGG - Intronic
1102392550 12:112561229-112561251 TACCTAGGAATGGAATTGCTGGG + Intergenic
1103549349 12:121725457-121725479 TACCTAGGAATGGAATTGCTGGG - Intronic
1104225151 12:126824304-126824326 TACCTAGTAATGGGATTGCTGGG + Intergenic
1104305338 12:127605415-127605437 TACCTAGCAATGAAATTGCTGGG + Intergenic
1104619069 12:130296859-130296881 TACCTAGTAATGGGATTGCTGGG - Intergenic
1105226386 13:18438180-18438202 TACCTAGGAATGGAATTGCTGGG + Intergenic
1105317706 13:19282353-19282375 TACCCACTAATGGGATTGCTGGG - Intergenic
1105350223 13:19608223-19608245 TACTTAAAAATGGTAAAGCTAGG - Intergenic
1105872060 13:24514031-24514053 TACCCAGTAATGGGATAGCTGGG - Intergenic
1105917555 13:24930824-24930846 TACCCAGTAATGGGATAGCTGGG + Intergenic
1106050116 13:26181608-26181630 TACCTACCAATGGTATAGCTTGG - Intronic
1106426037 13:29630840-29630862 TACCTAGTAATGGGATTGCTGGG + Intergenic
1106430107 13:29672898-29672920 TACCTAGTAATGGGATTGCTGGG - Intergenic
1106490295 13:30215405-30215427 TACCCACTAATGGGATGGCTGGG - Intronic
1106748389 13:32729457-32729479 TACCTAGTAATGGGATTGCTGGG + Intronic
1106868198 13:33990164-33990186 TACCCACTAATGGGATGGCTGGG - Intergenic
1107098949 13:36567512-36567534 TACTTACCAGTAGGATAGCTGGG - Intergenic
1107282292 13:38750638-38750660 TACCTAGCAGTGGGATAACTGGG + Intronic
1107321082 13:39189153-39189175 TACCTAGTAATGGGATCGCTGGG + Intergenic
1107472921 13:40707251-40707273 TACCTAGTAATGGGATTGCTGGG + Intergenic
1107775914 13:43840894-43840916 TACCTAGTAATGGGATGGCTGGG + Intronic
1107828578 13:44353231-44353253 TAGCTGGAAATGGTATAGCTGGG - Intergenic
1108173471 13:47768040-47768062 TACCCACTAATGGGATTGCTGGG + Intergenic
1108222325 13:48248569-48248591 TACCTAGGAATGGAATTGCTAGG + Intronic
1108450285 13:50555751-50555773 TACCCAGCAATGGGATGGCTGGG - Intronic
1108756705 13:53511690-53511712 TACCTAGTAATGGGATTGCTGGG + Intergenic
1108765042 13:53618210-53618232 TACCTACAAGTGGAATAGGTGGG - Intergenic
1108841187 13:54617423-54617445 TACCTAGGAATGGAATTGCTAGG + Intergenic
1108917240 13:55630097-55630119 TACCTAATAATGGGATTGCTGGG + Intergenic
1109253241 13:60046602-60046624 TACCTAGTAATGGGATTGCTCGG - Intronic
1109315166 13:60741273-60741295 TACCCAGTAATGGGATAGCTGGG + Intergenic
1109359056 13:61272050-61272072 TACCCAGTAATGGTATTGCTGGG - Intergenic
1109363757 13:61329205-61329227 TACCCAGCAATGGAATCGCTGGG - Intergenic
1109407704 13:61922624-61922646 TACCAAGCAATGGGATTGCTGGG + Intergenic
1109453827 13:62556374-62556396 TACCTAGTAATGGGATTGCTGGG - Intergenic
1109462056 13:62673813-62673835 TACCTAGTAATGGGATTGCTAGG - Intergenic
1109465435 13:62726059-62726081 TACCCACTAATGGGATCGCTGGG + Intergenic
1109563664 13:64082007-64082029 TACCCAGTAATGGTATTGCTGGG + Intergenic
1109691911 13:65905670-65905692 TACCTAGTAATGGGATTGCTGGG + Intergenic
1109864667 13:68247081-68247103 TACCGAGTAATGGTATTGCTGGG + Intergenic
1109867436 13:68284043-68284065 TACCCAGCAATGGGATGGCTGGG - Intergenic
1109899871 13:68753554-68753576 TACCCAGCAATGGGATTGCTGGG - Intergenic
1109915530 13:68980731-68980753 TACCCAGCAATGATATTGCTGGG - Intergenic
1110089109 13:71423064-71423086 TACCTAATAATGGGATTGCTGGG - Intergenic
1110128876 13:71981466-71981488 TACCTAGTAATGGGATTGCTGGG + Intergenic
1110148888 13:72226279-72226301 TACCCAGCAACGGGATAGCTGGG + Intergenic
1110200606 13:72845526-72845548 TACCTAGTAATGGGATTGCTGGG + Intronic
1110258018 13:73453495-73453517 TACCCACTAATGGGATGGCTGGG + Intergenic
1110283611 13:73724020-73724042 TACCCAGAAATGGTATTGCTGGG - Intronic
1110349310 13:74488573-74488595 TACCCACTAATGGGATTGCTGGG + Intergenic
1110571481 13:77009733-77009755 TACCCAGTAATGGTATTGCTGGG - Intronic
1110789934 13:79576377-79576399 TACCTAGTAATGGGATTGCTGGG + Intergenic
1110792817 13:79603902-79603924 TACCTAGTAATGGAATTGCTGGG + Intergenic
1110871230 13:80454669-80454691 TACCTACTAATAGGATTGCTGGG - Intergenic
1110872383 13:80467641-80467663 TACCTGGTAATGGCATAGCTGGG - Intergenic
1110956510 13:81559332-81559354 TACCCACTAATGGGATGGCTGGG + Intergenic
1111000615 13:82175123-82175145 TACCTAGTAATGGGATAGCAGGG - Intergenic
1111167305 13:84476545-84476567 TACCCACTAATGGGATTGCTGGG - Intergenic
1111409217 13:87852943-87852965 TACCTAGTAATGGGATTGCTGGG - Intergenic
1111457357 13:88502500-88502522 TACCCACTAATGGGATTGCTTGG + Intergenic
1111861892 13:93718121-93718143 TACCCACTAATGGAATTGCTGGG + Intronic
1111911792 13:94321427-94321449 TACCTAGTAATGGGATTGCTGGG + Intronic
1112134506 13:96562007-96562029 TACCCAGCAATGGGATTGCTGGG - Intronic
1112233978 13:97618560-97618582 TACCTAGTAATGGGATTGCTGGG - Intergenic
1112465945 13:99645030-99645052 TACCTAGCATTGGGATTGCTGGG + Intronic
1112661206 13:101510509-101510531 TACCTAGTAATGGGATTGCTAGG + Intronic
1112740634 13:102468944-102468966 TACCCAGTAATGGTATTGCTAGG + Intergenic
1112911749 13:104493842-104493864 TACCCAGCAATGGGATTGCTGGG + Intergenic
1113019554 13:105869049-105869071 TACCTAGTAATGGGATTGCTGGG - Intergenic
1113276422 13:108735653-108735675 TACCCAGTAATGGTATGGCTGGG + Intronic
1113384121 13:109832633-109832655 TACCTAGTAATGGGATTGCTGGG - Intergenic
1113605911 13:111605618-111605640 TACCCACTAATGGGATGGCTGGG + Intronic
1113703693 13:112409846-112409868 TACCCACTAATGGGATGGCTGGG - Intronic
1113720045 13:112548965-112548987 TACCCACTAATGGGATGGCTGGG - Intronic
1113916632 13:113877764-113877786 TACCTCACAATGGTATTGCTAGG - Intergenic
1114010846 14:18366686-18366708 TACCTAGGAATGGAATTGCTGGG + Intergenic
1114032984 14:18591951-18591973 TACCTACCAATGGCATTGCTGGG - Intergenic
1114077780 14:19171148-19171170 TACCTACCAATGGCATTGCTGGG - Intergenic
1114125953 14:19725807-19725829 TACCTAACAATGGCATTGCTGGG + Intronic
1114127584 14:19747843-19747865 AACCAACCAAAGGCATAGCTGGG - Exonic
1114368499 14:22057579-22057601 TACCTAGTAATGGGATTGCTGGG - Intergenic
1114374389 14:22128228-22128250 TACCCAGAAATGGTATTGCTGGG + Intergenic
1114433486 14:22683434-22683456 TACCCAGTAATGGGATAGCTGGG - Intergenic
1114706470 14:24732120-24732142 TACCTAGTAATGGGATTGCTGGG - Intergenic
1114710524 14:24773479-24773501 TACCGACTAATGGGATTGCTAGG - Intergenic
1114741262 14:25100147-25100169 TACCTAGTAATGGAATTGCTGGG - Intergenic
1114807257 14:25852451-25852473 TACCCAGTAATGGGATAGCTGGG + Intergenic
1115009829 14:28532172-28532194 TACCTAGCAATGAGATTGCTGGG + Intergenic
1115021087 14:28682589-28682611 TACCTAATAATGGGATTGCTGGG + Intergenic
1115053585 14:29094832-29094854 TACCTAGCAGTGGGATTGCTAGG + Intergenic
1115122636 14:29955885-29955907 TACCCAGCAATGGGATGGCTGGG + Intronic
1115294862 14:31814045-31814067 TACCCAGCAATGGGATTGCTGGG + Intronic
1115495966 14:34004828-34004850 TCCCTATCAATGGAATAGCAGGG - Intronic
1115778708 14:36745354-36745376 TACCTAGGAATGGGATGGCTGGG + Intronic
1115842285 14:37485343-37485365 TACCCAGTAATGGTATTGCTGGG + Intronic
1116109934 14:40565010-40565032 TACCCAGTAATGGTATGGCTGGG + Intergenic
1116212236 14:41963068-41963090 TACCCAGCAATGGGATTGCTGGG + Intergenic
1116316727 14:43405838-43405860 TACCCAGCAATGGGATGGCTGGG - Intergenic
1116318461 14:43428516-43428538 TACCCAGCAATGGGATGGCTGGG + Intergenic
1116366674 14:44075685-44075707 TACCTAGTAATGGGATTGCTGGG + Intergenic
1116570922 14:46514222-46514244 TACCTAGTAATGGGATGGCTGGG - Intergenic
1116675215 14:47898101-47898123 TACCCACTAATGGGATTGCTGGG - Intergenic
1116684195 14:48017017-48017039 TACCCAGTAATGGGATAGCTGGG + Intergenic
1116692770 14:48131554-48131576 TACCCAGTAATGGTATCGCTGGG + Intergenic
1116728849 14:48596557-48596579 TACCTAGCAATGGGATGGCTGGG + Intergenic
1116793237 14:49362210-49362232 TACCCAGCAATGGGATGGCTAGG - Intergenic
1117397412 14:55324437-55324459 TACCTAGCAGTGGAATTGCTGGG + Intronic
1117591928 14:57279159-57279181 TACCCAATAATGGAATAGCTGGG - Intronic
1117663225 14:58029833-58029855 TACCTAACAGTGGAATTGCTGGG - Intronic
1117697844 14:58384268-58384290 TACCTAGAAGTGGAATAGCTGGG - Intergenic
1118062471 14:62155361-62155383 TACCTAGTAATGGGATTGCTGGG + Intergenic
1118076576 14:62306183-62306205 TACCCAGCAATGGGATGGCTGGG + Intergenic
1118146949 14:63148049-63148071 TACCCAGTAATGGTATTGCTGGG + Intergenic
1118801785 14:69196501-69196523 TACCTGCCAGTGGCATTGCTAGG + Intronic
1118995464 14:70831644-70831666 TACCTAGAAATGGAATGGCTGGG + Intergenic
1119176529 14:72572273-72572295 TACCTATGAATGGAATTGCTGGG - Intergenic
1119220537 14:72903004-72903026 TACCTAGGAGTGGAATAGCTGGG - Intergenic
1119369437 14:74126362-74126384 AACCTAGCAATGGAATTGCTGGG - Intronic
1119570852 14:75670434-75670456 TACCTAGGAATGGAATTGCTAGG + Intronic
1119817822 14:77586419-77586441 TACCTAAGAATGGAATTGCTGGG - Intronic
1120021658 14:79537802-79537824 TACCCACTAATGGGATTGCTGGG + Intronic
1120624517 14:86807955-86807977 TACCCAGTAATGGGATAGCTGGG + Intergenic
1120769929 14:88367920-88367942 TACCTAGTAATGATATTGCTGGG + Intergenic
1120842647 14:89099290-89099312 TACCCACTAATGGGATTGCTGGG + Intergenic
1120954150 14:90066788-90066810 TACCTAGAAATGGAATTGCTGGG - Intronic
1121213496 14:92227943-92227965 TACCCAGCAATGGGATGGCTGGG + Intergenic
1121234341 14:92381061-92381083 TACCTAGTAATGGGATTGCTGGG - Intronic
1121378977 14:93443957-93443979 TACCTAGGAATGGAATTGCTTGG + Intronic
1121725368 14:96144279-96144301 TACCCAATAATGGGATAGCTGGG - Intergenic
1123388560 15:19845583-19845605 TACCCAGCAATGGGATTGCTGGG + Intergenic
1123569185 15:21585109-21585131 TACCTACCAATGGCATTGCTGGG + Intergenic
1123571035 15:21609517-21609539 AACCAACCAAAGGCATAGCTGGG - Intergenic
1123605295 15:22020429-22020451 TACCTACCAATGGCATTGCTGGG + Intergenic
1123607147 15:22044874-22044896 AACCAACCAAAGGCATAGCTGGG - Intergenic
1123790971 15:23719563-23719585 TACCTAGTAATGGAATGGCTGGG - Intergenic
1124221401 15:27853053-27853075 TACCCAGTAATGGGATAGCTGGG - Intronic
1124224394 15:27879366-27879388 TACCCAGCAATGGAATTGCTGGG + Intronic
1124390803 15:29255498-29255520 TACCTAGTAATGGGATTGCTGGG - Intronic
1124741127 15:32297777-32297799 TACCCAGTAATGGGATAGCTGGG - Intergenic
1124855513 15:33383742-33383764 TACCTAGCAATGGGATTGCTGGG - Intronic
1124874373 15:33578237-33578259 TACCTAGTAATGGGATTGCTGGG - Intronic
1125062551 15:35441290-35441312 TACCTAGTAATGGGATTGCTGGG - Intronic
1125111846 15:36043423-36043445 TACCCAGCAATGGGATTGCTGGG - Intergenic
1125314382 15:38415490-38415512 TACCTAGTAATGGGATTGCTGGG + Intergenic
1125351673 15:38774117-38774139 TACCCAGCAATGGGATCGCTGGG + Intergenic
1125787769 15:42337113-42337135 TACCTAGTAATGGGATTGCTGGG - Intronic
1126026737 15:44453936-44453958 TACCCAGTAATGGGATAGCTGGG + Intronic
1126214783 15:46142663-46142685 TACCTAGTAATGGGATCGCTGGG + Intergenic
1126239987 15:46430532-46430554 TACCTAGTAATGGGATGGCTGGG - Intergenic
1126363253 15:47867913-47867935 TACCTAGTAATGGGATTGCTGGG + Intergenic
1126565215 15:50089842-50089864 TACCTAGTAATGGGATTGCTGGG - Intronic
1126569839 15:50139067-50139089 TACCCAGCAATGGGATTGCTGGG - Intronic
1127052321 15:55097576-55097598 TACCCAGCAATGGGATGGCTGGG - Intergenic
1127202453 15:56670699-56670721 TACCCAGCAATGGGATTGCTGGG + Intronic
1127438087 15:58978125-58978147 TACCTATGAGTGGAATAGCTGGG - Intronic
1128369298 15:67028430-67028452 TACCTAGAAATGGGATTGCTGGG - Intergenic
1128657174 15:69470744-69470766 TACCTGCCGGTGGTATACCTGGG - Intergenic
1128857798 15:71034513-71034535 TACCCACTAATGGAATTGCTGGG - Intronic
1128857928 15:71035853-71035875 TACCCACTAATGGAATTGCTGGG + Intronic
1128949220 15:71858237-71858259 TACCCAGTAATGGTATGGCTGGG - Intronic
1129127290 15:73453599-73453621 TACCCAGCAATGGGATTGCTGGG - Intronic
1129555633 15:76505721-76505743 TACCTACCAGTGGAATTGCTGGG - Intronic
1129939868 15:79486295-79486317 TACCCAGTAATGGGATAGCTGGG + Intergenic
1129959528 15:79670865-79670887 TACCCAGCAATGGGATTGCTGGG - Intergenic
1129971919 15:79786259-79786281 TACCCAGCAATGGGATTGCTGGG - Intergenic
1129991774 15:79971527-79971549 TACCTATGAATGGAATTGCTGGG - Intergenic
1131210061 15:90487315-90487337 TACCTACTTATGGAATGGCTGGG + Intronic
1131320238 15:91382388-91382410 TACCAAGCAATGGGATTGCTGGG - Intergenic
1131415981 15:92258265-92258287 TACCCAACAATGGTATCGCTGGG - Intergenic
1131598023 15:93818805-93818827 TACCCAGCAATGGGATTGCTGGG - Intergenic
1131695426 15:94872160-94872182 TACCTAGTAATGGAATTGCTGGG + Intergenic
1131736202 15:95334922-95334944 TACCTAGTAATGGGATGGCTGGG + Intergenic
1131984429 15:98027521-98027543 TACCTAATAATGGGATTGCTGGG - Intergenic
1202949788 15_KI270727v1_random:23290-23312 TACCCAGCAATGGGATGGCTGGG - Intergenic
1202977538 15_KI270727v1_random:312199-312221 TACCTACCAATGGCATTGCTGGG + Intergenic
1132924202 16:2419420-2419442 TACCTAGGAATGGAATTGCTGGG - Intergenic
1133112192 16:3554746-3554768 TACCTAGGAATGGAATTGCTGGG - Intronic
1135474101 16:22758262-22758284 TACCTAGTAATGGGATTGCTGGG + Intergenic
1135475132 16:22767803-22767825 TACCTAGTAATGGGATTGCTGGG - Intergenic
1136643028 16:31583550-31583572 TACCCACTAATGGGATTGCTGGG + Intergenic
1136653360 16:31692794-31692816 TACCCAGTAATGGGATAGCTGGG - Intergenic
1136662601 16:31777594-31777616 TACCCACTAATGGGATTGCTGGG - Intronic
1137020126 16:35416593-35416615 TACCCAGTAATGGTATTGCTGGG + Intergenic
1137069314 16:35886917-35886939 TACCTAGTAATGGGATTGCTGGG - Intergenic
1137412626 16:48242526-48242548 TACCCAGCAATGGGATGGCTGGG - Intronic
1137877217 16:52008107-52008129 TACCCAGTAATGGGATAGCTGGG + Intronic
1138065795 16:53940005-53940027 TACCTAGGAATGGAATTGCTGGG + Intronic
1138088882 16:54158000-54158022 TACCCAGTAATGGGATAGCTGGG - Intergenic
1138366827 16:56486333-56486355 TACCTTACAATGGGATTGCTGGG - Intronic
1138683194 16:58701823-58701845 TACCTAAGAATGGAATTGCTGGG + Intergenic
1138698793 16:58841173-58841195 TACCTAGTAATGGGATGGCTGGG + Intergenic
1138887402 16:61096317-61096339 TATCCAGCAATGGGATAGCTGGG - Intergenic
1138901828 16:61280794-61280816 TACCTAGGAGTGGTATATCTGGG + Intergenic
1138966515 16:62091030-62091052 TACCCAGCAATGGGATGGCTGGG - Intergenic
1139010839 16:62631827-62631849 TACCCAGCAATGGGATGGCTGGG + Intergenic
1139173088 16:64654496-64654518 TACCTAGTAATGGGATTGCTGGG - Intergenic
1139196749 16:64928375-64928397 TACCTATTAATGGAATTGCTAGG - Intergenic
1139567421 16:67787508-67787530 CACCTAAGAATGGTATTGCTGGG - Intronic
1139998963 16:71007779-71007801 TACCTAGTAATGGAATTGCTGGG - Intronic
1140008656 16:71107801-71107823 TACCCAGTAATGGTATTGCTGGG - Intronic
1140494836 16:75376266-75376288 TACCTAGGAATGGAATTGCTAGG - Intronic
1141415528 16:83869491-83869513 TACCTAGTAATGGGATTGCTGGG - Intergenic
1142770252 17:2091600-2091622 TCCCTACCCCTGCTATAGCTGGG + Intronic
1143256301 17:5560502-5560524 TACCTGCCAATGGTGTCCCTCGG + Intronic
1143333318 17:6154164-6154186 TATCCAGCAATGGTATTGCTGGG - Intergenic
1144645245 17:16969175-16969197 TACCTACAAGTGGAATTGCTGGG - Intronic
1145194808 17:20882653-20882675 TACCCACTAATGGGATTGCTGGG - Intronic
1145684774 17:26641154-26641176 TACCCAGCAATGGGATGGCTGGG - Intergenic
1145738838 17:27254823-27254845 TACCTAGTAATGGGATTGCTAGG - Intergenic
1145829163 17:27901177-27901199 TACCCAGTAATGGTATGGCTGGG + Intergenic
1146098708 17:29957847-29957869 TACCCAGCAATGGGATTGCTGGG + Intronic
1146729138 17:35179381-35179403 TACCCAGCAATGGGATTGCTGGG - Intronic
1146745806 17:35328412-35328434 TACCTAGTAATGGGATTGCTGGG + Intergenic
1146995131 17:37313833-37313855 TACCTAGCTATGGGATTGCTGGG - Intronic
1147509723 17:41057547-41057569 TACCCACTAATGGGATTGCTGGG - Intergenic
1147523499 17:41197615-41197637 AAACTATCAATGTTATAGCTGGG - Intronic
1147674845 17:42198060-42198082 TACCTACAAGTGGAATGGCTGGG + Intergenic
1148702323 17:49596211-49596233 TTCATTCCAATTGTATAGCTTGG - Intergenic
1149014856 17:51896596-51896618 TACCCAACAATGGGATTGCTGGG + Intronic
1149025393 17:52021321-52021343 TACCCAGCAATGGGATTGCTTGG + Intronic
1149054256 17:52343855-52343877 TACCTAGTAATGGGATTGCTGGG + Intergenic
1149078562 17:52627069-52627091 TACCTAGGAATGGGATTGCTAGG + Intergenic
1149202844 17:54207881-54207903 TACCTAGTAATGGGATTGCTGGG - Intergenic
1149249117 17:54747714-54747736 TACCTAGCAGTGGGATTGCTGGG + Intergenic
1149579451 17:57738634-57738656 TACCTACGAGTGGAATTGCTGGG + Intergenic
1150581630 17:66479484-66479506 TACCTAGCCATGGGATTGCTGGG - Intronic
1150899752 17:69259060-69259082 TACCTAGAAATGGGATTGCTGGG - Intronic
1150921461 17:69488401-69488423 TACCCAGCAATGGGATTGCTAGG - Intronic
1150995495 17:70312507-70312529 TACCCAGCAATGGGATTGCTGGG + Intergenic
1153072666 18:1123795-1123817 TACCCAGTAATGGTATTGCTGGG + Intergenic
1153168337 18:2287071-2287093 TACCTAATAATGGGATTGCTGGG + Intergenic
1153254734 18:3159488-3159510 TACCTACAAGTGGAATTGCTAGG - Intronic
1153391104 18:4560491-4560513 TACCCAGCAATGGGATTGCTGGG + Intergenic
1153686623 18:7552598-7552620 TACCTACTAATGGGATTGCTGGG + Intergenic
1153874245 18:9352440-9352462 TACCTAGGAATGGGATTGCTGGG + Intronic
1153956992 18:10105028-10105050 TACCTAGTAATGGGATTGCTGGG + Intergenic
1154043598 18:10883280-10883302 TACCCAGCAATGGGATTGCTGGG + Intronic
1154053820 18:10991740-10991762 TACCTAGTAATGGGATTGCTGGG + Intronic
1154526997 18:15301297-15301319 TACCTAAGAATGGAATTGCTGGG - Intergenic
1155093624 18:22535137-22535159 TACCTAGTAATGGGATGGCTGGG - Intergenic
1155282828 18:24258097-24258119 TACCTAGCAGTGGGATTGCTGGG - Intronic
1155534370 18:26801638-26801660 TACCTAGCAGTGGGATTGCTGGG - Intergenic
1155754568 18:29474382-29474404 TACCCAGCAATGGGATTGCTGGG - Intergenic
1155776972 18:29776909-29776931 TACCCAGCAATGGAATTGCTGGG + Intergenic
1155786052 18:29900957-29900979 TACCTAGTAATGGGATGGCTGGG - Intergenic
1155789682 18:29949995-29950017 TACCTAGTAATGGGATGGCTGGG - Intergenic
1155795638 18:30033515-30033537 TACCTACCATTGGTACAACCAGG + Intergenic
1155814373 18:30286773-30286795 TACCTAGCAATGGCATTGCCAGG - Intergenic
1155924246 18:31637435-31637457 TACTTACCAACTGTAGAGCTGGG + Intronic
1156006084 18:32443748-32443770 TACCTACAACTGGAATTGCTGGG - Intronic
1156384683 18:36594417-36594439 TACCTCACAGTGTTATAGCTGGG + Intronic
1156733994 18:40230326-40230348 TACCCAGCAATGGGATGGCTGGG + Intergenic
1157066057 18:44352070-44352092 TACCCAGTAATGGTATGGCTGGG - Intergenic
1157074240 18:44447634-44447656 TACCTAGTAATGGGATGGCTGGG - Intergenic
1157199297 18:45645351-45645373 TACCTAGTAATGGGATTGCTGGG + Intronic
1157734301 18:50033024-50033046 TACCTAAGAATGGAATTGCTGGG + Intronic
1158040484 18:53087112-53087134 TACCCAGCAATGGGATGGCTGGG + Intronic
1159149684 18:64505188-64505210 TAGCTACCAGTGCTATACCTGGG - Intergenic
1159321371 18:66855191-66855213 TACCTAGTAATGGGATTGCTGGG - Intergenic
1159456708 18:68668700-68668722 TACCCAGTAATGGTATTGCTGGG - Intergenic
1159463539 18:68750423-68750445 TACCCACTAATGGGATGGCTGGG - Intronic
1159485136 18:69046110-69046132 TACCCAACAATGGGATTGCTGGG + Intronic
1159523912 18:69563281-69563303 TACCCAGCAATGGGATGGCTGGG - Intronic
1159811377 18:73021940-73021962 TACCAAGCAATGGGATGGCTGGG - Intergenic
1160053479 18:75458041-75458063 TACCTACAAGTGGAATTGCTGGG - Intergenic
1162119530 19:8454583-8454605 TACCTAGCAGTGGAATTGCTGGG + Intronic
1162160245 19:8708569-8708591 TACCCAGCAATGGGATGGCTGGG + Intergenic
1163880633 19:19918462-19918484 TACCCAACAATGGGATGGCTGGG + Intronic
1164132470 19:22377608-22377630 TACCTAGTAATGGGATGGCTGGG + Intergenic
1164358405 19:27469198-27469220 TACCCAGCAATGGGATGGCTGGG - Intergenic
1164448539 19:28338371-28338393 TACCCAGCAATGGGATTGCTGGG + Intergenic
1164774143 19:30838037-30838059 TACCTAGTAATGGGATTGCTGGG + Intergenic
1165189453 19:34050464-34050486 TACCCAGCAATGGGATTGCTGGG - Intergenic
1165985322 19:39763696-39763718 TACCCAGCAATGGTATTGCTGGG - Intergenic
1166195133 19:41200795-41200817 TTCCCACCAATGGTATACATGGG - Intronic
1166902726 19:46078345-46078367 TACCTACTATTGGGATTGCTGGG - Intergenic
1168174186 19:54611340-54611362 TACCTACCAATGGGTTTGCTAGG - Intronic
1168372234 19:55845537-55845559 TACCTAATAATGGGATGGCTGGG + Intronic
1168388028 19:55982272-55982294 TACCTAGCAGTGGGATTGCTAGG - Intronic
1168533433 19:57148984-57149006 TACCCACTAATGGGATGGCTGGG - Intergenic
1168656490 19:58132726-58132748 TACCTACCAGTGGAACTGCTGGG - Intronic
925447095 2:3936394-3936416 TACCTAGTAATGGGATTGCTGGG + Intergenic
925782649 2:7396607-7396629 TACCTAGCAATGGGATTGTTGGG + Intergenic
925971393 2:9108972-9108994 TACCTACGAGTGGAATTGCTGGG - Intergenic
926265685 2:11318123-11318145 TACCCACTAATGGGATGGCTGGG + Intronic
926324061 2:11769082-11769104 TACCTAGGAATGGCATTGCTGGG + Intronic
926382705 2:12306309-12306331 TACCTAGTAATGGGATTGCTGGG - Intergenic
926469513 2:13236604-13236626 TACCCACTAATGGGATGGCTGGG + Intergenic
926919174 2:17922958-17922980 TACCTAGGAATGGAATTGCTGGG + Intronic
926981783 2:18580263-18580285 TACCCAGCAATGGGATTGCTGGG - Intronic
927117753 2:19922199-19922221 TACCCAGCAATGGGATTGCTGGG - Intronic
927260092 2:21079531-21079553 TACCCAGCAATGGAATTGCTGGG + Intergenic
927301543 2:21521504-21521526 TACCTAGTAATGGGATGGCTGGG + Intergenic
927354920 2:22161936-22161958 TACCCAATAATGGGATAGCTGGG - Intergenic
927789171 2:25996715-25996737 TACCTAGGAATGGAATAGCTGGG + Intergenic
928754163 2:34503849-34503871 TACCTAGTAATGGGATTGCTGGG - Intergenic
928755561 2:34521570-34521592 TACCCAGCAATGGAATTGCTGGG + Intergenic
928767307 2:34662601-34662623 TACCTTGCAATGTTATTGCTGGG + Intergenic
928933796 2:36653016-36653038 TACCTAGCAATAGTATTGCTGGG - Intergenic
929035940 2:37691872-37691894 TACCTAGTAATGGGATGGCTGGG - Intronic
929235636 2:39602683-39602705 TACCTAGGAATGGAATTGCTGGG + Intergenic
929240896 2:39652193-39652215 TACCCACTAATGGGATGGCTGGG + Intergenic
929243649 2:39678208-39678230 TACCTACTAGTGGAATTGCTGGG - Intronic
929324279 2:40588546-40588568 TACCTAAGAATGGGATTGCTGGG - Intronic
929339868 2:40802170-40802192 TACCTAGTAATGGGATGGCTGGG - Intergenic
930222789 2:48762091-48762113 TACCCAGTAATGGTATTGCTGGG + Intronic
930306886 2:49685970-49685992 TACCTAGTAATGGGATTGCTGGG - Intergenic
930530992 2:52588114-52588136 TACCTAGTAATGGGATTGCTGGG + Intergenic
930796208 2:55394442-55394464 TACCCAGTAATGGGATAGCTGGG + Intronic
930981554 2:57531975-57531997 TACCTATTAATGGGATCGCTCGG - Intergenic
931062977 2:58551600-58551622 TACCCACTAATGGGATTGCTGGG + Intergenic
931332920 2:61306945-61306967 TACCTAGTAATGGGATGGCTGGG - Intronic
932007693 2:67943986-67944008 TACCCACTAATGGGATTGCTGGG - Intergenic
932069263 2:68600564-68600586 TACCTAGTAATGGGATGGCTGGG - Intronic
932426442 2:71638843-71638865 TACCTAGGAATGGAATTGCTAGG + Intronic
932517735 2:72370492-72370514 TACCCAGCAATGGGATGGCTGGG - Intronic
932788517 2:74630845-74630867 TACCTAGTAATGGGATTGCTGGG + Intronic
933076052 2:77927903-77927925 TACCTAGTAATGGAATTGCTGGG + Intergenic
933112588 2:78422757-78422779 TACCCAGTAATGGTATGGCTGGG - Intergenic
933335742 2:80956534-80956556 TACCCAGCAATGGGATTGCTGGG + Intergenic
933410311 2:81917132-81917154 TACCCAGTAATGGGATAGCTGGG + Intergenic
933412649 2:81945373-81945395 TACCCAGTAATGGTATTGCTGGG + Intergenic
933547888 2:83738421-83738443 TACCCAGCAATGGGATTGCTGGG + Intergenic
933601998 2:84342211-84342233 TACCTAGTAATGGGATTGCTAGG + Intergenic
934152783 2:89164458-89164480 TACCTAGTAATGGGATTGCTGGG + Intergenic
934214459 2:90017474-90017496 TACCTAGTAATGGGATTGCTGGG - Intergenic
934478640 2:94613591-94613613 TACCTAGTAATGGGATTGCTGGG + Intergenic
934644101 2:96048246-96048268 TACCTAGAAATGGAATAGCAGGG - Intergenic
934814043 2:97309396-97309418 TACCTAGTAATGGAATTGCTGGG - Intergenic
934823652 2:97399086-97399108 TACCTAGTAATGGAATTGCTGGG + Intergenic
935263258 2:101373086-101373108 TACCTAGGAATGGAATTGCTAGG - Intronic
935389337 2:102534004-102534026 TACCTAGTAATGGGATGGCTGGG + Intergenic
935471954 2:103471181-103471203 TACCCAGTAATGGGATAGCTGGG + Intergenic
935475656 2:103518750-103518772 TACCCAGTAATGGGATAGCTGGG - Intergenic
935759555 2:106307859-106307881 TACCTAGAAATGGGATTGCTGGG + Intergenic
936395840 2:112128795-112128817 TACCTAGGAGTGGTATTGCTGGG - Intergenic
936648096 2:114394986-114395008 TACCTAGTAATGGGATTGCTGGG - Intergenic
936678225 2:114739987-114740009 TACCTAGTAATGGGATGGCTGGG - Intronic
936943574 2:117910621-117910643 TACCTAGTAATGGGATGGCTGGG + Intergenic
937554861 2:123141406-123141428 TACCTAGGAATGGGATGGCTGGG + Intergenic
937592810 2:123634211-123634233 TACCCAGTAATGGGATAGCTGGG - Intergenic
937639679 2:124197590-124197612 TACCTAGCAATGGGATTTCTTGG + Intronic
938526089 2:132132655-132132677 TACCTAGGAATGGAATTGCTGGG - Intergenic
938605974 2:132893284-132893306 TACCTAGCAATGGCGTTGCTGGG - Intronic
938675495 2:133629609-133629631 TACCCAGTAATGGTATTGCTGGG - Intergenic
938686899 2:133747178-133747200 TACCCACTAATGGGATTGCTGGG + Intergenic
939072503 2:137560191-137560213 TACCCAGCAATGGGATGGCTGGG - Intronic
939123047 2:138141384-138141406 TACCCAGCAATGGGATGGCTGGG + Intergenic
939514068 2:143144266-143144288 TACCTAGTAATGGGATTGCTGGG + Intronic
939524534 2:143276307-143276329 GACTTACCAAATGTATAGCTTGG + Intronic
939526759 2:143304956-143304978 TACCTAGTAATGGGATTGCTAGG - Intronic
939534642 2:143412624-143412646 TATTTACTTATGGTATAGCTAGG + Intronic
939573841 2:143872344-143872366 TACCTAGAAGTGGTATTGCTAGG - Intergenic
939731322 2:145787959-145787981 TACCCAGTAATGGTATCGCTGGG - Intergenic
939794036 2:146619011-146619033 TACCCAGCAATGGGATTGCTGGG - Intergenic
939860170 2:147410466-147410488 TACCCAGCAATGGGATTGCTGGG + Intergenic
939937252 2:148308152-148308174 TACCTAGTAATGGGATTGCTGGG + Intronic
940191437 2:151044691-151044713 TTCCTAGCAATGGAATTGCTGGG + Intronic
940553483 2:155191778-155191800 TACCCAGCAATGGGATGGCTGGG + Intergenic
940563253 2:155328933-155328955 TACCCAGCAATGATATTGCTAGG - Intergenic
940629930 2:156225417-156225439 TACCCAGCAATGGGATTGCTAGG - Intergenic
940643946 2:156370776-156370798 TACCCAATAATGGGATAGCTGGG + Intergenic
940809676 2:158228438-158228460 TACCCAGCAATGGGATTGCTGGG - Intronic
940814547 2:158283756-158283778 TACCTAGTAATGGGATGGCTGGG - Intronic
940942773 2:159581552-159581574 TACCTAGTAATGGGACAGCTGGG - Intronic
940977633 2:159963855-159963877 TACCTACGAATAGAATTGCTGGG - Intronic
941067059 2:160915087-160915109 TACCCAGCAATGGGATTGCTGGG + Intergenic
941267642 2:163382765-163382787 TACCTAGTAATGGGATTGCTGGG + Intergenic
941323809 2:164087942-164087964 TACCCAGCAATGGTATGGCTGGG + Intergenic
941566085 2:167109721-167109743 TACCTAATAATGGGATTGCTGGG + Intronic
941895318 2:170623083-170623105 TACCCAGTAATGGGATAGCTGGG + Intronic
942033189 2:171984294-171984316 TACCTAGTAATGGAATTGCTGGG + Intronic
942407777 2:175674271-175674293 TACCCAGTAATGGGATAGCTGGG - Intergenic
942754295 2:179321002-179321024 TACCTAGTAATGGGATGGCTGGG - Intergenic
942762829 2:179420107-179420129 TACCTAGTAATGGGATTGCTGGG - Intergenic
942790204 2:179752445-179752467 TACCCAGTAATGGGATAGCTGGG + Intronic
942878482 2:180830987-180831009 TACCCAGCAATGGGATGGCTGGG + Intergenic
943013730 2:182484995-182485017 TACCTAGTAATGGAATTGCTGGG - Intronic
943031601 2:182692154-182692176 TACCTAGTAATGGGATTGCTGGG - Intergenic
943177211 2:184492013-184492035 TACCTAATAATGGGATTGCTGGG - Intergenic
943262398 2:185682884-185682906 TACCTAGTAATGGGATGGCTGGG + Intergenic
943457807 2:188129004-188129026 TACCCAGTAATGGGATAGCTGGG - Intergenic
943667482 2:190625084-190625106 TACCTAGCACTGGCATTGCTGGG - Intergenic
943820923 2:192320059-192320081 TACCTAGTAATGGGATGGCTGGG - Intergenic
943885600 2:193212928-193212950 TACCCAGTAATGGGATAGCTGGG + Intergenic
943968192 2:194366600-194366622 TACCTAGTAATGGAATTGCTAGG - Intergenic
944020642 2:195099506-195099528 TACCCAACAATGGGATTGCTGGG - Intergenic
944093503 2:195941002-195941024 TACCTAGTAATGGGATTGCTGGG - Intronic
944116088 2:196187560-196187582 TACCCAGCAATGGGATTGCTGGG + Intergenic
944126017 2:196293513-196293535 TACCTAGTAATGGGATTGCTGGG + Intronic
944135383 2:196393783-196393805 TACCCAGTAATGGGATAGCTGGG - Intronic
944211859 2:197214624-197214646 TACCTATCACTGATATAGTTGGG + Intronic
944299308 2:198104551-198104573 TACCCACTAATGGGATTGCTGGG + Intronic
944714970 2:202368913-202368935 TAACTACATATGGTATAACTTGG + Intergenic
945329232 2:208520066-208520088 TACCTAGTAATGGGATTGCTGGG + Intronic
945343719 2:208687642-208687664 TACCTAGTAATGGGATTGCTGGG + Intronic
945770720 2:214039053-214039075 TACCTAGTAATGGGATTGCTGGG + Intronic
946089801 2:217210859-217210881 TACCTAATAATGGGATTGCTGGG + Intergenic
946511614 2:220363881-220363903 TACCCAGCAATGGGATTGCTGGG - Intergenic
946530137 2:220561847-220561869 TACCTACTAATGGGATTGCTGGG - Intergenic
946591749 2:221257304-221257326 TACCCACTAATGGGATGGCTGGG - Intergenic
946967079 2:225047464-225047486 TACCCAGCAATGGGATTGCTGGG + Intergenic
947146956 2:227077119-227077141 TACCTAGTAATGGGATTGCTGGG - Intronic
947196836 2:227576486-227576508 TACCTAACAGTGGAATTGCTGGG - Intergenic
947275412 2:228386201-228386223 TACCTAGTAATGGGATTGCTGGG + Intergenic
947299347 2:228671501-228671523 TACCTAGGAATGGAATTGCTAGG + Intergenic
947322046 2:228930975-228930997 TACCCAGTAATGGTATTGCTGGG + Intronic
947891959 2:233631349-233631371 TACCTAGTAATGGGATTGCTGGG + Intronic
948343660 2:237277185-237277207 TACCTAGTAATGGAATTGCTGGG - Intergenic
948415994 2:237804311-237804333 TACCTAGTAATGGGATTGCTGGG + Intronic
1168858401 20:1026883-1026905 TACCTAGTAATGGGATTGCTGGG + Intergenic
1168922034 20:1546600-1546622 TACCTAGGAGTGGAATAGCTGGG + Intronic
1169413458 20:5394472-5394494 TACCCAGTAATGGTATTGCTGGG + Intergenic
1169809868 20:9598470-9598492 TACCTAGTAATGGGATTGCTGGG + Intronic
1169857767 20:10122670-10122692 TACCCAGCAATGGGATTGCTCGG - Intergenic
1169903658 20:10578593-10578615 TACCTACGAATGGAATTTCTGGG + Intronic
1170107776 20:12770279-12770301 TACCCAGTAATGGTATTGCTGGG - Intergenic
1170170663 20:13407588-13407610 TACCTAGAAATGGAATTGCTGGG + Intronic
1170177114 20:13484287-13484309 TACCTAGTAATGGGATTGCTGGG - Intronic
1170237258 20:14120502-14120524 TACCTAGTAATGGGATTGCTGGG - Intronic
1170766628 20:19294797-19294819 TACCTAGTAATGGGATTGCTGGG + Intronic
1170976481 20:21169559-21169581 TACCCAGTAATGGGATAGCTGGG - Intronic
1170985450 20:21253726-21253748 TACCTAGTAATGGGATGGCTGGG + Intergenic
1171112652 20:22498517-22498539 TACCTAGTAATGGGATTGCTGGG - Intergenic
1171221797 20:23404969-23404991 TACCTAGGAATGGAATTGCTGGG - Intronic
1171231120 20:23486278-23486300 TACCCAGTAATGGGATAGCTGGG + Intergenic
1171408116 20:24927375-24927397 TACCTAGTAATGGCATGGCTGGG - Intergenic
1172923187 20:38505058-38505080 TACCCAGCAATGGGATAGCTGGG - Intronic
1173700100 20:45062438-45062460 TACCCAGCAATGGGATTGCTGGG + Intronic
1174288791 20:49491956-49491978 TATCCAGCAATGGTATTGCTAGG - Intergenic
1174839536 20:53888473-53888495 TACCTACAAGTGGAATTGCTGGG + Intergenic
1174855436 20:54040818-54040840 TACCTAGGAATGGAATTGCTGGG - Intronic
1174880581 20:54274737-54274759 TACCCACTAATGGGATTGCTGGG + Intergenic
1174937102 20:54882678-54882700 TACCTAGTAATGGGATGGCTGGG + Intergenic
1174989775 20:55497286-55497308 TACCTAGTAATGGGATGGCTGGG + Intergenic
1174991704 20:55517972-55517994 TACCCAACAATGGGATTGCTGGG + Intergenic
1176324050 21:5369619-5369641 TACCCAGCAATGGGATGGCTGGG - Intergenic
1176481810 21:7303626-7303648 TACCCAGCAATGGGATGGCTGGG - Intergenic
1176638418 21:9271537-9271559 TACCCAGCAATGGGATGGCTGGG - Intergenic
1176770438 21:13067206-13067228 TACCTAGGAATGGAATTGCTGGG + Intergenic
1176776342 21:13137388-13137410 TACCCAGTAATGGGATAGCTGGG - Intergenic
1177351229 21:19944414-19944436 TACCCAGAAATGGGATAGCTGGG + Intergenic
1177399078 21:20578540-20578562 TACCTAGTAATGGCATTGCTGGG + Intergenic
1177453399 21:21302092-21302114 TACCCACTAATGGGATGGCTGGG - Intronic
1177705540 21:24699289-24699311 TACCTAGTAATGGGATTGCTTGG + Intergenic
1177764266 21:25439102-25439124 TACCTAGTAATGGGATTGCTGGG - Intergenic
1177846642 21:26296385-26296407 TACCCACCAATGGGATTGCTGGG + Intergenic
1177866596 21:26519860-26519882 TACCTAGTAATGGGATTGCTGGG - Intronic
1177964139 21:27705837-27705859 TACCCAGCAATGGGATTGCTGGG + Intergenic
1178050529 21:28741917-28741939 TACCTAGTAATGGGATTGCTGGG + Intergenic
1178809136 21:35865276-35865298 TACCCACTAATGGGATCGCTGGG + Intronic
1179160962 21:38898711-38898733 TACCTAGAAATGGAATTGCTGGG - Intergenic
1179315175 21:40237725-40237747 TACCTAGTAATGGGATTGCTGGG + Intronic
1179386256 21:40945584-40945606 TACCCACAAATGGGATTGCTGGG - Intergenic
1180370554 22:12031875-12031897 TACCCAGCAATGGGATGGCTGGG + Intergenic
1180371726 22:12044370-12044392 TACCCAGCAATGGGATGGCTGGG - Intergenic
1180377334 22:12106336-12106358 TACCCACTAATGGGATGGCTGGG + Intergenic
1180400538 22:12416474-12416496 TACCCAGCAATGGGATGGCTGGG - Intergenic
1180422460 22:12879034-12879056 TACCCAGCAATGGGATGGCTGGG - Intergenic
1180435340 22:15297490-15297512 TACCTAGGAATGGAATTGCTGGG + Intergenic
1180457099 22:15519006-15519028 TACCTACCAATGGCATTGCTGGG - Intergenic
1180517533 22:16161281-16161303 TACCTAGGAATGGAATTGCTGGG + Intergenic
1180543796 22:16479496-16479518 TACCCAGCAATGGGATGGCTGGG - Intergenic
1180575667 22:16771598-16771620 TACCCACTAATGGGATGGCTGGG - Intergenic
1180577999 22:16798452-16798474 TACCCACTAATGGGATTGCTGGG - Intronic
1181504994 22:23347946-23347968 TACCCACTAATGGGATTGCTGGG + Intergenic
1181709983 22:24678210-24678232 TACCCACTAATGGGATTGCTGGG + Intergenic
1182267326 22:29127714-29127736 TACCTAAGAATGGAATTGCTGGG - Intronic
1182813003 22:33133690-33133712 TACCCACTAATGGGATTGCTGGG + Intergenic
1182950116 22:34366182-34366204 TACCTAGTAATGGGATTGCTCGG + Intergenic
1182952139 22:34386873-34386895 TACCCAGCAATGGGATTGCTGGG + Intergenic
1182988769 22:34746147-34746169 TACCTAGTAATGGTATCACTGGG + Intergenic
1182992193 22:34778556-34778578 TACCCAGCAATGGGATTGCTGGG - Intergenic
1183765437 22:39869094-39869116 TACCTAGTAATGGGATTGCTGGG - Intronic
1183907216 22:41050540-41050562 TACCTAGGAATGGAATTGCTGGG + Intergenic
1184323686 22:43764552-43764574 TACCTAGTAATGGGATTGCTGGG + Intronic
1184632993 22:45800572-45800594 TACCTACGAATGAAATTGCTGGG - Intronic
949308197 3:2667101-2667123 TACCTAGTAATGGGATGGCTGGG + Intronic
949423902 3:3895468-3895490 TACCCAGTAATGGGATAGCTGGG + Intronic
949510510 3:4762818-4762840 TACCCAGCAATGGGATTGCTGGG - Intronic
949668715 3:6373132-6373154 TACCCAGTAATGGGATAGCTGGG - Intergenic
949800010 3:7893346-7893368 TACCTAGTAATGGGATGGCTGGG + Intergenic
949846607 3:8377519-8377541 TACCCAGCAATGGGATTGCTGGG - Intergenic
950165792 3:10797698-10797720 TACCCAGTAATGGGATAGCTGGG - Intergenic
951012887 3:17700960-17700982 TACCTAGTAATGGGATGGCTGGG - Intronic
951052535 3:18110528-18110550 TACCTAGCAATGGGATGGCTGGG - Intronic
951320908 3:21244109-21244131 TACCCAGCAATGGGATTGCTGGG + Intergenic
951420938 3:22484018-22484040 TACCCAGTAATGGGATAGCTGGG - Intergenic
951487064 3:23224855-23224877 TACCTAGCAGTGGAATTGCTGGG + Intronic
951596733 3:24326574-24326596 TACCTCCCACTGGCATAGCATGG + Intronic
951618268 3:24572390-24572412 TACCCACTAATGGGATGGCTGGG - Intergenic
951687101 3:25357025-25357047 TACCTACTAATGAGATTGCTGGG + Intronic
951971897 3:28454995-28455017 TACCTAGTAATGGGATTGCTAGG + Intronic
952002881 3:28807623-28807645 TACCTAGAAATGGAATGGCTAGG + Intergenic
952029699 3:29126306-29126328 TACCTAGTAATGGCATTGCTGGG + Intergenic
952035831 3:29199634-29199656 TACCAAGCATTGGTATTGCTGGG + Intergenic
952088231 3:29852789-29852811 TACCTAGGAATGGGATTGCTGGG - Intronic
952595683 3:35014843-35014865 TACCTAGTAATGGGATGGCTGGG + Intergenic
952748425 3:36803849-36803871 TACCTTCCACTGGAATAGATTGG - Intergenic
952809600 3:37389585-37389607 TACCTAATAATGGGATTGCTGGG + Intronic
952937424 3:38411011-38411033 TACCTAGTAATGGGATGGCTGGG - Intronic
953253561 3:41267524-41267546 TACCCAGTAATGGTATTGCTGGG + Intronic
953275479 3:41492242-41492264 TACCCAGCAATGGGATGGCTGGG + Intronic
953516469 3:43597242-43597264 TACCTAGTAATGGGATGGCTGGG - Intronic
953525242 3:43684561-43684583 TACCTAGTAATGGGATGGCTGGG - Intronic
953816035 3:46157598-46157620 TACCCACTAATGGGATTGCTGGG + Intergenic
953895425 3:46795541-46795563 TACCCAGCAATGGGATTGCTGGG - Intronic
954929108 3:54265095-54265117 TACCCAGCAATGGGATTGCTGGG + Intronic
955174535 3:56600491-56600513 TACCTAGTAATGGGATTGCTGGG + Intronic
955361162 3:58276126-58276148 TACCTAGTAATGGGATTGCTGGG + Intronic
955434577 3:58888826-58888848 TACCTAGTAATGGGATTGCTGGG + Intronic
955479581 3:59375991-59376013 TACCCAGCAATGGGATGGCTGGG + Intergenic
956016221 3:64886013-64886035 TACCCAGCAATGGGATTGCTGGG + Intergenic
956154048 3:66274881-66274903 TACCTAGTAATGGGATGGCTGGG - Intronic
956244269 3:67164089-67164111 TACCCAGCAATGGGATTGCTGGG - Intergenic
956245048 3:67173580-67173602 TACCTAGTAATGGGATTGCTGGG + Intergenic
956432216 3:69198561-69198583 TACCTAGGAATGGAATTGCTGGG - Intronic
956668986 3:71668875-71668897 TACCTAGTAATGGGATTGCTGGG - Intergenic
956865962 3:73368969-73368991 TACCCACTAATGGGATGGCTAGG + Intergenic
956954052 3:74316465-74316487 TACCTAGTAATGGGATTGCTGGG - Intronic
957134176 3:76263699-76263721 TACCCACTAATGGGATGGCTGGG - Intronic
957467663 3:80615854-80615876 TACCCACTAATGGGATTGCTGGG - Intergenic
957545633 3:81632683-81632705 TACCTAGTAATGGGATTGCTGGG - Intronic
957565927 3:81883747-81883769 TACCTAGTAATGGGATCGCTGGG - Intergenic
957588091 3:82158462-82158484 TACCTACCAATTTTACATCTGGG + Intergenic
957655538 3:83069423-83069445 TACCTAGTAATGGGATTGCTTGG + Intergenic
958184101 3:90097368-90097390 TACCTAGTAATGGGATCGCTGGG + Intergenic
958214503 3:90545016-90545038 TACCCAGTAATGGTATGGCTGGG - Intergenic
958698342 3:97555440-97555462 TACCTAGTAATGGGATAGCTGGG + Intronic
958705165 3:97645145-97645167 TACCTAGTAATGGGATGGCTGGG - Intronic
958760595 3:98303014-98303036 TACCTAGCAGTGGGATTGCTGGG - Intergenic
958848057 3:99289107-99289129 TACCCACTAATGGGATGGCTGGG + Intergenic
958876140 3:99619469-99619491 TACCTAGTAATGGGATTGCTGGG - Intergenic
959119812 3:102219931-102219953 TACCCAGTAATGGTATTGCTGGG + Intronic
959124430 3:102272919-102272941 TACCCAGCAATGGGATTGCTGGG + Intronic
959235079 3:103710454-103710476 TACCCAGCAATGGAATGGCTGGG + Intergenic
959451425 3:106507759-106507781 TACCTAATAATGGGATTGCTGGG + Intergenic
959495183 3:107042061-107042083 TACCCAGCAATGGGATTGCTGGG - Intergenic
959656803 3:108815987-108816009 TACCTAGTAATGGGATGGCTGGG - Intergenic
959834161 3:110898696-110898718 TACCTAGTAATGGGATTGCTGGG + Intergenic
959843378 3:111004219-111004241 TACCCAGTAATGGTATTGCTGGG - Intergenic
959956936 3:112250423-112250445 TACCTAGTAATGGGATGGCTGGG + Intronic
960075306 3:113477416-113477438 TACCCAGCAATGGGATGGCTGGG - Intronic
960129387 3:114038632-114038654 TACCCAGTAATGGTATAGCTGGG + Intronic
960248613 3:115426986-115427008 TACCTAGTAATGGGATGGCTGGG + Intergenic
960346889 3:116544257-116544279 TACCTAATAATGGGATTGCTGGG - Intronic
960357564 3:116672514-116672536 TACCCAGTAATGGGATAGCTGGG - Intronic
960428865 3:117544422-117544444 TACCTAGTAATGGGATTGCTGGG - Intergenic
960516274 3:118605908-118605930 TACCCAGTAATGGGATAGCTGGG + Intergenic
960558735 3:119058604-119058626 TACCCAGCAATGGGATGGCTGGG - Intronic
960668732 3:120136242-120136264 TACCTAGCAGTGGGATTGCTGGG - Intergenic
960910881 3:122648283-122648305 TTCCTAGCAATGGAATTGCTGGG - Intergenic
961225266 3:125238740-125238762 TACCTAGGAATGGAATTGCTGGG - Intronic
961583925 3:127906660-127906682 TACCTAGCAATGGGATTGCTGGG - Intergenic
961979679 3:131063806-131063828 TACCTAGGAATGGAATTGCTAGG - Intronic
962160979 3:133000026-133000048 TACCCACTAATGGGATGGCTGGG + Intergenic
962220008 3:133556953-133556975 TACCTAGTAATGGGATGGCTGGG - Intergenic
962335152 3:134522914-134522936 TACCTAGTAATGGGATTGCTGGG + Intronic
962339837 3:134572767-134572789 TACCTAGTAATGGAATTGCTGGG + Intronic
962340479 3:134578131-134578153 TACCTAGTAATGGGATTGCTAGG + Intergenic
963047475 3:141113265-141113287 TACCTAAGAATGGAATTGCTGGG - Intronic
963180825 3:142354405-142354427 TACCCAACAATGGGATTGCTGGG - Intronic
963415799 3:144994162-144994184 TACCCAGTAATGGGATAGCTGGG + Intergenic
963499807 3:146112128-146112150 TACCCAGCAATGGGATTGCTGGG - Intronic
963879062 3:150506982-150507004 TACCCAGCAATGGGATTGCTAGG + Intergenic
963953036 3:151223320-151223342 TACCTAGTAATGGGATTGCTGGG - Intronic
964488201 3:157207429-157207451 TACCCAGCAATGGCATAGCTGGG - Intergenic
964500733 3:157345660-157345682 TACCCAGCAATGGGATGGCTGGG - Intronic
964563629 3:158025175-158025197 TACCCAGCAATGGGATGGCTGGG - Intergenic
964596589 3:158439294-158439316 TACCTAGTAATGGGATTGCTGGG - Intronic
964598907 3:158473144-158473166 TACCCAGTAATGGGATAGCTGGG - Intronic
964652574 3:159028003-159028025 TACCTAACAGTGGGATTGCTGGG - Intronic
964779654 3:160322546-160322568 TACCCACTAATGGGATGGCTGGG + Intronic
964781599 3:160345070-160345092 TACCTAGCAGTGGGATTGCTTGG - Intronic
964785290 3:160389841-160389863 TACCCACTAATGGGATGGCTGGG + Intronic
964810463 3:160658018-160658040 TACCCAGCAATGGGATTGCTGGG + Intergenic
964888573 3:161512905-161512927 TACCCACTAATGGGATTGCTGGG + Intergenic
964959565 3:162406376-162406398 TACCCACTAATGGGATGGCTGGG + Intergenic
965135717 3:164764593-164764615 TACCCACCAATGGGATGGCTGGG + Intergenic
965201256 3:165660534-165660556 TACCTAGTAATGGGATTGCTGGG + Intergenic
965296058 3:166948372-166948394 TACCTAATAATGGGATAGCTGGG - Intergenic
965366411 3:167805952-167805974 TACCTAGTAATGGGATTGCTGGG - Intronic
965444448 3:168757635-168757657 TACCTAGTAATGGAATGGCTAGG + Intergenic
965508680 3:169544374-169544396 TACCCAGTAATGGTATTGCTGGG + Intronic
965511448 3:169572471-169572493 TACCCAGCAATGGGATTGCTGGG - Intronic
965989818 3:174802992-174803014 TACCTAGTAATGGGATTGCTGGG + Intronic
966037391 3:175436361-175436383 TACCCACTAATGGGATGGCTGGG + Intronic
966142772 3:176774651-176774673 TACCTAGCAGTGGGATTGCTGGG - Intergenic
966341737 3:178932777-178932799 TACCCAGCAATGGGATTGCTAGG - Intergenic
966352307 3:179044202-179044224 TACCTAGTAATGGGATTGCTGGG - Intronic
966550286 3:181197683-181197705 TACCTAGTAATGGGATTGCTTGG - Intergenic
966654815 3:182344037-182344059 TACCTACTAATGAGATTGCTGGG + Intergenic
966978117 3:185104454-185104476 TACCTAGTAATGGGATTGCTGGG - Intronic
967418036 3:189240891-189240913 TATCTACCAGTGATATAACTTGG + Intronic
967480576 3:189968605-189968627 TACCTAGTAATGGGATTGCTGGG + Intronic
967560708 3:190915943-190915965 TACCTAGCAATGAGATTGCTGGG + Intergenic
967593581 3:191305179-191305201 TACCTAGTAATGGGATTGCTGGG + Intronic
967902683 3:194472627-194472649 TACCTAGTAATGGGATTGCTGGG - Intronic
1202748478 3_GL000221v1_random:133484-133506 TACCCAGCAATGGGATGGCTGGG + Intergenic
969068347 4:4509074-4509096 TACCCACTAATGGGATTGCTAGG + Intronic
969142385 4:5089714-5089736 TACCTAGTAATGGGATTGCTGGG + Intronic
969807709 4:9623557-9623579 TACCCAGCAATGGGATTGCTGGG - Intergenic
970070643 4:12155674-12155696 TACCCAGCAATGGGATTGCTGGG + Intergenic
970096315 4:12466921-12466943 TACCCAGCAATGGGATGGCTGGG - Intergenic
970183327 4:13422378-13422400 TACCCAACAATGGGATGGCTGGG - Intronic
970286819 4:14527053-14527075 TACCCAGCAATGGGATTGCTGGG - Intergenic
970341588 4:15113043-15113065 TACCCAGTAATGGGATAGCTGGG + Intergenic
970391541 4:15617095-15617117 TACCTAGTAATGGGATTGCTGGG - Intronic
970469950 4:16367803-16367825 TACCCAGTAATGGTATGGCTGGG + Intergenic
970591303 4:17562719-17562741 TACCTGCCAATGGTATGACATGG + Intergenic
970612058 4:17734811-17734833 TACCTAGTAATGGGATGGCTGGG - Intronic
970796186 4:19916185-19916207 TACCCAGCAATGGGATGGCTGGG + Intergenic
970957600 4:21833101-21833123 TACCTAGTAATGGGATGGCTGGG + Intronic
970997900 4:22288811-22288833 TACCTGGTAATGGTATTGCTGGG + Intergenic
971023492 4:22564200-22564222 TACCTAGTAATGGGATTGCTGGG - Intergenic
971390365 4:26179797-26179819 TACCCAGCAATGGTATTGCTGGG - Intronic
971429054 4:26544329-26544351 TACCTAGTAATGGGATTGCTGGG + Intergenic
971501007 4:27317921-27317943 TACCTAGTAATGGGATTGCTGGG + Intergenic
971517988 4:27512751-27512773 TACCTAGTAATGGGATGGCTGGG - Intergenic
971548227 4:27914528-27914550 TACCTAGTAATGGGATTGCTGGG - Intergenic
971679509 4:29678522-29678544 TACCTAGTAATGGGATTGCTTGG - Intergenic
971729357 4:30357346-30357368 TACCCAACGATGGTATTGCTGGG + Intergenic
971749227 4:30624694-30624716 TACCCAGTAATGGTATTGCTGGG + Intergenic
971791378 4:31173995-31174017 TACCCAGCAATGGGATTGCTGGG + Intergenic
971873955 4:32280380-32280402 TACCCACTAATGGGATTGCTGGG - Intergenic
972042615 4:34622755-34622777 TACCCAGTAATGGGATAGCTGGG + Intergenic
972057259 4:34818876-34818898 TACCCAGCAATGGGATTGCTGGG - Intergenic
972083034 4:35178138-35178160 TACCTAGTAATGGCATTGCTGGG - Intergenic
972203560 4:36745121-36745143 CACCCAGCAATGGGATAGCTGGG - Intergenic
972417201 4:38852861-38852883 TACCCAGTAATGGGATAGCTGGG - Intronic
972445348 4:39138232-39138254 TACCCAGTAATGGTATTGCTGGG - Intergenic
972455668 4:39251988-39252010 TACCTAGTAATGGGATGGCTGGG - Intronic
972662311 4:41128391-41128413 TACCCAACAATGGGATTGCTGGG - Intronic
972829067 4:42793192-42793214 TACCTAGCAATGGGATGGCTGGG - Intergenic
972948762 4:44292103-44292125 TACCTAGTAATGGGATTGCTGGG - Intronic
973079524 4:45972344-45972366 TACCCAGTAATGGAATAGCTTGG - Intergenic
973139936 4:46754193-46754215 TACCTAGTAATGGGATGGCTGGG - Intronic
973215232 4:47660806-47660828 TACCTAGCAGTGGGATTGCTGGG - Intronic
973289047 4:48451995-48452017 TACCTCACAATGGGATTGCTGGG - Intergenic
973629593 4:52807630-52807652 TACCTAGTAATGGGATTGCTGGG - Intergenic
973640282 4:52895682-52895704 TACCTAGTAATGGGATGGCTGGG + Intronic
973654833 4:53035955-53035977 TACCTAGTAATGGGATTGCTGGG - Intronic
973957081 4:56073116-56073138 TACCCAACAATGGGATGGCTGGG + Intergenic
974104893 4:57458699-57458721 TACCTAGTAATGGGATTGCTGGG - Intergenic
974215223 4:58837846-58837868 CACCTACTAATGGGATTGCTGGG - Intergenic
974603333 4:64118184-64118206 TACCTAGTAATGGGATTGCTGGG + Intergenic
974613021 4:64241013-64241035 TACCCAGTAATGGGATAGCTGGG - Intergenic
974614468 4:64264484-64264506 GAACTACCAATGCTGTAGCTTGG - Intergenic
974766761 4:66357368-66357390 TACCTAGTAATGGGATTGCTGGG + Intergenic
974867513 4:67598291-67598313 TACCTAGCAGTGGGATTGCTGGG + Intronic
974955526 4:68636424-68636446 TACCCAGCAATGGCATTGCTGGG + Intronic
974970932 4:68825850-68825872 TACCTAGTAATGGGATTGCTGGG + Intronic
975036817 4:69694612-69694634 TACCTAGTAATGGGATGGCTGGG + Intergenic
975150673 4:71017409-71017431 TACCCACTAATGGGATGGCTGGG - Intronic
975187863 4:71424471-71424493 TACCCACTAATGGGATGGCTGGG - Intronic
975238135 4:72025126-72025148 TACCCAGCAATGGGATGGCTGGG - Intergenic
975247655 4:72138772-72138794 TACCTAGTAATGGGATTGCTGGG + Intronic
975309804 4:72890927-72890949 TACCCAGTAATGGTATTGCTGGG + Intergenic
975389138 4:73796274-73796296 TACCCAGCAATGGAATTGCTGGG - Intergenic
975411030 4:74050144-74050166 TACCTAGTAATGGGATGGCTGGG - Intergenic
975430515 4:74284820-74284842 TACCCAGCAATGGCATGGCTGGG - Intronic
975724733 4:77280840-77280862 TACCTAGTAATGGGATTGCTGGG + Intronic
975904305 4:79191183-79191205 TACCCAGCAATGGGATTGCTGGG + Intergenic
976037718 4:80844264-80844286 TACCTAGTAATGGGATGGCTGGG + Intronic
976131574 4:81890395-81890417 TACCTAGTAATGGGATGGCTGGG - Intronic
976328942 4:83805604-83805626 TACCCAGCAATGGGATGGCTGGG - Intergenic
976594962 4:86886743-86886765 TACCTAGTAATGGGATGGCTGGG - Exonic
976795266 4:88925185-88925207 TACCCACTAATGGGATGGCTGGG - Intronic
976908674 4:90272537-90272559 TACCTAGCAGTGGGATACCTAGG - Intronic
977218318 4:94309640-94309662 TACCCACTAATGGGATGGCTGGG + Intronic
977339070 4:95734512-95734534 TACCTAGTAATGGCATTGCTGGG + Intergenic
977347005 4:95828854-95828876 TACCCACTAATGGGATCGCTGGG - Intergenic
977448385 4:97161664-97161686 TACCCACTAATGGGATGGCTGGG - Intergenic
977455520 4:97255115-97255137 TACCCACTAATGGGATTGCTGGG + Intronic
977519410 4:98061926-98061948 TACTTAGCAATGGGATTGCTGGG - Intronic
977632207 4:99255528-99255550 TACCTAGTAATGGGATTGCTGGG + Intergenic
977980102 4:103311058-103311080 TACCCAGTAATGGTATGGCTGGG + Intergenic
978026275 4:103878726-103878748 TACCCAGCAATGGGATTGCTGGG - Intergenic
978253866 4:106669449-106669471 TACCTAGTAATGGGATTGCTGGG + Intergenic
978474296 4:109108541-109108563 TACCTAGTAATGGGATGGCTGGG + Intronic
978517270 4:109582009-109582031 TACCCAGCAATGGGATGGCTGGG - Intronic
978548067 4:109894810-109894832 TACCCACCAATGGGATGGCTGGG + Intergenic
978560039 4:110023236-110023258 TACCTAGTAATGGGATTGCTGGG + Intergenic
978565998 4:110082224-110082246 TACCCAGTAATGGGATAGCTGGG - Intronic
978590739 4:110322329-110322351 TACCCAGTAATGGGATAGCTGGG + Intergenic
978678030 4:111342415-111342437 TACCTAGTAATGGGATGGCTGGG - Intergenic
978730885 4:112025179-112025201 TACCCAGTAATGGTATTGCTGGG - Intergenic
979184926 4:117776234-117776256 TACCTAACAGTGGGATTGCTAGG - Intergenic
979236783 4:118409307-118409329 TACCCAGTAATGGGATAGCTGGG - Intergenic
979423117 4:120530894-120530916 TACCCAGTAATGGGATAGCTGGG + Intergenic
979543040 4:121908357-121908379 TACCCACTAATGGAATTGCTGGG - Intronic
979582295 4:122374970-122374992 TACCTAGGAATGGGATTGCTGGG - Intergenic
979953587 4:126926313-126926335 TACCTAGTAATGGGATTGCTGGG - Intergenic
979960882 4:127020364-127020386 TACCTAGTAATGGGATGGCTGGG - Intergenic
980030246 4:127819977-127819999 TACCTAGGAATGGAATTGCTGGG + Intronic
980288666 4:130814895-130814917 TACCTAATAATGGGATTGCTGGG + Intergenic
980329572 4:131392718-131392740 TACCTAGGAATGAAATAGCTAGG - Intergenic
980335995 4:131474063-131474085 TACCCAGTAATGGTATTGCTGGG + Intergenic
980414217 4:132463368-132463390 TACCCAGCAATGGGATGGCTGGG - Intergenic
980542554 4:134213399-134213421 TACCCAGTAATGGGATAGCTGGG - Intergenic
980635663 4:135498591-135498613 TACCTAATAATGGGATTGCTGGG + Intergenic
980863880 4:138530597-138530619 TACCCAGCAATGGGATTGCTGGG - Intergenic
981014928 4:139964076-139964098 TACCCAGCAATGGGATTGCTGGG - Intronic
981311255 4:143300080-143300102 TACCTAGTAATGGGATTGCTGGG - Intergenic
981388219 4:144156515-144156537 TACCTAGTAATGGGATTGCTGGG + Intergenic
981427182 4:144617059-144617081 TACCCACTAATGGTATTGCTGGG - Intergenic
981612217 4:146606550-146606572 TACCTAGTAATGGGATCGCTGGG - Intergenic
981632531 4:146836974-146836996 TACCTAGTAATGGGATTGCTGGG - Intronic
981759942 4:148183332-148183354 TACCCAGTAATGGGATAGCTGGG + Intronic
981851425 4:149234616-149234638 TACCCAGCAATGGGATTGCTGGG + Intergenic
982315938 4:154031925-154031947 TACCTGCTAATGGGATTGCTGGG + Intergenic
982410310 4:155068716-155068738 TACCCAGTAATGGGATAGCTGGG - Intergenic
982846623 4:160260621-160260643 TACCCACTAATGGGATTGCTGGG + Intergenic
982895124 4:160911083-160911105 TACCCAGCAATGGGATGGCTGGG - Intergenic
983079724 4:163370452-163370474 TACCTAGTAATGGGATTGCTGGG - Intergenic
983272640 4:165581251-165581273 TACCCAGCAATGGGATGGCTGGG - Intergenic
983327081 4:166271019-166271041 TACCTAGTAATGGGATGGCTGGG - Intergenic
983478455 4:168243735-168243757 TACCCAGCAATGGAATTGCTGGG - Intronic
983715645 4:170778019-170778041 CACCTAGCAATGGGATTGCTGGG - Intergenic
983895709 4:173079325-173079347 TACCTAGTAATGGGATTGCTGGG + Intergenic
983996385 4:174187856-174187878 TACCCAGTAATGGTATTGCTGGG - Intergenic
984267306 4:177510363-177510385 TACCTAGTAATGGGATTGCTGGG + Intergenic
984324439 4:178234043-178234065 TACCTAGTAATGGGATTGCTAGG + Intergenic
984485159 4:180358877-180358899 TACCCATTAATGGGATAGCTGGG + Intergenic
984574723 4:181434867-181434889 TACCCAGCAATGGGATTGCTGGG + Intergenic
984903628 4:184607434-184607456 TACCTAGTAATGGGATTGCTGGG - Intergenic
985039895 4:185879530-185879552 TACCCAGTAATGGGATAGCTGGG + Intronic
985325469 4:188763484-188763506 TACCCAGCAATGGGATCGCTGGG + Intergenic
1202758941 4_GL000008v2_random:91795-91817 TACCCACTAATGGGATGGCTGGG + Intergenic
985984138 5:3499737-3499759 TACCTAGTAATGGGATTGCTGGG - Intergenic
986100798 5:4609248-4609270 TACCTAGTAATGGGATTGCTGGG - Intergenic
986347449 5:6847936-6847958 TACCCAGCAATGGGATTGCTGGG + Intergenic
986420148 5:7572151-7572173 TACCTAGTAATGGGATTGCTGGG + Intronic
986467748 5:8043587-8043609 TACCTAGTAATGGGATGGCTGGG + Intergenic
986522891 5:8640877-8640899 TACCCACTAATGGGATTGCTGGG - Intergenic
986894640 5:12350598-12350620 AACCTACAAAAGGTAAAGCTAGG - Intergenic
986924400 5:12729655-12729677 TACCCAGTAATGGTATTGCTGGG - Intergenic
987139993 5:14935508-14935530 TACCTAGGAATGGAATTGCTGGG + Intergenic
987156982 5:15098442-15098464 TACCTAGTAATGGAATCGCTGGG + Intergenic
987275648 5:16359633-16359655 TACCCACTAATGGGATTGCTGGG - Intergenic
987443107 5:17982218-17982240 TACCTAGTAATGGAATTGCTGGG - Intergenic
987555154 5:19436916-19436938 TGCCTACCAATAGTATTACTTGG - Intergenic
987694965 5:21316254-21316276 TACCTAGTAATGGGATTGCTGGG + Intergenic
987714020 5:21543162-21543184 TACCTAGTAATGGGATTGCTGGG + Intergenic
987731379 5:21777269-21777291 TACATAACAGTGGTATAGTTAGG - Intronic
988126583 5:27047160-27047182 TACCTAGTAATGGGATGGCTGGG - Intronic
988129304 5:27081522-27081544 TACCTACTAATGGCATTGCTGGG - Intronic
988190102 5:27919375-27919397 TACCTAGTAATGGGATGGCTGGG - Intergenic
988235968 5:28545073-28545095 TACCTAGTAATGGGATTGCTGGG - Intergenic
988308681 5:29528677-29528699 TACCTAGTAATGGGATGGCTGGG - Intergenic
988309247 5:29536675-29536697 TACCCAGCAATGGAATTGCTGGG + Intergenic
988344020 5:30013817-30013839 TACCTAGTAATGGGATTGCTGGG - Intergenic
988379750 5:30484888-30484910 TACCCAGTAATGGTATTGCTGGG + Intergenic
988397244 5:30710537-30710559 TACCCAGCAATGGGATGGCTGGG - Intergenic
988626344 5:32879317-32879339 TACCTAGCATTGGGATTGCTGGG - Intergenic
989026941 5:37078561-37078583 TACCCAGCAATGGTATTGCTGGG + Intergenic
989161089 5:38392469-38392491 TACCCACTAATGGCATTGCTGGG + Intronic
989212807 5:38873446-38873468 TACTTACAAATGGAATTGCTGGG + Intronic
989215563 5:38901249-38901271 TGCCTACCAATGGTCTGGCGTGG - Intronic
989670502 5:43911061-43911083 TACCTAGTAATGGGATGGCTGGG + Intergenic
989825836 5:45853494-45853516 TACCCAGCAATGGGATTGCTGGG - Intergenic
989835353 5:45981857-45981879 TACCCAGCAATGGGATGGCTGGG - Intergenic
989843151 5:46106789-46106811 TACCCAGCAATGGGATGGCTGGG + Intergenic
989854824 5:46270824-46270846 TACCCACTAATGGGATGGCTGGG - Intergenic
989954993 5:50348022-50348044 TACCCAGCAATGGGATGGCTGGG + Intergenic
990027287 5:51209342-51209364 TACCTAGGAATGGAATTGCTGGG + Intergenic
990167670 5:53012612-53012634 TACCTAATAATGGGATTGCTGGG + Intronic
990379920 5:55212929-55212951 TACCTACCAATGAATGAGCTTGG + Intergenic
990405028 5:55480798-55480820 TACCTACAAGTGGGATTGCTAGG + Intronic
990480077 5:56201773-56201795 TACCTAGTAATGGGATTGCTGGG - Intronic
990549833 5:56863654-56863676 TACCTAGGAATGGAATTGCTGGG + Intronic
990668508 5:58100631-58100653 TACCTAGTAATGGGATTGCTGGG + Intergenic
990971982 5:61518299-61518321 TACCCACTAATGGGATGGCTGGG + Intronic
991040471 5:62169729-62169751 TACCCAGCAATGGGATTGCTGGG - Intergenic
991151042 5:63370606-63370628 TACCTAGGAATGGAATCGCTGGG - Intergenic
991167331 5:63579375-63579397 TACCCAGCAATGGGATGGCTGGG - Intergenic
991209978 5:64092800-64092822 TACCTAGTAATGGGATGGCTGGG - Intergenic
991234106 5:64374582-64374604 TAGCTACCAGTGGTACAGCTAGG + Intergenic
991265164 5:64709548-64709570 TACCTAGTAATGGGATGGCTGGG + Intronic
991407086 5:66310452-66310474 TACCTAGTAATGGGATTGCTGGG + Intergenic
991576403 5:68108204-68108226 TACCCAGCAATGGGATAGCTGGG - Intergenic
991745263 5:69733189-69733211 TACCTAGTAATGGGATTGCTGGG - Intergenic
991752444 5:69822037-69822059 TACCTAGTAATGGGATTGCTGGG + Intergenic
991796831 5:70312918-70312940 TACCTAGTAATGGGATTGCTGGG - Intergenic
991824640 5:70608503-70608525 TACCTAGTAATGGGATTGCTGGG - Intergenic
991831762 5:70697161-70697183 TACCTAGTAATGGGATTGCTGGG + Intergenic
991889209 5:71312474-71312496 TACCTAGTAATGGGATTGCTGGG - Intergenic
991931741 5:71759708-71759730 TACCCACTAATGGGATGGCTGGG + Intergenic
992026506 5:72674829-72674851 TACCTAGTAATGGGATTGCTGGG + Intergenic
992288427 5:75259944-75259966 TACCCAGTAATGGGATAGCTGGG - Intergenic
992310707 5:75496451-75496473 TACCTATGAATGGGATTGCTAGG - Intronic
992346431 5:75883321-75883343 TACCCAGTAATGGGATAGCTGGG - Intergenic
992465281 5:76998256-76998278 TACCTAGTAATGGTATTGGTGGG - Intergenic
992674920 5:79096404-79096426 TACCCAGTAATGGGATAGCTGGG + Intronic
992811341 5:80391649-80391671 TACCCAGTAATGGGATAGCTGGG + Intergenic
992865349 5:80952189-80952211 TACCCAGTAATGGGATAGCTGGG - Intergenic
992972790 5:82079876-82079898 TACCCAGTAATGGGATAGCTGGG + Intronic
993008264 5:82451749-82451771 TACCCACTAATGGAATGGCTGGG + Intergenic
993116703 5:83727845-83727867 TACCCAGCAATGGGATTGCTGGG - Intergenic
993119658 5:83759100-83759122 TACCCAGCAATGGGATTGCTGGG - Intergenic
993255252 5:85582761-85582783 TACCCATTAATGGTATTGCTGGG + Intergenic
993420437 5:87694749-87694771 TACCCAGCAATGGGATGGCTGGG + Intergenic
993492428 5:88568562-88568584 TACCCAGAAATGGTATGGCTGGG - Intergenic
993512902 5:88794155-88794177 TACCCAGAAATGGTATGGCTGGG + Intronic
993672436 5:90777451-90777473 CAACTATCAATGGCATAGCTGGG + Intronic
993720558 5:91317668-91317690 TACCTACCATTGTTATTCCTTGG - Intergenic
994319923 5:98382370-98382392 TACCTACCAGTGGGATTGCTGGG + Intergenic
994331062 5:98507207-98507229 TACCCAGCAATGGGATTGCTGGG - Intergenic
994443983 5:99848980-99849002 TACCTAGTAATGGGATGGCTGGG - Intergenic
994444998 5:99861414-99861436 TACCTAGTAATGGGATGGCTGGG - Intergenic
994447630 5:99898288-99898310 TACCTAGTAATGGGATGGCTGGG - Intergenic
994550805 5:101232368-101232390 TACCTAGTAATGGGATTGCTGGG + Intergenic
994619708 5:102148753-102148775 TACCTAGTAATGGGATCGCTGGG - Intergenic
994966844 5:106683837-106683859 TACCTAGTAATGGGATGGCTGGG - Intergenic
994971321 5:106742842-106742864 TACCTAGTAATGGGATTGCTGGG + Intergenic
995017988 5:107333564-107333586 TACCCACTAATGGGATTGCTGGG - Intergenic
995099914 5:108287745-108287767 TACCCAACAATGGGATTGCTGGG - Intronic
995188495 5:109296402-109296424 TACCTAGCAATGGGATTGCTGGG - Intergenic
995263043 5:110127823-110127845 TACCCAGCAATGGGATTGCTGGG + Intergenic
995322882 5:110857058-110857080 TACCCAGCAATGATATTGCTGGG - Intergenic
995553761 5:113306267-113306289 TACCTAAGAATGGAATTGCTTGG + Intronic
995698042 5:114901500-114901522 TACCTAGTAATGGGATTGCTGGG + Intergenic
995699198 5:114915180-114915202 TACCCAGTAATGGGATAGCTGGG + Intergenic
995812852 5:116127406-116127428 TACCTAGTAATGGGATGGCTGGG - Intronic
996151463 5:120041048-120041070 TACCCAGCAATGGGATTGCTTGG - Intergenic
996172423 5:120310636-120310658 TACCTAGTAATGGCATGGCTGGG + Intergenic
996186488 5:120482641-120482663 TACCTGGCAATGGGATTGCTGGG + Intronic
996252504 5:121353572-121353594 TACCCACTAATGGGATGGCTGGG - Intergenic
996256633 5:121412431-121412453 TACCCACTAATGGGATGGCTGGG - Intergenic
996280195 5:121720896-121720918 TACCCAGCAATGGGATTGCTGGG + Intergenic
996288421 5:121823180-121823202 TACCTAGGAATGGGATAGCTGGG + Intergenic
996296369 5:121922125-121922147 TACCCAGCAATGGGATTGCTGGG - Intergenic
996361462 5:122652392-122652414 TACCTAGGAATGGAATTGCTGGG - Intergenic
996366757 5:122710125-122710147 TACCCAGTAATGGGATAGCTGGG + Intergenic
996419930 5:123251441-123251463 TACCCACTAATGGGATGGCTGGG + Intergenic
996649474 5:125856169-125856191 TACCCACTAATGGGATGGCTGGG - Intergenic
996830216 5:127732473-127732495 TACCTAGTAATGGGATTGCTGGG - Intergenic
996959840 5:129234052-129234074 TACCCAGTAATGGGATAGCTGGG + Intergenic
997515707 5:134488056-134488078 TACCTAGGAATGGAATGGCTGGG + Intergenic
997806286 5:136921434-136921456 TACCCAGTAATGGTATTGCTGGG - Intergenic
997898220 5:137739311-137739333 TACCTAGTAATGGGATTGCTGGG - Intergenic
998206565 5:140161450-140161472 TACCTACAAGTGGGATTGCTGGG + Intergenic
998255864 5:140587360-140587382 TACCTAGGAGTGGAATAGCTGGG - Intronic
998671755 5:144361278-144361300 TACCTAGTAATGGGATTGCTGGG + Intronic
998704160 5:144739595-144739617 TACCTAGTAATGGGATTGCTGGG - Intergenic
999440417 5:151596297-151596319 TACCTTTAAATGGTAGAGCTAGG + Intergenic
999484627 5:151983484-151983506 TACCCAGCAATGGGATGGCTGGG + Intergenic
999529502 5:152446749-152446771 TACCCACTAATGGGATTGCTGGG + Intergenic
999740565 5:154547111-154547133 TACCCACTAATGGGATTGCTGGG - Intergenic
999971977 5:156873464-156873486 TACCTAGTAATGGGATTGCTGGG + Intergenic
1000057762 5:157623077-157623099 TACCCAGCAATGGGATTGCTGGG - Intergenic
1000421160 5:161039532-161039554 TACCCACTAATGGGATTGCTGGG - Intergenic
1000425742 5:161089295-161089317 TACCTAGTAATGGGATTGCTGGG - Intergenic
1000613011 5:163396046-163396068 TACCTAGTAATGGGATTGCTGGG - Intergenic
1000675841 5:164121537-164121559 TACCTAGTAATGGGATTGCTGGG + Intergenic
1000845832 5:166279430-166279452 TACCCACTAATGGGATTGCTGGG + Intergenic
1001190742 5:169628678-169628700 TACCTAGTAATGGGATTGCTGGG + Intergenic
1001192681 5:169645154-169645176 TACCTAGTAATGGGATTGCTGGG + Intronic
1001387327 5:171350612-171350634 TACCTAATAATGGGATTGCTGGG + Intergenic
1001507152 5:172288706-172288728 TACCTAGGAATGGAATTGCTTGG + Intergenic
1001842389 5:174889474-174889496 TACCTAGTAATGGGATCGCTGGG + Intergenic
1001856575 5:175016165-175016187 TACCTAGGAATGGAATTGCTGGG + Intergenic
1001897700 5:175395804-175395826 TACCTAGTAATGGGATGGCTGGG + Intergenic
1002004724 5:176222652-176222674 TACCTAGGAATGGAATGGCTGGG - Intergenic
1002221653 5:177687968-177687990 TACCTAGGAATGGAATGGCTGGG + Intergenic
1002286720 5:178167585-178167607 TATCTACTAATGGGATTGCTGGG + Intergenic
1002314766 5:178336215-178336237 TACCTAGCAGTGGAATTGCTGGG - Intronic
1002545172 5:179937678-179937700 TACCTAGCAGTGGAATTGCTGGG - Intronic
1002578320 5:180191267-180191289 TACCTACCAGTGGAATGGCCAGG - Intronic
1002848570 6:970492-970514 TACCTCCCAATGTTGTTGCTGGG + Intergenic
1003103824 6:3198115-3198137 TACCCATCAATGGGATGGCTGGG + Intergenic
1003498954 6:6688187-6688209 TACCTAGTAATGGGATTGCTTGG + Intergenic
1003523356 6:6877793-6877815 TACCCACTAATGGGATCGCTGGG - Intergenic
1003803064 6:9693331-9693353 TACCCACTAATGGGATTGCTGGG + Intronic
1004190590 6:13460293-13460315 TACCTAGTAATGGGATTGCTGGG - Intronic
1004493128 6:16136590-16136612 TACCTAAGAGTGGAATAGCTGGG + Intronic
1004506496 6:16251020-16251042 TACCTAGAAATGGAATTGCTGGG - Intronic
1004752451 6:18576712-18576734 TACCTAGTAATGGGATTGCTGGG + Intergenic
1004796339 6:19090055-19090077 TACCTAGGAATGGGATTGCTAGG - Intergenic
1004833629 6:19505757-19505779 TACCCAGCAATGGGATTGCTGGG + Intergenic
1004937802 6:20525190-20525212 CACCTAGTAATGGGATAGCTGGG - Intergenic
1005119729 6:22376681-22376703 TACCTAGTAATGGGATTGCTGGG + Intergenic
1005171273 6:22988010-22988032 TACCTACTAATAGGATTGCTGGG + Intergenic
1005177592 6:23064446-23064468 TACCCAGTAATGGGATAGCTGGG - Intergenic
1005237303 6:23779516-23779538 TACCTAGTAATGGGATGGCTGGG - Intergenic
1005245907 6:23884938-23884960 TACCAAACAATGGTATGGATTGG - Intergenic
1005290189 6:24372099-24372121 TACCCAGCAATGGGATGGCTGGG - Intergenic
1005555930 6:26983581-26983603 TACCTAGTAATGGGATTGCTGGG - Intergenic
1005789217 6:29279067-29279089 TACCCAGCAATGGGATGGCTGGG - Intergenic
1006266065 6:32924858-32924880 TACCCAACAATGGAATTGCTGGG + Intergenic
1006570131 6:34995915-34995937 TACCTATGAATGGGATTGCTGGG + Intronic
1006753939 6:36398355-36398377 TACCTAGGAATGGAATTGCTGGG - Intronic
1007068974 6:39021029-39021051 TACCTAGTAATGGGATTGCTGGG + Intronic
1008154929 6:48002241-48002263 TACCCACTAATGGGATGGCTGGG - Intronic
1008237054 6:49063268-49063290 TACCTAGTAATGGGATGGCTGGG - Intergenic
1008269918 6:49479607-49479629 TACCCACTAATGGGATTGCTGGG - Intronic
1008286886 6:49664049-49664071 TACCTAGTAATGGGATTGCTGGG - Intergenic
1008303516 6:49871910-49871932 TACCTAGTAATGGGATGGCTGGG + Intronic
1008304079 6:49879573-49879595 TACCTAGCAATGGAATTGCTAGG + Intergenic
1008350413 6:50483116-50483138 TACCCACTAATGGGATGGCTGGG - Intergenic
1008363092 6:50644533-50644555 TACCTAGTAATGGGATGGCTGGG + Intergenic
1008486291 6:52039733-52039755 TACCTAAAAATGGAATTGCTGGG - Intronic
1008499631 6:52168333-52168355 TACCTAGTAATGGGATTGCTGGG - Intergenic
1008614386 6:53212076-53212098 TACCTAGCAGTGGGATTGCTGGG + Intergenic
1008887809 6:56450145-56450167 TACCTACCAATAGTATGTGTAGG + Intergenic
1009002708 6:57738910-57738932 TACCTAGTAATGGGATTGCTGGG - Intergenic
1009245074 6:61227551-61227573 TACCTAGTAATGGGATAGCTGGG - Intergenic
1009304454 6:62070850-62070872 TACCCAGCAATGGGATGGCTGGG + Intronic
1009801059 6:68536917-68536939 TACCTAGTAATGGGATTGCTGGG + Intergenic
1009838044 6:69030244-69030266 TACCTAGCAATGGGATTGCTGGG - Intronic
1009845716 6:69132137-69132159 TACCCAGCAATGGGATTGCTGGG + Intronic
1009921397 6:70066079-70066101 TACCCAGTAATGGTATGGCTGGG - Intronic
1009984438 6:70766256-70766278 TACCTAGTAATGGGATGGCTGGG + Intronic
1009997672 6:70914916-70914938 TACCCACAAATGGGATTGCTGGG + Intronic
1010006745 6:71003624-71003646 TACCCACAAATGGGATTGCTGGG - Intergenic
1010031555 6:71276135-71276157 TACCCAGTAATGGGATAGCTGGG - Intergenic
1010125460 6:72426687-72426709 TACCTAGTAATGGGATGGCTGGG + Intergenic
1010199083 6:73267645-73267667 TACCTAAAAATGGAATTGCTGGG - Intronic
1010294357 6:74179052-74179074 TACCTAGTAATGGGATTGCTGGG - Intergenic
1010312750 6:74406771-74406793 TACCTAGTAATGGGATGGCTGGG - Intergenic
1010313977 6:74423280-74423302 TACCCAGCAATGGGATGGCTGGG - Intergenic
1010336633 6:74692122-74692144 TACCCAGCAATGGGATTGCTGGG + Intergenic
1010399589 6:75433188-75433210 TACCCAGTAATGGTATGGCTGGG + Intronic
1010448044 6:75970948-75970970 TACCTAGTAATGGGATTGCTGGG - Intronic
1010449637 6:75988132-75988154 TACCTACTAATGGGATGGCTGGG + Intronic
1010473125 6:76253626-76253648 TACCCACTAATGGGATTGCTGGG + Intergenic
1010482279 6:76369941-76369963 TACCTAGTAATGGGATGGCTGGG + Intergenic
1010502915 6:76623354-76623376 TACCCACTAATGGGATGGCTGGG + Intergenic
1010609792 6:77940491-77940513 ACCCAACCAATTGTATAGCTTGG + Intergenic
1010647902 6:78414889-78414911 TACCCAGCAATGATATTGCTGGG - Intergenic
1010680600 6:78794601-78794623 TACCCAGTAATGGTATGGCTGGG - Intergenic
1010852463 6:80794914-80794936 TACCCACTAATGGGATTGCTGGG - Intergenic
1010907051 6:81503516-81503538 TACCTAGCAATGGGATTGCTGGG - Intronic
1010952230 6:82050295-82050317 TACCTAAGAGTGGTATTGCTGGG + Intergenic
1010998839 6:82563890-82563912 TACCCAATAATGGGATAGCTGGG - Intergenic
1011021303 6:82816239-82816261 TACCTAGCAATGGGATTGCTGGG - Intergenic
1011153928 6:84307616-84307638 TACCCAGCAATGGGATTGCTGGG + Intergenic
1011302333 6:85889427-85889449 TACCTAGTAATGGGATTGCTGGG + Intergenic
1011308099 6:85951662-85951684 TACCCACTAATGGGATTGCTGGG - Intergenic
1011402377 6:86977544-86977566 TACCTAATAATGGGATTGCTGGG + Intronic
1011815622 6:91186734-91186756 TACCCACTAATGGGATTGCTGGG + Intergenic
1011916792 6:92515923-92515945 TACCCAGTAATGGTATTGCTGGG - Intergenic
1011967833 6:93181531-93181553 TACCTAGTAATGGGATGGCTGGG + Intergenic
1012018265 6:93881185-93881207 TACCCAGCAATGGGATTGCTGGG + Intergenic
1012047905 6:94301923-94301945 TACCCACTAATGGGATTGCTGGG - Intergenic
1012094304 6:94939112-94939134 TACCCAATAATGGGATAGCTGGG - Intergenic
1012135877 6:95554953-95554975 TACCTAGTAATGGGATTGCTGGG + Intergenic
1012172157 6:96030605-96030627 TACCTAGAAATTGTATTGCTGGG - Intronic
1012664458 6:101949868-101949890 TACCTAGTAATGGGATTGCTGGG + Intronic
1012738768 6:102985850-102985872 TACCTACGAGTGGGATTGCTGGG + Intergenic
1012768116 6:103395782-103395804 TATATACCAATGGTATGGTTTGG + Intergenic
1012789354 6:103674222-103674244 TACCTAGTAATGGGATTGCTGGG + Intergenic
1012921947 6:105229057-105229079 TACCCAGTAATGGGATAGCTGGG + Intergenic
1012924070 6:105249987-105250009 TACCCAGCAATGGGATGGCTGGG - Intergenic
1013057753 6:106600944-106600966 TACCTAAGAATGGAATTGCTGGG + Intronic
1013433094 6:110073481-110073503 TACCCACTAATGGGATTGCTGGG - Intergenic
1013506140 6:110802161-110802183 TACCTAGTAATGGGATTGCTGGG - Intronic
1013661714 6:112304427-112304449 TACCCAGAAATGGTATTGCTGGG + Intergenic
1013669741 6:112387252-112387274 TACCTAGTAATGGGATTGCTGGG - Intergenic
1013867922 6:114721234-114721256 TACCTAGTAATGGGATGGCTGGG + Intergenic
1013873865 6:114800417-114800439 TACCTAGTAATGGGATGGCTGGG + Intergenic
1013877171 6:114846058-114846080 TACCTAGTAATGGGATGGCTGGG + Intergenic
1013903051 6:115180698-115180720 TACCTAGTAATGGGATGGCTGGG - Intergenic
1013965485 6:115950649-115950671 TACCCAGCAATGGGATTGCTGGG - Intronic
1013991593 6:116260000-116260022 TACCTATTAATGGGATTGCTTGG + Intronic
1014183970 6:118414429-118414451 TACCCAGTAATGGTATTGCTGGG - Intergenic
1014297337 6:119636084-119636106 TACCTAGCATTGGAATTGCTGGG - Intergenic
1014334869 6:120120654-120120676 TACCTAGTAATGGAATTGCTAGG + Intergenic
1014487484 6:122017231-122017253 TACCCAACAATGGGATTGCTAGG + Intergenic
1014515865 6:122377736-122377758 TACCCAGTAATGGTATTGCTGGG + Intergenic
1014672636 6:124325372-124325394 TACCTAGAAGTGGTATTGCTGGG - Intronic
1014683507 6:124465112-124465134 TACCTTGCAATGGGATTGCTGGG - Intronic
1014782135 6:125576315-125576337 TACCTAGTAATGGGATTGCTGGG + Intergenic
1014855813 6:126399169-126399191 TACCTAGTAATGGGATTGCTGGG + Intergenic
1014894319 6:126883275-126883297 TACCCAGCAATGGGATTGCTGGG + Intergenic
1015170854 6:130250952-130250974 TACTTAGCAGTGGTATTGCTGGG + Intronic
1015282153 6:131445367-131445389 TACCTAGTAATGGGATTGCTGGG - Intergenic
1015773073 6:136788880-136788902 TACCTAGTAATGGGATTGCTGGG - Intronic
1016164888 6:140928615-140928637 TACCCAGTAATGGTATTGCTGGG + Intergenic
1016223909 6:141710249-141710271 TACCTAGTAATGGGATTGCTAGG - Intergenic
1016249852 6:142027803-142027825 TACCTAGTAATGGGATTGCTGGG - Intergenic
1016338026 6:143029752-143029774 TACCCACTAATGGGATTGCTGGG + Intergenic
1016695437 6:146988845-146988867 TACCTAGTAATGGGATTGCTGGG - Intergenic
1016980383 6:149848360-149848382 TACCTAGTAATGGGATTGCTGGG - Intronic
1017210258 6:151847958-151847980 TACCCAGTAATGGGATAGCTGGG - Intronic
1017217915 6:151931963-151931985 TACCCAGTAATGGGATAGCTGGG + Intronic
1017297723 6:152818064-152818086 TACCCAGTAATGGTATTGCTGGG - Intergenic
1017542837 6:155420837-155420859 TATCTACCAAAGGTATAAATAGG - Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1018015559 6:159709747-159709769 TACCTAGTAATGGGATGGCTGGG - Intronic
1018109018 6:160517542-160517564 TACCTAGCAATGGAATTGCTGGG - Intergenic
1018348368 6:162927282-162927304 TACCCAGCAATGGGATTGCTGGG - Intronic
1018588914 6:165394578-165394600 TACCTAGTAATGGGATTGCTAGG + Intronic
1018934978 6:168268163-168268185 TACCTAGTAATGGGATTGCTGGG + Intergenic
1019203106 6:170335565-170335587 TACCTAGTAATGGGATTGCTGGG + Intronic
1019879997 7:3850487-3850509 TACCCAGTAATGGGATAGCTAGG - Intronic
1019885763 7:3903601-3903623 TACCTAGGAGTGGTATTGCTAGG - Intronic
1020472000 7:8547997-8548019 TACCTACTAGTGGGATTGCTGGG + Intronic
1020490228 7:8773418-8773440 TACCCAGTAATGGGATAGCTGGG + Intergenic
1020871232 7:13631179-13631201 TACCCAGCAATGGGATGGCTGGG + Intergenic
1020980122 7:15056671-15056693 TACCTACTAATGGTACAGACAGG - Intergenic
1021004848 7:15381651-15381673 TACCTAGTAATGGGATTGCTGGG - Intronic
1021216667 7:17924589-17924611 TACCTAGGAATGGAATTGCTGGG - Intronic
1021320123 7:19199318-19199340 TACCCACTAATGGGATGGCTGGG - Intergenic
1021381849 7:19977415-19977437 TACCCAGTAATGGTATTGCTGGG - Intergenic
1021435088 7:20604780-20604802 TACCTAGTAATGGGATGGCTGGG + Intergenic
1021725301 7:23542785-23542807 TACCTAGGAATGGGATTGCTGGG - Intergenic
1021745712 7:23738987-23739009 TACCCAGTAATGGTATTGCTGGG + Intronic
1021748748 7:23773553-23773575 TACCCAGTAATGGTATTGCTGGG + Intronic
1022045841 7:26621604-26621626 TACCTAGTAATGGGATTGCTGGG - Intergenic
1022364626 7:29700074-29700096 TACCCAGTAATGGGATAGCTGGG + Intergenic
1022527177 7:31045715-31045737 TACCCAGCAATGGGATTGCTGGG - Intergenic
1022639983 7:32172989-32173011 TACCCAGCAATGGGATTGCTGGG - Intronic
1022688802 7:32624721-32624743 TACCCAGCAATGGGATTGCTGGG - Intergenic
1022771652 7:33479617-33479639 TACCCAGTAATGGAATAGCTGGG + Intronic
1022875791 7:34527998-34528020 TACCTAGTAATGGGATTGCTGGG + Intergenic
1022906606 7:34863855-34863877 TACCTAGTAATGGGATTGCTGGG - Intronic
1022916428 7:34959344-34959366 TACCCAGCAATGGGATTGCTGGG - Intronic
1022937125 7:35189715-35189737 TACCTAGTAATGGGATGGCTGGG + Intergenic
1022949394 7:35321310-35321332 TAAGTTCCAATGGTAGAGCTTGG - Intergenic
1023066541 7:36383293-36383315 TACCCAGTAATGGTATTGCTGGG - Intronic
1023099695 7:36703820-36703842 TACCCACTAATGGGATTGCTGGG + Intronic
1023497196 7:40810278-40810300 TACCTAGTAATGGGATTGCTAGG + Intronic
1023526152 7:41105996-41106018 TACCTAGTAATGGGATTGCTGGG + Intergenic
1023719024 7:43073829-43073851 TACCTAGTAATGGGATTGCTGGG - Intergenic
1023858122 7:44198272-44198294 TACCTAGTAATGGGATGGCTGGG + Intergenic
1024091667 7:45947927-45947949 TACCTAGTAATGGGATGGCTGGG + Intergenic
1026157740 7:67841904-67841926 TACCCACCAACGGGATTGCTGGG - Intergenic
1026227614 7:68456494-68456516 TACCTAGTAATGGGATTGCTGGG - Intergenic
1026643413 7:72147578-72147600 TACCCAGTAATGGGATAGCTGGG - Intronic
1027923807 7:84433588-84433610 TACCCAGTAATGGTATTGCTGGG + Intronic
1028040842 7:86052447-86052469 TACCTAGTAATGGGATTGCTGGG - Intergenic
1028159614 7:87470848-87470870 TACCTAGTAATGGGATGGCTGGG - Intronic
1028161143 7:87485790-87485812 TACCTAGTAATGGGATTGCTGGG - Intergenic
1028185470 7:87780142-87780164 TACCTAGTAATGGTATTGCTGGG + Intronic
1028211804 7:88082968-88082990 TACCCACTAATGGGATGGCTGGG - Intronic
1028332431 7:89611303-89611325 TACCCAGCAATGGGATTGCTGGG - Intergenic
1028379750 7:90186282-90186304 TACCCAGTAATGGGATAGCTGGG - Intronic
1028471845 7:91214246-91214268 TACCCAGTAATGGGATAGCTGGG + Intergenic
1028691562 7:93658549-93658571 TACCCAGCAATGGGATTGCTGGG + Intronic
1028767969 7:94581886-94581908 TACCCAGCAATGGGATTGCTGGG + Intergenic
1028782403 7:94752122-94752144 TACCTAGTAATGGGATTGCTGGG + Intergenic
1029004682 7:97196166-97196188 TACCTAGTAATGGGATTGCTGGG - Intergenic
1029849709 7:103448874-103448896 TACCTAGTAATGGGATTGCTGGG + Intergenic
1029862833 7:103592541-103592563 TACCTAATAATGGGATTGCTGGG + Intronic
1030178073 7:106675489-106675511 TACCTAGTAATGGGATTGCTGGG - Intergenic
1030185171 7:106754698-106754720 TACCTAGTAATGGGATTGCTGGG - Intergenic
1030242392 7:107342847-107342869 TACCTAATAATGGGATTGCTGGG - Intronic
1030540005 7:110818594-110818616 TACCCAGTAATGGGATAGCTGGG - Intronic
1030593117 7:111505454-111505476 TACCCAGCAATGGGATGGCTGGG - Intronic
1030702413 7:112655958-112655980 TACCTAGTAATGGGATTGCTGGG + Intergenic
1030806479 7:113926208-113926230 TACCCAGTAATGGTATTGCTGGG + Intronic
1030966081 7:115994827-115994849 TACCCAGCAATGGGATGGCTGGG - Intronic
1031052851 7:116962296-116962318 TACCTAGTAATGGGATTGCTTGG + Intronic
1031095537 7:117414993-117415015 TACCTAGTAATGGGATTGCTGGG + Intronic
1031240381 7:119230617-119230639 TACCCAGCAATGGGATGGCTGGG + Intergenic
1031385903 7:121150562-121150584 TACCTAGTAATGGTATTGTTGGG + Intronic
1031495623 7:122444321-122444343 TACCTAGGAATGGAATGGCTGGG + Intronic
1031571776 7:123368270-123368292 TACCTAGTAATGGGATTGCTGGG + Intergenic
1031651690 7:124299208-124299230 TACCTAGTAATGGTATTGCTGGG + Intergenic
1031707180 7:124995932-124995954 TACCTAGTAATGGAATTGCTGGG - Intergenic
1031735332 7:125352627-125352649 TACCCAGTAATGGGATAGCTAGG - Intergenic
1031760788 7:125710886-125710908 TACCCAGTAATGGGATAGCTGGG - Intergenic
1031888612 7:127267424-127267446 TACCTAGTAATGGGATTGCTGGG + Intergenic
1032482772 7:132260138-132260160 TACCTAGTAATGGGATTGCTAGG - Intronic
1032544482 7:132730153-132730175 TACCTACAAAGGGAATGGCTGGG - Intergenic
1032882964 7:136109416-136109438 TACCTAGTAATGGGATTGCTGGG + Intergenic
1033780620 7:144664705-144664727 TACCTAATAATGGAATTGCTAGG - Intronic
1033812645 7:145034228-145034250 TACCCAGTAATGGTATTGCTGGG + Intergenic
1033829591 7:145236054-145236076 TACCCAGTAATGGGATAGCTGGG + Intergenic
1033877300 7:145838216-145838238 TACCTAGTAATGGGATTGCTGGG - Intergenic
1034211677 7:149369048-149369070 TACCCAGTAATGGGATAGCTGGG + Intergenic
1034722532 7:153307813-153307835 TACCTAGTAATGGGATGGCTGGG - Intergenic
1034815115 7:154165517-154165539 TACCTAGTAATGGGATGGCTGGG + Intronic
1035090095 7:156303123-156303145 TACTTACGAATGGAATGGCTGGG - Intergenic
1035144784 7:156803623-156803645 TACCTAGTAATGGGATGGCTGGG - Intronic
1035749734 8:1988242-1988264 TACCCACTAATGGGATGGCTGGG + Intronic
1035905667 8:3507515-3507537 TACCTAGTAATGGGATTGCTGGG + Intronic
1035973191 8:4276101-4276123 TACCCACTAATGGGATTGCTGGG - Intronic
1036046759 8:5151455-5151477 TACCCAGTAATGGTATCGCTGGG + Intergenic
1036995427 8:13649949-13649971 TACCTAGTAATGGGATGGCTGGG + Intergenic
1037029841 8:14091347-14091369 TACCCACAAATGGGATTGCTGGG + Intronic
1038250317 8:25897873-25897895 TACCCAGCAATGGGATTGCTGGG + Intronic
1038331213 8:26610955-26610977 TAGCTAGCCATGGTAGAGCTGGG + Intronic
1038846207 8:31231775-31231797 TACCTAGTAATGGGATTGCTGGG + Intergenic
1039104341 8:33974048-33974070 TACCTAGTAATGGGATTGCTGGG - Intergenic
1039134356 8:34303192-34303214 TACCCAGTAATGGTATTGCTGGG - Intergenic
1039293354 8:36122448-36122470 TACCTAGTAATGGGATTGCTGGG + Intergenic
1039523868 8:38196196-38196218 TACCTAGAAATGGAATTGCTTGG + Intronic
1039657960 8:39430799-39430821 TACATAGCAATGGGATTGCTGGG + Intergenic
1040085760 8:43339115-43339137 TACCCACTAATGGGATTGCTGGG - Intergenic
1040404656 8:47088022-47088044 TACCCAGCAATGGGATGGCTGGG - Intergenic
1040651385 8:49452593-49452615 TACCCAGCAATGGGATGGCTGGG - Intergenic
1040748178 8:50671674-50671696 TACCTAGGAATGGGATTGCTGGG - Intronic
1040777398 8:51062642-51062664 TACCTAGTAATGGGATGGCTGGG - Intergenic
1041039127 8:53828121-53828143 TACCCAACAATGGGATTGCTGGG + Intronic
1041193451 8:55376240-55376262 TACCTAGTAATGGGATTGCTGGG + Intronic
1041363355 8:57074602-57074624 TACCTAGTAATGGGATTGCTGGG + Intergenic
1041426750 8:57729667-57729689 TACCTAGTAATGGGATGGCTGGG + Intergenic
1041624038 8:60004791-60004813 TACCCAGTAATGGGATAGCTGGG - Intergenic
1041766296 8:61421597-61421619 CACTTAGGAATGGTATAGCTGGG - Intronic
1041850877 8:62390555-62390577 TACCCACTAATGGGATTGCTGGG + Intronic
1041951229 8:63505261-63505283 TACCCAGTAATGGGATAGCTGGG + Intergenic
1041987150 8:63935631-63935653 TACCCACTAATGGGATTGCTGGG + Intergenic
1042070300 8:64925834-64925856 TACCCAGTAATGGGATAGCTGGG + Intergenic
1042253616 8:66781139-66781161 TGCCTACAAATGGAAAAGCTTGG + Intronic
1042349006 8:67757341-67757363 TACCCAGCAATGGCATGGCTGGG - Intergenic
1042602023 8:70508046-70508068 TACCCAGCAATGGGATGGCTGGG + Intergenic
1042624887 8:70747268-70747290 TACCCAGTAATGGTATTGCTGGG + Intronic
1042812380 8:72840421-72840443 TACCCAGCAATGGGATTGCTGGG + Intronic
1042813053 8:72846888-72846910 TACCTAGTAATGGGATGGCTGGG - Intronic
1042968806 8:74385698-74385720 TACCTAGTAATGGGATTGCTGGG + Intronic
1042986598 8:74590714-74590736 TACCTAGTAATGGTATTGCTGGG - Intergenic
1043075288 8:75691112-75691134 TACCTAGTAATGGGATTGCTAGG + Intergenic
1043181770 8:77093914-77093936 TACCCACTAATGGGATGGCTGGG - Intergenic
1043248605 8:78038299-78038321 TACCCAACAATGGGATTGCTGGG + Intergenic
1043309164 8:78836879-78836901 TACCCAGTAATGGTATTGCTTGG - Intergenic
1043322016 8:78999150-78999172 TACCCAGCAATGGGATTGCTGGG + Intergenic
1043462331 8:80472852-80472874 TACCTAGTAATGGGATGGCTGGG + Intergenic
1043716537 8:83494184-83494206 TACCCAGTAATGGGATAGCTAGG + Intergenic
1043744520 8:83856646-83856668 TACCTAGCAGTGGGATTGCTGGG - Intergenic
1043761061 8:84068874-84068896 TACCTAGTAATGGGATTGCTGGG + Intergenic
1043859532 8:85299916-85299938 TACCTAGTAATGGGATTGCTGGG - Intergenic
1044175403 8:89114662-89114684 TACCTAGTAATGGGATTGCTGGG - Intergenic
1044186362 8:89256514-89256536 TACCTAGTAATGGGATTGCTGGG - Intergenic
1044202861 8:89457049-89457071 TACATACCATTGATATAACTAGG - Intergenic
1044428688 8:92083729-92083751 TACCCAGCAATGGGATTGCTGGG - Intronic
1044745902 8:95370592-95370614 TACCCAGTAATGGGATAGCTGGG + Intergenic
1044770752 8:95629367-95629389 TACCTAAAAATGGAATTGCTTGG + Intergenic
1044939160 8:97322800-97322822 TACCTAGTAATGGGATGGCTGGG + Intergenic
1045083684 8:98655965-98655987 TACCCAGTAATGGGATAGCTGGG - Intronic
1045084230 8:98663501-98663523 TACCCAGCAATGGGATGGCTGGG - Intronic
1045554259 8:103200329-103200351 TACCTAGTAATGGGATTGCTGGG - Intronic
1045916329 8:107476065-107476087 TACCCAGTAATGGGATAGCTGGG - Intronic
1045923050 8:107555045-107555067 TACCCAGTAATGGGATAGCTGGG - Intergenic
1046093654 8:109533042-109533064 GAGCTACTAATGGTAAAGCTGGG + Intergenic
1046148720 8:110195216-110195238 TACCTAGTAATGGGATGGCTGGG + Intergenic
1046150927 8:110224048-110224070 TACCCAGTAATGGTATTGCTGGG + Intergenic
1046280489 8:112022711-112022733 TACCTACAAGTGGGATTGCTGGG - Intergenic
1046311587 8:112444335-112444357 TACCTACGAATGAAATTGCTGGG - Intronic
1046346057 8:112928798-112928820 TACCCACTAATGGCATGGCTGGG + Intronic
1046433335 8:114155984-114156006 TACCCAGCAATGGGATTGCTGGG - Intergenic
1046449480 8:114370111-114370133 TACCTAATAATGGGATTGCTGGG - Intergenic
1046469609 8:114653540-114653562 TACCAAGTAATGGGATAGCTGGG + Intergenic
1046488803 8:114920029-114920051 TACCCAACAATGGGATTGCTGGG - Intergenic
1046520501 8:115319183-115319205 TACCCAGTAATGGGATAGCTGGG + Intergenic
1046684768 8:117212939-117212961 TACCTAGTAATGGGATTGCTGGG - Intergenic
1046716307 8:117571374-117571396 TACCTAGTAATGGGATTGCTGGG + Intergenic
1046947141 8:119984779-119984801 TACCTAGTAATGGGATTGCTGGG + Intronic
1046989075 8:120428975-120428997 TACCTAGGAATGGGATTGCTGGG - Intronic
1047571684 8:126105596-126105618 TACCCAGTAATGGTATTGCTGGG + Intergenic
1047575896 8:126154969-126154991 TACCTACTAATGGGATTGCTAGG - Intergenic
1047642629 8:126836640-126836662 TACCCAGCAATGGGATTGCTGGG + Intergenic
1047918294 8:129605897-129605919 TACCCAGCAATGGAATGGCTGGG + Intergenic
1048587203 8:135785359-135785381 TACCTAGTAATGGAATAGCTGGG + Intergenic
1048684615 8:136890140-136890162 TACCTAGTAATGGGATGGCTGGG + Intergenic
1048858959 8:138709268-138709290 TACCTAGAAATGGGATGGCTGGG - Intronic
1050010182 9:1178138-1178160 TACCCAGCAATGGGATTGCTGGG - Intergenic
1050294043 9:4186509-4186531 TACCCACTAATGGGATGGCTGGG + Intronic
1050393677 9:5173247-5173269 TACCCAATAATGGTATTGCTGGG - Intronic
1050397566 9:5215502-5215524 TACCTAGTAATGGGATTGCTGGG - Intergenic
1050445033 9:5712086-5712108 TACCTAGTAATGGGATTGCTGGG + Intronic
1050956301 9:11665773-11665795 TACCCAGTAATGGGATAGCTGGG + Intergenic
1051005761 9:12341746-12341768 TACCCACTAATGGGATGGCTGGG - Intergenic
1051030134 9:12664601-12664623 TACCTAGCAGTGGAATTGCTGGG - Intergenic
1051145180 9:14019727-14019749 TACCCAGCAATGGGATTGCTGGG + Intergenic
1051294586 9:15582410-15582432 TACCCAGCAATGGGATGGCTGGG - Intronic
1051296698 9:15603763-15603785 TACCTATTAATGGGATTGCTGGG + Intronic
1051328013 9:15994068-15994090 TACATAGCAATGGGATGGCTGGG - Intronic
1051489152 9:17641951-17641973 TACCCACTAATGGGATTGCTGGG + Intronic
1051660102 9:19418327-19418349 TACCTAGTAATGGCATTGCTGGG - Intronic
1051702965 9:19844036-19844058 TACCCAGTAATGGTATTGCTAGG + Intergenic
1051708801 9:19908962-19908984 TACCTAGTAATGGGATGGCTGGG - Intergenic
1051788003 9:20767335-20767357 TACCCAGTAATGGGATAGCTGGG + Intronic
1052151528 9:25122897-25122919 TACCTAGTAATGGGATTGCTGGG + Intergenic
1052224797 9:26072637-26072659 TACCCACTAATGGGATTGCTGGG + Intergenic
1052295050 9:26888726-26888748 TATCTAGCAATGGAATTGCTGGG - Intronic
1052335747 9:27318199-27318221 TACCTAGTAATGGGATTGCTGGG + Intergenic
1052501242 9:29293029-29293051 TACCCAACAATGGGATTGCTAGG + Intergenic
1052596885 9:30572933-30572955 TACCTAGTAATGGGATTGCTGGG - Intergenic
1052709805 9:32039817-32039839 TACCTAGTAATGGGATTGCTGGG - Intergenic
1052722597 9:32190483-32190505 TACCCAGTAATGGGATAGCTGGG - Intergenic
1052724395 9:32212340-32212362 TACCCAGTAATGGGATAGCTGGG + Intergenic
1052766131 9:32643033-32643055 TACCCAGTAATGGGATAGCTGGG + Intergenic
1053049649 9:34949479-34949501 TACCCAGCAATGGGATTGCTGGG - Intergenic
1053086506 9:35227918-35227940 TACATACCAATGTTAGAACTAGG - Intronic
1053522429 9:38793519-38793541 TACCCAGTAATGGTATTGCTGGG + Intergenic
1053554807 9:39124988-39125010 TACCTAGTAATGGGATGGCTGGG - Intronic
1053608842 9:39689581-39689603 TACCTAGTAATGGGATTGCTGGG - Intergenic
1053704783 9:40740004-40740026 TACCTAGGAATGGAATTGCTGGG - Intergenic
1053847616 9:42255782-42255804 TACCTAGTAATGGGATGGCTGGG - Intergenic
1053866688 9:42445846-42445868 TACCTAGTAATGGGATTGCTGGG - Intergenic
1053929413 9:43100841-43100863 TACCTAGTAATGGGATTGCTGGG - Intergenic
1054194658 9:62017941-62017963 TACCCAGTAATGGTATCGCTGGG + Intergenic
1054244681 9:62652817-62652839 TACCTAGTAATGGGATTGCTGGG + Intergenic
1054284298 9:63152447-63152469 TACCTAGTAATGGGATTGCTGGG + Intergenic
1054292500 9:63308034-63308056 TACCTAGTAATGGGATTGCTGGG - Intergenic
1054390520 9:64612508-64612530 TACCTAGTAATGGGATTGCTGGG - Intergenic
1054414862 9:64863612-64863634 TACCTAGGAATGGAATTGCTGGG - Intergenic
1054505199 9:65903799-65903821 TACCTAGTAATGGGATTGCTGGG + Intergenic
1054558808 9:66687360-66687382 TACCTAGTAATGGGATTGCTGGG + Intergenic
1054643750 9:67570749-67570771 TACCCAGTAATGGTATCGCTGGG - Intergenic
1054836518 9:69680558-69680580 TACCTAGTAATGGGATGGCTGGG + Intergenic
1055148216 9:72961994-72962016 TACCCAGCAATGGGATGGCTGGG - Intronic
1055380506 9:75701610-75701632 TACCCAGTAATGGTATGGCTGGG + Intergenic
1055458928 9:76498332-76498354 TACCTAATAGTGGAATAGCTAGG + Intronic
1055784215 9:79854936-79854958 TACCCAGTAATGGGATAGCTGGG - Intergenic
1055866743 9:80823427-80823449 TACCTAGTAATGGCATTGCTGGG - Intergenic
1056289855 9:85132265-85132287 TACCTAGTAATGGGATCGCTGGG - Intergenic
1056485259 9:87050234-87050256 TACCTGGTAATGGGATAGCTGGG + Intergenic
1056720199 9:89064720-89064742 TACCCTCCAATGCTATACCTTGG - Intronic
1057338160 9:94173864-94173886 TACCTAGAAATGGAATTGCTGGG + Intergenic
1057752077 9:97801192-97801214 TACCTAGGAATGGAATTGCTGGG - Intergenic
1058120140 9:101129344-101129366 TATCTAGCAATGGAATGGCTGGG - Intronic
1058182178 9:101811573-101811595 TACCTAGTAATGGAATTGCTGGG + Intergenic
1058635507 9:107034440-107034462 TACCCAGCAATGGGATTGCTGGG + Intergenic
1058912796 9:109536359-109536381 TACCTACAAATGGAGTTGCTGGG + Intergenic
1059028123 9:110659181-110659203 TACCCAGTAATGGGATAGCTGGG - Intergenic
1059126908 9:111697702-111697724 TACCCAGTAATGGTATGGCTGGG + Intronic
1059258376 9:112951962-112951984 TACCTAGTAATGGGATTGCTGGG + Intergenic
1059265943 9:113030725-113030747 TACCCAGTAATGGGATAGCTGGG - Intergenic
1059454246 9:114389598-114389620 TGCCTACCAAGGGTAGAGCGGGG + Intronic
1059912724 9:119063936-119063958 TACCCAGTAATGGGATAGCTGGG + Intergenic
1059966520 9:119619877-119619899 TACCCAGCAATGGGATTGCTGGG + Intergenic
1060683650 9:125588045-125588067 TACCTAGGAATGGAATCGCTTGG - Intronic
1061646889 9:132010512-132010534 TACCCAGCAATGGGATGGCTGGG - Intronic
1061978156 9:134083484-134083506 TACCTAGGAATGGAATTGCTGGG - Intergenic
1061992809 9:134169218-134169240 TACATACCTATGATAAAGCTAGG + Intergenic
1203690734 Un_GL000214v1:40012-40034 TACCCACTAATGGGATGGCTGGG + Intergenic
1203444174 Un_GL000219v1:39602-39624 TACCTAGTAATGGGATGGCTGGG - Intergenic
1203381566 Un_KI270435v1:52762-52784 TACCCAGCAATGGGATGGCTGGG - Intergenic
1203400966 Un_KI270519v1:96908-96930 TACCCAGCAATGGGATGGCTGGG - Intergenic
1203717116 Un_KI270742v1:163574-163596 TACCCAGCAATGGGATGGCTGGG + Intergenic
1203539725 Un_KI270743v1:76694-76716 TACCCACTAATGGGATGGCTGGG + Intergenic
1203645561 Un_KI270751v1:64179-64201 TACCCACTAATGGGATGGCTGGG - Intergenic
1203651344 Un_KI270751v1:127161-127183 TACCCAGCAATGGGATGGCTGGG + Intergenic
1185479348 X:434506-434528 TACCCAGCAATGGGATGGCTGGG - Intergenic
1185711216 X:2304835-2304857 TACCTAGTAATGGGATTGCTGGG - Intronic
1185760642 X:2687876-2687898 TACCTAGTAATGGGATTGCTGGG - Intergenic
1185920075 X:4081640-4081662 TACCCACTAATGGGATTGCTGGG + Intergenic
1185984144 X:4811647-4811669 TTCCTAGTAATGGTATTGCTGGG + Intergenic
1186134881 X:6508657-6508679 TACCCAGTAATGGGATAGCTGGG - Intergenic
1186158123 X:6746927-6746949 TACCTAGTAATGGGATTGCTGGG + Intergenic
1186391743 X:9167290-9167312 TACCTAGGAGTGGTATTGCTGGG - Intergenic
1186667004 X:11727359-11727381 TACCTAGTAATGGGATTGCTGGG + Intergenic
1186678044 X:11841257-11841279 TACCCACTAATGGGATGGCTGGG + Intergenic
1186678607 X:11847512-11847534 TACCCACTAATGGGATGGCTGGG - Intergenic
1186810786 X:13186614-13186636 TACCCAATAATGGGATAGCTGGG - Intergenic
1187289221 X:17936348-17936370 TACCCAACAATGGGATTGCTGGG + Intergenic
1187382304 X:18814352-18814374 TACCTAGTAATGGGATTGCTGGG + Intronic
1187430358 X:19218327-19218349 TACCTAGGAATGGGATTGCTGGG + Intergenic
1187431648 X:19230260-19230282 TACCTAGTAATGGGATTGCTGGG + Intergenic
1187463846 X:19511798-19511820 TACCCAGCAATGGGATTGCTGGG - Intronic
1187553759 X:20331783-20331805 TACCTAGGAATGGAATTGCTGGG + Intergenic
1187960998 X:24565850-24565872 TACCTACAAATGATAGATCTCGG + Intronic
1188017100 X:25117653-25117675 TACCCAGCAATGGGATCGCTGGG + Intergenic
1188234989 X:27717244-27717266 TACCCAGTAATGGGATAGCTGGG + Intronic
1188270143 X:28128900-28128922 TACCCAGCAATGGGATTGCTGGG + Intergenic
1188414536 X:29916260-29916282 TACCCAGTAATGGGATAGCTGGG + Intronic
1188480661 X:30634062-30634084 TACCCAGCAATGGGATTGCTGGG - Intergenic
1188579331 X:31690598-31690620 TACCCAGTAATGGGATAGCTGGG - Intronic
1188717805 X:33482059-33482081 TACCCAGCAATGGGATTGCTAGG - Intergenic
1188770966 X:34153838-34153860 TACCCAGTAATGGGATAGCTGGG + Intergenic
1188792448 X:34420639-34420661 TACCCAGTAATGGGATAGCTGGG - Intergenic
1188796739 X:34476050-34476072 TACCCAGTAATGGGATAGCTGGG + Intergenic
1188810528 X:34649181-34649203 TACCTAGTAATGGGATTGCTGGG - Intronic
1189154595 X:38744440-38744462 TACCTAGTAATGGGATTGCTGGG - Intergenic
1189162506 X:38824710-38824732 CACCTACAAATGGAATTGCTGGG - Intergenic
1189209423 X:39271612-39271634 TACCCAATAATGGTATTGCTGGG + Intergenic
1189582801 X:42425370-42425392 TACCCAGCAATGGGATGGCTGGG + Intergenic
1189649342 X:43172587-43172609 TACCTAGTAATGGGATGGCTGGG - Intergenic
1189714368 X:43850138-43850160 CACCTAGCAATGGCAGAGCTAGG + Intronic
1189750723 X:44218819-44218841 TACCTAGGAATGGAATTGCTGGG - Intronic
1190513754 X:51201734-51201756 TACCTAGTAATGGGATTGCTGGG - Intergenic
1190515263 X:51217189-51217211 TACCCAATAATGGTATTGCTGGG + Intergenic
1190518360 X:51248757-51248779 TACCCAGCAATGGGATGGCTTGG - Intergenic
1190535931 X:51427959-51427981 TACCCAGCAATGGGATGGCTGGG + Intergenic
1190540063 X:51468115-51468137 TACCCAGTAATGGGATAGCTGGG - Intergenic
1190578964 X:51871785-51871807 TACCTAGTAATGGGATGGCTGGG + Intronic
1190900105 X:54663560-54663582 TACCTAGGAATGGAATTGCTTGG + Intergenic
1190930177 X:54941873-54941895 TACCCAGTAATGGGATAGCTGGG - Intronic
1191049167 X:56172616-56172638 TACCCAGTAATGGGATAGCTGGG + Intergenic
1191061890 X:56306944-56306966 TACCCAGCAATGGGATTGCTGGG + Intergenic
1191165385 X:57384805-57384827 TACCCACTAATGGGATGGCTGGG - Intronic
1191199971 X:57769982-57770004 TACCCAGTAATGGGATAGCTGGG + Intergenic
1191598864 X:62980332-62980354 TACCTAGTAATGGGATTGCTGGG + Intergenic
1191605928 X:63062794-63062816 TACCTAGTAATGGGATGGCTGGG - Intergenic
1191606651 X:63070000-63070022 TACCCACTAATGGGATTGCTAGG - Intergenic
1191850828 X:65584817-65584839 TACCCAGCAATGGGATTGCTGGG + Intergenic
1191890474 X:65934784-65934806 TACCCAGTAATGGGATAGCTGGG + Intergenic
1191906466 X:66096478-66096500 TACCTAGTAATGGGATTGCTGGG - Intergenic
1191939197 X:66459462-66459484 TACCCAGCAATGGGATGGCTGGG - Intergenic
1192000298 X:67142750-67142772 TACCTAGTAATGGGATTGCTGGG - Intergenic
1192028630 X:67484730-67484752 TACCCACTAATGGGATTGCTGGG - Intergenic
1192054756 X:67761612-67761634 TACCTAGTAATGGGATGGCTGGG + Intergenic
1192281112 X:69686936-69686958 TACCTACAAGTGGAATTGCTGGG + Intronic
1192345894 X:70305111-70305133 TACCTAGGAATGGAATTGCTAGG + Intronic
1192379261 X:70598489-70598511 TACCTAGGATTGGTATTGCTGGG - Intronic
1192394142 X:70761240-70761262 TACCCACTAATGGGATGGCTGGG - Intronic
1192565775 X:72162280-72162302 TACCTAGGAATGGAATTGCTGGG - Intergenic
1192613411 X:72591042-72591064 TACCTAGTAATGGGATTGCTGGG - Intronic
1192663330 X:73065291-73065313 TACCCAGCAATGGGATGGCTGGG - Intergenic
1192916649 X:75658580-75658602 TACCCAGCAATGGAATTGCTGGG - Intergenic
1192919423 X:75690676-75690698 TACCCAGTAATGGGATAGCTGGG + Intergenic
1192964692 X:76164961-76164983 TACCCAGTAATGGTATTGCTGGG - Intergenic
1193003837 X:76593015-76593037 TACCTAGTAATGGGATTGCTGGG + Intergenic
1193047919 X:77071740-77071762 TACCTAGTAATGGAATTGCTGGG + Intergenic
1193189915 X:78558331-78558353 TACCTAGTAATTGTATTGCTGGG + Intergenic
1193200954 X:78689965-78689987 TACCCAGTAATGGGATAGCTGGG + Intergenic
1193259205 X:79385698-79385720 TACCTAGTAATGGGATTGCTGGG - Intergenic
1193260270 X:79398269-79398291 TACCTAGTAATGGGATTGCTGGG - Intergenic
1193315568 X:80061058-80061080 TACCTAGTAATGGGATGGCTGGG + Intergenic
1193329619 X:80221838-80221860 TACCTAATAATGGGATTGCTGGG - Intergenic
1193340817 X:80347188-80347210 TACCCAGTAATGGTATTGCTGGG + Intronic
1193341981 X:80359280-80359302 TACCTAGTAATGGGATTGCTGGG - Intronic
1193392214 X:80942168-80942190 TACCTAGTAATGGGATGGCTGGG - Intergenic
1193425901 X:81340392-81340414 TACCCACTAATGGGATGGCTGGG + Intergenic
1193476406 X:81971818-81971840 TACCCAGCAATGGGATGGCTGGG + Intergenic
1193555588 X:82950166-82950188 TACCCACTAATGGGATTGCTGGG - Intergenic
1193565699 X:83074002-83074024 TACCCAGCAATGGGATTGCTGGG + Intergenic
1193727368 X:85058585-85058607 TACCTAGTAATGGGATTGCTGGG + Intronic
1193733371 X:85128157-85128179 TACCCAGTAATGGGATAGCTGGG + Intergenic
1193755342 X:85402524-85402546 TACCCACTAATGGGATTGCTGGG + Intergenic
1193856341 X:86608397-86608419 TACCTAGTAATGGGATGGCTGGG - Intronic
1193869282 X:86777098-86777120 TACCCAGCAATGGGATGGCTGGG + Intronic
1193909852 X:87290481-87290503 TACCCAATAATGGGATAGCTGGG + Intergenic
1193987690 X:88266218-88266240 TACCTAGTAATGGGATTGCTAGG - Intergenic
1194008977 X:88534861-88534883 TACCCAGCAATGGGATGGCTGGG + Intergenic
1194028340 X:88781925-88781947 TACCCACTAATGGGATGGCTGGG + Intergenic
1194050543 X:89062262-89062284 TACCCAGCAATGGGATGGCTGGG - Intergenic
1194182521 X:90731398-90731420 TACCTAGTAATGGGATCGCTGGG - Intergenic
1194213743 X:91101413-91101435 TACCTAGTAATGGGATTGCTGGG + Intergenic
1194259323 X:91674459-91674481 TACCTAGTAATGGGATGGCTGGG + Intergenic
1194388407 X:93286495-93286517 TACCTACTAATGCTCTAGTTTGG - Intergenic
1194487429 X:94502630-94502652 TACCCAGCAATGGGATTGCTAGG + Intergenic
1194493698 X:94582216-94582238 TACCTAATAATGGGATTGCTGGG - Intergenic
1194536681 X:95113858-95113880 TACCTAGTAATGGTATTGCTGGG + Intergenic
1194561241 X:95423684-95423706 TACCTAGTAATGGGATTGCTGGG - Intergenic
1194790817 X:98147140-98147162 TACCTAGTAATGGGATTGCTGGG + Intergenic
1194805640 X:98324159-98324181 TACCTAGCAATGTGATTGCTGGG - Intergenic
1194989155 X:100526664-100526686 TACCTAGCAAAGGAATTGCTGGG + Intergenic
1195230080 X:102838059-102838081 TACCTAGGAATGGAATTGCTGGG + Intergenic
1195261561 X:103137014-103137036 TACCCAGCAATGGGATGGCTGGG - Intergenic
1195309134 X:103613715-103613737 TACCTAGGAATGGAATTGCTGGG - Intronic
1195593182 X:106655852-106655874 TACCTAGAAATGGGATGGCTGGG + Intronic
1195660872 X:107376558-107376580 TACCCAGTAATGGTATTGCTGGG + Intergenic
1195851187 X:109283387-109283409 TACCTAGGAATGGAATTGCTGGG + Intergenic
1195981832 X:110586857-110586879 TACCTAGGAGTGGTATTGCTGGG - Intergenic
1196012038 X:110898905-110898927 TACCCAGTAATGGTATTGCTGGG + Intergenic
1196091306 X:111746696-111746718 TACCTAGCAGTGGAATTGCTGGG + Intronic
1196183811 X:112724107-112724129 TACCTAGTAATGGGATGGCTGGG - Intergenic
1196216845 X:113062759-113062781 TACCTAGTAATGGGATTGCTGGG + Intergenic
1196238921 X:113317327-113317349 TACCTAAAAATGGGATTGCTGGG + Intergenic
1196259917 X:113566697-113566719 TACCTAGTAATGGGATGGCTGGG - Intergenic
1196262679 X:113603062-113603084 TACCTACTAGTGGAATTGCTGGG - Intergenic
1196361772 X:114869352-114869374 TACCCAGTAATGGTATTGCTGGG + Intronic
1197184145 X:123568026-123568048 TACCTAGTAATGGGATTGCTGGG - Intergenic
1197185288 X:123579430-123579452 TACCTAGTAATGGGATTGCTGGG - Intergenic
1197322462 X:125049546-125049568 TACCTATGAATGGAATTGCTGGG + Intergenic
1197323517 X:125063790-125063812 TACCTAGTAATGGGATGGCTGGG - Intergenic
1197349334 X:125363807-125363829 TACCTAGTAATGGGATTGCTGGG + Intergenic
1197357204 X:125450191-125450213 TACCCAGCAATGGGATTGCTAGG - Intergenic
1197409993 X:126104636-126104658 TACCCAGTAATGGTATGGCTGGG + Intergenic
1197421522 X:126241181-126241203 TACCCAGCAATGGGATGGCTGGG + Intergenic
1197428724 X:126331490-126331512 TACCCAGCAATGGGATTGCTGGG + Intergenic
1197488357 X:127083345-127083367 TACCCACTAATGGGATGGCTGGG - Intergenic
1197514140 X:127402998-127403020 TACCCACTAATGGGATTGCTGGG - Intergenic
1197530116 X:127612963-127612985 TACCCAGCAATGGGATGGCTGGG - Intergenic
1197589599 X:128392137-128392159 TACCCAGTAATGGTATTGCTGGG - Intergenic
1197598674 X:128499734-128499756 TACCCACTAATGGGATTGCTAGG + Intergenic
1197605063 X:128575888-128575910 TACCCAGTAATGGGATAGCTGGG - Intergenic
1197646542 X:129024105-129024127 TACCCAGTAATGGGATAGCTGGG - Intergenic
1197654032 X:129096830-129096852 TACCTAAGAATGGAATTGCTAGG + Intergenic
1197689444 X:129481811-129481833 TACCTAGTAATGGGATGGCTGGG - Intronic
1197813496 X:130472469-130472491 TACCTAGTAATGGGATTGCTTGG - Intergenic
1197909639 X:131466777-131466799 TACCCAGCAATGGGATGGCTGGG - Intergenic
1198001748 X:132446306-132446328 TACCTAGTAATGGGATTGCTGGG + Intronic
1198094392 X:133364291-133364313 TACCTAGCAATGGAATTGCTTGG + Intronic
1198200338 X:134410151-134410173 TACCCAGTAATGGTATTGCTGGG + Intronic
1198338966 X:135694776-135694798 TACCTAGTAATGGGATTGCTGGG + Intergenic
1198488416 X:137111912-137111934 TACCTAGTAATGGGATGGCTGGG + Intergenic
1198543958 X:137671672-137671694 TACCCACTAATGGGATTGCTGGG + Intergenic
1198549490 X:137729742-137729764 TACCTAGTAATGGGATTGCTGGG + Intergenic
1198560399 X:137843641-137843663 TACCCAGTAATGGGATAGCTGGG + Intergenic
1198564022 X:137884830-137884852 TACCTAGTAATGGGATTGCTGGG - Intergenic
1198629562 X:138619946-138619968 TACCTAGTAATGGGATTGCTGGG - Intergenic
1198658423 X:138939930-138939952 TACCCAACAATGGAATTGCTGGG + Intronic
1198769383 X:140112954-140112976 TACCTAGGAATGGAATTGCTGGG + Intergenic
1198833518 X:140776771-140776793 TACCTAGTAATGGGATTGCTGGG - Intergenic
1199080026 X:143566816-143566838 TACCTAGTAATGGGATTGCTGGG - Intergenic
1199311167 X:146321328-146321350 TACCCAGCAATGGGATTGCTGGG - Intergenic
1199469043 X:148173190-148173212 TACCCAGCAATGGGATGGCTGGG - Intergenic
1199505775 X:148559787-148559809 TACCTAGTAATGGGATTGCTGGG + Intronic
1199658452 X:150022244-150022266 TACCCAGCAATGGGATGGCTGGG - Intergenic
1199703356 X:150402552-150402574 TACCCAGTAATGGGATAGCTGGG - Intronic
1199724030 X:150564766-150564788 TACCTAGGAATAGTATTGCTCGG + Intergenic
1199739806 X:150724092-150724114 TACCTAGTAATGGGATTGCTGGG + Intronic
1199824091 X:151480348-151480370 TACCCAGTAATGGGATAGCTGGG - Intergenic
1199829345 X:151533826-151533848 TACCTAGGAATGGAATTGCTGGG + Intergenic
1200001298 X:153061710-153061732 TACCTAGGAATGGAATGGCTGGG + Intergenic
1200299963 X:154963562-154963584 TACCTAGTAATGGGATGGCTGGG + Intronic
1200378330 X:155807736-155807758 TACCCAGTAATGGTATTGCTGGG + Intergenic
1200386709 X:155899152-155899174 TACCTAGGAATGGAATTGCTGGG + Intronic
1200460535 Y:3449032-3449054 TACCTAGTAATGGGATGGCTGGG - Intergenic
1200689934 Y:6297055-6297077 TACCCAGTAATGGGATAGCTGGG - Intergenic
1200879605 Y:8199056-8199078 TACCCAGTAATGGGATAGCTGGG - Intergenic
1200889322 Y:8306209-8306231 TACCCAGTAATGGTATGGCTGGG + Intergenic
1200955751 Y:8943551-8943573 TACCTAGTAATGGGATGGCTGGG + Intergenic
1201013717 Y:9576246-9576268 TACCCAGTAATGGGATAGCTGGG - Intergenic
1201045339 Y:9877665-9877687 TACCCAGTAATGGGATAGCTGGG + Intergenic
1201055688 Y:9988236-9988258 TACCTAGTAATGGGATTGCTGGG - Intergenic
1201258191 Y:12130711-12130733 TACCCAGTAATGGGATAGCTGGG - Intergenic
1201398499 Y:13576260-13576282 TACCTAGTAATGGGATTGCTGGG - Intergenic
1201498324 Y:14613948-14613970 TACCTAGTAATGGGATTGCTGGG + Intronic
1201521716 Y:14882733-14882755 TACCCAGTAATGGGATAGCTGGG + Intergenic
1201623787 Y:15990055-15990077 TACCCACTAATGGGATTGCTGGG - Intergenic
1201625275 Y:16007899-16007921 TACCTAGTAATGGGATGGCTGGG + Intergenic
1201689540 Y:16747625-16747647 TACCTAATAATGGGATTGCTGGG + Intergenic
1201768104 Y:17591975-17591997 TACCTAGTAATGGGATGGCTGGG - Intergenic
1201833449 Y:18314010-18314032 TACCTAGTAATGGGATGGCTGGG + Intergenic
1202022717 Y:20482673-20482695 TACCCAGTAATGGTATGGCTGGG - Intergenic
1202077170 Y:21048263-21048285 TACCCAGTAATGGGATAGCTGGG + Intergenic
1202090923 Y:21188579-21188601 TACCTAGTAATGGGATTGCTCGG + Intergenic
1202108981 Y:21402375-21402397 TACCTAGTAATGGGATGGCTGGG - Intergenic
1202625632 Y:56854704-56854726 TACCTAGTAATGGGATGGCTGGG - Intergenic