ID: 1106052182

View in Genome Browser
Species Human (GRCh38)
Location 13:26201898-26201920
Sequence CTTCCAAGCAGATCCACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106052182_1106052187 23 Left 1106052182 13:26201898-26201920 CCAGCTGTGGATCTGCTTGGAAG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1106052187 13:26201944-26201966 ATTATGGGGACCACAAAAAGAGG 0: 1
1: 0
2: 1
3: 14
4: 145
1106052182_1106052184 7 Left 1106052182 13:26201898-26201920 CCAGCTGTGGATCTGCTTGGAAG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1106052184 13:26201928-26201950 GACTAACTTCTTATTCATTATGG 0: 1
1: 0
2: 1
3: 10
4: 154
1106052182_1106052185 8 Left 1106052182 13:26201898-26201920 CCAGCTGTGGATCTGCTTGGAAG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1106052185 13:26201929-26201951 ACTAACTTCTTATTCATTATGGG 0: 1
1: 0
2: 2
3: 32
4: 264
1106052182_1106052186 9 Left 1106052182 13:26201898-26201920 CCAGCTGTGGATCTGCTTGGAAG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1106052186 13:26201930-26201952 CTAACTTCTTATTCATTATGGGG 0: 1
1: 0
2: 3
3: 17
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106052182 Original CRISPR CTTCCAAGCAGATCCACAGC TGG (reversed) Intronic
900405772 1:2492379-2492401 CTGCCCAGCAGAGCCACAGATGG - Intronic
900698176 1:4025911-4025933 CTTCCCAGCAGAGGAACAGCCGG + Intergenic
900975358 1:6012970-6012992 CCTCCAAGGGGATCCACAGTGGG - Intronic
903010024 1:20323238-20323260 CTTCCATGCAGAGCCTGAGCAGG + Intronic
904326434 1:29729649-29729671 CTTCCAGGCAGCGCCAGAGCTGG - Intergenic
904336814 1:29803237-29803259 CTTGCAACCACATTCACAGCAGG + Intergenic
906146635 1:43564484-43564506 CATGCAAGCAGATCCAGAGGCGG - Intronic
910533406 1:88267712-88267734 CTGCCAAGAAGAACCAGAGCTGG - Intergenic
912851003 1:113124380-113124402 CTGACAAGCAGATGCACACCAGG - Exonic
914676507 1:149910660-149910682 CTGCCTACCAGTTCCACAGCTGG - Exonic
916712709 1:167425780-167425802 CTTCCAAGCAGTTCCAGTACAGG - Exonic
916735327 1:167602253-167602275 CTTCCTGGCGGAACCACAGCAGG - Intergenic
921166666 1:212513057-212513079 GGTCTAAGCAGATCCACTGCAGG + Intergenic
921230116 1:213061453-213061475 CTTCCCTGCAGAGCCACAGGTGG - Intronic
923034318 1:230273555-230273577 GTTCCAGGCAGGGCCACAGCAGG - Intronic
1064487381 10:15808351-15808373 CTTCCAAGAAAATTCACAGTTGG - Intronic
1068349631 10:55825602-55825624 TTCCCAAGCAGATACCCAGCAGG - Intergenic
1069548462 10:69345587-69345609 CTCCCAAGCAAAGCCAAAGCAGG - Intronic
1070719594 10:78746919-78746941 GTTCCAACCAGATCCAAAGAAGG + Intergenic
1071485679 10:86100850-86100872 CTGGCAAACAGACCCACAGCTGG + Intronic
1073084983 10:100882592-100882614 CTCCCCAGCAGAGCCATAGCTGG - Intergenic
1073578848 10:104645577-104645599 ATTCCAAGCAGATACACTGCAGG - Intronic
1074823241 10:117197231-117197253 CTTCCAGGCAGCTCCAGGGCCGG + Intergenic
1076741797 10:132489270-132489292 CGTCCAGGCAGATGCCCAGCAGG + Intergenic
1077386748 11:2272840-2272862 CGTCCAAGCCCCTCCACAGCTGG + Intergenic
1077929869 11:6720004-6720026 CTTCCAGTCAGATTCAGAGCAGG - Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1083400388 11:62419242-62419264 CCTCCCAGCAGCTCCAGAGCAGG - Intronic
1083655530 11:64227378-64227400 CTTCAAAGGAGATACACAGGGGG - Intronic
1084510470 11:69600533-69600555 CGTCCAAGCAGAATCAAAGCTGG + Intergenic
1085750589 11:79157632-79157654 GTTCCAGGCAGACACACAGCAGG - Intronic
1087650388 11:100860447-100860469 CTGTCAAGCAGAACCACAGAAGG - Intronic
1091949791 12:4583322-4583344 ATTCCAAGCAGAAACAGAGCAGG - Intronic
1096556567 12:52407630-52407652 CTGCCATGCTGCTCCACAGCAGG + Intergenic
1100350420 12:93775843-93775865 CTTCCCAGCTGATTCACAGTAGG + Intronic
1100356106 12:93831477-93831499 CTGCCATGCAGATTCACAGATGG - Intronic
1101533076 12:105592481-105592503 CTTCCAGGCAAATGGACAGCTGG + Intergenic
1104088802 12:125497169-125497191 CTTCCACGTAGGTCAACAGCAGG - Intronic
1104586993 12:130055660-130055682 CTTCAGAGCAGATCCTGAGCTGG + Intergenic
1104881658 12:132075545-132075567 TTTCCCAGCAGTTCCACAGGGGG + Intronic
1106052182 13:26201898-26201920 CTTCCAAGCAGATCCACAGCTGG - Intronic
1107014282 13:35696110-35696132 CTTCAAAGGAGAACCACTGCAGG + Intergenic
1108228817 13:48317533-48317555 CTGCCCAGCAGTGCCACAGCGGG - Intronic
1112505548 13:99972554-99972576 CTTCCAATTAGATCTACAGTAGG + Intergenic
1122549420 14:102541930-102541952 CTTCCAAGCTCACCCACAGGGGG + Intergenic
1123766177 15:23480563-23480585 GGACCAAGCAGATTCACAGCAGG - Intergenic
1124214868 15:27797913-27797935 CTTCCCAGCAGAGCCATTGCAGG - Intronic
1128038666 15:64550249-64550271 CTACAAAGAAGATACACAGCTGG - Intronic
1129120497 15:73393617-73393639 CTTCAAGGCAGACCCAAAGCTGG - Intergenic
1136056684 16:27695048-27695070 CTTCCTATCCCATCCACAGCTGG + Intronic
1142414140 16:89932282-89932304 CTTGCCAGCAGCTGCACAGCTGG + Intronic
1143873156 17:9972084-9972106 ATAGCAAGCTGATCCACAGCAGG + Intronic
1146351966 17:32102566-32102588 CATAGAAGCAGATTCACAGCTGG + Intergenic
1147959220 17:44155938-44155960 CTTCCAGGCAGATCCACTCCAGG + Intronic
1149545805 17:57502859-57502881 CTTGGGAGCAGATGCACAGCTGG + Intronic
1152331481 17:79675703-79675725 CTCCCAGGAAGATCCACAGAGGG + Intergenic
1154333453 18:13448410-13448432 CTTCCGGGCAGCTCCACAACTGG + Intronic
1155698570 18:28714802-28714824 TTTCCAAGCAGACCCATAGGGGG - Intergenic
1156885746 18:42133477-42133499 CTTCCACGTATTTCCACAGCTGG + Intergenic
1158226532 18:55207067-55207089 CTTGGAAGAACATCCACAGCTGG - Intergenic
1159810102 18:73008067-73008089 CTGCCAAGAAGTTCCAGAGCTGG - Intergenic
1160492970 18:79353355-79353377 CTTCCACGCAGACCAGCAGCAGG + Intronic
1162721439 19:12665161-12665183 CTTCCCAGAGGATGCACAGCAGG + Intronic
1164398906 19:27889408-27889430 ACTACTAGCAGATCCACAGCAGG + Intergenic
1165759217 19:38310755-38310777 GTTCCAAGCAGAGGCACAGCTGG - Intronic
1166158766 19:40936074-40936096 CTGCCAATCACATCCACACCAGG - Intergenic
1166167702 19:41003978-41004000 CTGCCAATCACATCCACACCAGG - Intronic
1166794671 19:45419355-45419377 CTTCCAAGAAGATGCTCCGCAGG + Intronic
1167400128 19:49260830-49260852 CTTCCAAGAAGATAAACAGATGG + Intergenic
925064400 2:918089-918111 CTTCCAGCCAGATCAACAGAAGG - Intergenic
927108691 2:19848991-19849013 CTGCCAAGCCATTCCACAGCAGG - Intergenic
927491175 2:23522036-23522058 CTAACAAGCAGGTCCACAGCAGG - Intronic
927697185 2:25246562-25246584 CCGCCAGGCAGATCCACACCAGG - Intronic
927945625 2:27133553-27133575 CTTCCAGGCACATCAACAGCAGG - Exonic
928386196 2:30870498-30870520 ATTCCAAGCAACTCCATAGCTGG - Intergenic
931990340 2:67783684-67783706 CTTCCCACCAGAACCAAAGCAGG - Intergenic
937072412 2:119074087-119074109 CTTACAAGCATCTTCACAGCAGG - Intergenic
939136759 2:138305459-138305481 TTTCCAAGAAGCTCCACAGCAGG + Intergenic
941635474 2:167931036-167931058 CTACCAGGCAGATCCCCAGTGGG + Intergenic
946222965 2:218244772-218244794 CTTCCAAGATGATAGACAGCAGG - Intronic
948637382 2:239348293-239348315 CGTCCCAGCAAATCCACTGCGGG + Intronic
1171288813 20:23967801-23967823 CTACCAAGCAAATGCATAGCAGG + Intergenic
1172669491 20:36625124-36625146 CTTGTCAGCACATCCACAGCTGG + Intronic
1173163007 20:40666160-40666182 CTTCCACACAGACACACAGCGGG - Intergenic
1174082789 20:47983005-47983027 ATCCCAAGCAGAGGCACAGCAGG + Intergenic
1174755499 20:53154469-53154491 CTTCCATGCACAACCACTGCGGG + Intronic
1175820845 20:61908023-61908045 CTTCCTACCAGACCCAGAGCTGG + Intronic
1181314398 22:21962256-21962278 CAGCCAGGCAGGTCCACAGCGGG - Intronic
1181579911 22:23822379-23822401 CTCCCAAGCAGGTGCACAGCAGG - Intronic
1184160916 22:42696867-42696889 CCTCCAAGCAGAAGAACAGCAGG - Intronic
1184396705 22:44246553-44246575 CTTCCAGCCACAACCACAGCAGG + Exonic
953733609 3:45471692-45471714 CTTCCAAGCAAATCCATATGTGG - Intronic
954830399 3:53416627-53416649 CTTCAAAGCAGATCTACTTCTGG + Intergenic
955230493 3:57094996-57095018 CTTCCAAGCACATGCATGGCAGG - Exonic
958095070 3:88933894-88933916 CTTCCAAGCAGGTCCAAAGGTGG - Intergenic
960639978 3:119815090-119815112 CTTCCAAGCAGTAGGACAGCCGG - Exonic
961086630 3:124073287-124073309 CTTCCAAGAGGCTCCACAGATGG - Intergenic
962350013 3:134649874-134649896 ATTCCAAGGAGCTCCAGAGCTGG + Intronic
962430083 3:135311118-135311140 TGTCCAAGCAGACACACAGCAGG + Intergenic
965431675 3:168596787-168596809 CTTGTAAGCAGAACCTCAGCTGG + Intergenic
967971638 3:195003768-195003790 CTTTCAATCAGATCCCCAGGTGG + Intergenic
968062758 3:195738796-195738818 CTTCCAAGCAAACTCACACCTGG + Intronic
968816173 4:2823088-2823110 CCTCCCAGCAGAGCCCCAGCTGG + Intronic
969545745 4:7826415-7826437 CTTCCCAGAGCATCCACAGCTGG + Intronic
969665370 4:8554282-8554304 AATCCCAGCAGATTCACAGCAGG - Intergenic
971262300 4:25068493-25068515 CATCCAAGCAGATGGACAGATGG - Intergenic
975374294 4:73625365-73625387 TTTCCAAGCAGATGCAGAGATGG + Intergenic
977089408 4:92651732-92651754 CTTCCAAGCAAATTCAAAACAGG + Intronic
979779376 4:124631288-124631310 CTTCTAAGGAGATACACAGAAGG + Intergenic
981125551 4:141102176-141102198 CTTTCAAGTATATCCACAGAAGG + Intronic
984714231 4:182911719-182911741 GGTCCAAGCATATCCACAACTGG + Intronic
985938124 5:3112087-3112109 CCACCAAGCAGTTCCAGAGCTGG - Intergenic
992996473 5:82339026-82339048 TTTCCCAGCAGATGCAGAGCTGG + Intronic
997029486 5:130108768-130108790 CTTCAAAGCAGATGCACAAATGG + Intronic
997681069 5:135751059-135751081 CAGCCATCCAGATCCACAGCTGG + Intergenic
1001180122 5:169512635-169512657 CTTGGAGGCAGATCCACAGCTGG - Intergenic
1001668258 5:173451529-173451551 CTTCCAAGAAGCTCCACAATGGG + Intergenic
1002758492 6:183588-183610 CTTCCCAGTTGACCCACAGCTGG + Intergenic
1004162234 6:13224871-13224893 CTTCCAAGTGGTTTCACAGCAGG - Intronic
1009510980 6:64549443-64549465 CTTCCAACCACCTCCACAGGAGG + Intronic
1012623466 6:101377624-101377646 CTCACAAGCAGATGCAAAGCTGG + Intergenic
1015632399 6:135244872-135244894 CTTCCCAGCATCTCCACCGCAGG - Intergenic
1015850619 6:137568215-137568237 CTCCCAAGCAGGTCCACAAATGG + Intergenic
1017706318 6:157126356-157126378 CTTCCAAACAAATCCATAGGGGG + Intronic
1020706026 7:11545495-11545517 CCTCCAAGCAGATCTTCAGAAGG + Intronic
1031161631 7:118175931-118175953 CTTCAAAGCCCATCAACAGCAGG + Intergenic
1031329940 7:120452444-120452466 ATTCCAAGCAGATCTTCAGAGGG + Intronic
1032965509 7:137093075-137093097 ATTCCAAGCAGATCTTCAGAAGG + Intergenic
1033276070 7:139972405-139972427 ATGCCAAGCAGATGCACAGAAGG - Intronic
1035379594 7:158429286-158429308 CGTTCCAGCAGATCCACAGCCGG + Intronic
1035651972 8:1273338-1273360 CTCCCAAGCAAATGCTCAGCTGG - Intergenic
1036430175 8:8682387-8682409 CTTCAAAGCTCAACCACAGCAGG - Intergenic
1038368416 8:26961837-26961859 TTTCCAATCAGATCCTCAGGGGG - Intergenic
1039484199 8:37898861-37898883 CTTCCAAGAAGACCCAAAGCTGG + Intronic
1040978049 8:53215516-53215538 CTTCCTAGCAGATCTTCAGAGGG - Intergenic
1041727113 8:61028794-61028816 GCTCCAAGCAGAACCTCAGCTGG - Intergenic
1043616008 8:82126502-82126524 TTTCCCAATAGATCCACAGCAGG - Intergenic
1045504535 8:102769190-102769212 CTTCAAATCAGATCCACACCTGG + Intergenic
1045913840 8:107442831-107442853 CTTACAAGCAGATACTTAGCAGG - Intronic
1046924713 8:119773818-119773840 CTTCCAAGCACTTCCTTAGCAGG + Intronic
1047207196 8:122812137-122812159 ATTCCAGGCAGAGCGACAGCTGG + Intronic
1049965556 9:776123-776145 CTTGAAACCAGACCCACAGCTGG + Intergenic
1051301471 9:15655765-15655787 CTTCAAAGAAGATACACAGTTGG + Intronic
1059495993 9:114709902-114709924 CTTCCAAGCAGAGCTTCAGAGGG - Intergenic
1185471972 X:389410-389432 TATCCAAGCTGCTCCACAGCCGG + Intergenic
1187137168 X:16559232-16559254 CTTCCAAGTGAAACCACAGCAGG + Intergenic
1191257747 X:58287068-58287090 CTTTCCAGCAGTTCCAGAGCCGG + Intergenic
1191722925 X:64249372-64249394 ATTCCAAGCAGATCTTCAGAGGG - Intergenic
1195476425 X:105290971-105290993 CATCAAATGAGATCCACAGCTGG + Intronic