ID: 1106055395

View in Genome Browser
Species Human (GRCh38)
Location 13:26232224-26232246
Sequence AGTTGGGACTACCTGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106055387_1106055395 17 Left 1106055387 13:26232184-26232206 CCATCCTGCTTCCTGAAACTCCT 0: 1
1: 0
2: 1
3: 60
4: 585
Right 1106055395 13:26232224-26232246 AGTTGGGACTACCTGGAAACTGG 0: 1
1: 0
2: 0
3: 5
4: 122
1106055390_1106055395 6 Left 1106055390 13:26232195-26232217 CCTGAAACTCCTCTGGCACTAAC 0: 1
1: 0
2: 0
3: 13
4: 114
Right 1106055395 13:26232224-26232246 AGTTGGGACTACCTGGAAACTGG 0: 1
1: 0
2: 0
3: 5
4: 122
1106055391_1106055395 -3 Left 1106055391 13:26232204-26232226 CCTCTGGCACTAACTATCTTAGT 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1106055395 13:26232224-26232246 AGTTGGGACTACCTGGAAACTGG 0: 1
1: 0
2: 0
3: 5
4: 122
1106055388_1106055395 13 Left 1106055388 13:26232188-26232210 CCTGCTTCCTGAAACTCCTCTGG 0: 1
1: 0
2: 3
3: 21
4: 280
Right 1106055395 13:26232224-26232246 AGTTGGGACTACCTGGAAACTGG 0: 1
1: 0
2: 0
3: 5
4: 122
1106055386_1106055395 25 Left 1106055386 13:26232176-26232198 CCAGAAGTCCATCCTGCTTCCTG 0: 1
1: 0
2: 5
3: 22
4: 303
Right 1106055395 13:26232224-26232246 AGTTGGGACTACCTGGAAACTGG 0: 1
1: 0
2: 0
3: 5
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106055395 Original CRISPR AGTTGGGACTACCTGGAAAC TGG Intergenic
901413059 1:9098478-9098500 AGTTGGCACTGCCTGTACACAGG - Intergenic
902361703 1:15945606-15945628 AGGTGGGACTAGCTGGAGGCAGG + Intronic
905315302 1:37079070-37079092 ACTTGGCAGTACCTGGAGACAGG - Intergenic
906646747 1:47480662-47480684 AATTGGGAAAACTTGGAAACAGG - Intergenic
909565325 1:77047115-77047137 AGTAGGGACTACGTGGACCCTGG - Intronic
912790349 1:112643471-112643493 TATGTGGACTACCTGGAAACAGG - Intronic
914957417 1:152175395-152175417 AGTTGGGGCTACTTGGAATCAGG - Intergenic
917659343 1:177162854-177162876 ACTGGGGACTAGCTGGAAATGGG - Intronic
920047082 1:203140326-203140348 AGTTGGAACCAACTGGAAATAGG + Intronic
1063176075 10:3552118-3552140 AGTGGGGACTCCCAGGAAACAGG + Intergenic
1065997113 10:31069559-31069581 AGTTGGAAACAGCTGGAAACAGG - Intergenic
1066815583 10:39406147-39406169 ATTGAGGACTACGTGGAAACAGG + Intergenic
1070053675 10:72913675-72913697 AGATGGGACTATTTGAAAACAGG - Intronic
1072781232 10:98253199-98253221 AGTGGGGACTCCCAGGAACCTGG - Intronic
1073396790 10:103224602-103224624 AGTTGGAACTTCCTAGAAACTGG - Intergenic
1074981021 10:118620089-118620111 TGTGGGGACTACCTGGGCACAGG - Intergenic
1077420133 11:2446163-2446185 AATTGGAACCACCTGGTAACAGG - Intronic
1081219747 11:40445866-40445888 AGTGGGGACTGCCTTCAAACAGG + Intronic
1081720383 11:45284803-45284825 ACTTGGGACGATCTGGAAAAGGG - Intronic
1085996966 11:81929536-81929558 ACTTGGATCTACCTGTAAACTGG + Intergenic
1087679257 11:101200910-101200932 TGGTGGGAGTACCTGGAAAATGG + Intergenic
1088064928 11:105705760-105705782 TGGTGGGACTACGGGGAAACAGG + Intronic
1091444046 12:533388-533410 AGCTGGGCCAGCCTGGAAACAGG + Intronic
1092023850 12:5224422-5224444 ATTTGGGGCTACATGGAGACAGG - Intergenic
1092048820 12:5453497-5453519 AGTTGGGAAGAACTGGAACCTGG + Intronic
1094008394 12:25780684-25780706 ACTTAGGACTATCTGGACACAGG + Intergenic
1097787741 12:63779850-63779872 GCTGGGGACTGCCTGGAAACGGG + Exonic
1106055395 13:26232224-26232246 AGTTGGGACTACCTGGAAACTGG + Intergenic
1106928100 13:34633981-34634003 AGTTGGCACTATCTGGGAAGAGG + Intergenic
1110718803 13:78738294-78738316 TGCTGGGACTATCGGGAAACTGG + Intergenic
1110943215 13:81379613-81379635 AGTTGGAAATATCTGGAAAGTGG - Intergenic
1118944111 14:70367129-70367151 AGTGAGGAAAACCTGGAAACAGG + Exonic
1119251983 14:73164173-73164195 ATTCGGGACTTCCTAGAAACTGG + Intronic
1119258007 14:73216280-73216302 AGTGGGGATTAACTGTAAACGGG + Intronic
1119619805 14:76123687-76123709 AGTTGTGACTTCCTGGCCACAGG + Intergenic
1121699462 14:95941513-95941535 ATTTGGAACTTCCTGGAGACTGG + Intergenic
1124635897 15:31365150-31365172 GGTGGGGAATACCTGGAGACTGG + Intronic
1128366659 15:67008345-67008367 AGTTTGGAAGACTTGGAAACTGG - Intergenic
1130379839 15:83362057-83362079 ACTTGGTACTACCTAGAAACTGG + Intergenic
1130621668 15:85469408-85469430 ATCTGGAACTACCTGGAAAGAGG - Intronic
1135247313 16:20868053-20868075 AGTTGGGACTAAGTGGAGAGGGG - Intronic
1138503946 16:57467099-57467121 AGCTGGGACTACTTGGGAGCGGG - Intronic
1138515857 16:57535316-57535338 AGATGGGGCTACCTGGGAATAGG - Intronic
1138550457 16:57744906-57744928 AGTGGGGACCACCTGGAGTCAGG - Intronic
1142724201 17:1800002-1800024 AGTTGGGATGGCCTGTAAACTGG + Exonic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1151148550 17:72064211-72064233 AGTTGGGACTCTCAGGAAAAGGG - Intergenic
1152585290 17:81186616-81186638 AGCTGGGACTACCTGGTAGTGGG - Intergenic
1158239161 18:55357744-55357766 AGGTTGGCCTCCCTGGAAACAGG + Intronic
1160177886 18:76611064-76611086 AATTGGGCCAAACTGGAAACTGG - Intergenic
1164159442 19:22617062-22617084 AGATGGGAACACCAGGAAACTGG - Intergenic
1167074433 19:47240052-47240074 AGTTGGGATGGGCTGGAAACGGG + Intergenic
928873582 2:36011076-36011098 ACTTGGGAAGACCTGGAAAAGGG - Intergenic
930342965 2:50140573-50140595 AGTTGCTACTGCCTTGAAACAGG - Intronic
930407554 2:50979381-50979403 AGATGGAAATACCTGAAAACTGG - Intronic
930825926 2:55696573-55696595 TGTTCAGAATACCTGGAAACTGG - Intergenic
932566454 2:72914316-72914338 AGATGGGACCTCCAGGAAACTGG + Intergenic
937957801 2:127431680-127431702 AGGTGGGGCTGCCTGGAAATGGG + Intergenic
940642546 2:156361518-156361540 AGGTGGGAGGATCTGGAAACTGG - Intergenic
941256733 2:163241351-163241373 AGTTGGGGCAGCCTGGAACCTGG + Intergenic
944616612 2:201466447-201466469 AGTTGACACCAGCTGGAAACTGG + Intronic
945809493 2:214531179-214531201 AGTTGGGAATCACAGGAAACAGG + Intronic
947034778 2:225839757-225839779 AGCTGGGACTTCATGGAGACTGG - Intergenic
948877906 2:240839933-240839955 AGTAGACACTACCTGGGAACCGG - Intergenic
948890816 2:240906267-240906289 AGCTGGGTTTCCCTGGAAACAGG - Intergenic
1169474237 20:5916608-5916630 AGTTGGGATTATCTGGAGAAGGG - Intronic
1170042756 20:12055219-12055241 ATCTGGGACTGCCTGGAGACAGG + Intergenic
1173734922 20:45353661-45353683 AGTTGGCAAGTCCTGGAAACAGG - Intergenic
1174246394 20:49184799-49184821 AGTTATGACTACCTGGAAGATGG - Intronic
1179240015 21:39581648-39581670 AGGTGGGAGTCCCTGGAAATGGG + Intronic
1183046785 22:35226849-35226871 AGCTGGGACTAGCTGCAGACAGG - Intergenic
1184258302 22:43299769-43299791 AATTGGGACTAACCGAAAACGGG - Intronic
952858600 3:37793783-37793805 AGTTGGTCCTGCCTGGAAGCAGG + Intronic
954518151 3:51198410-51198432 TGTTGGGACATCCTGGAAGCGGG - Intronic
956493550 3:69800093-69800115 AGTTGGGACTAACTGCTAATAGG - Intronic
960753415 3:120982262-120982284 AGCAGGGAATTCCTGGAAACTGG - Intronic
963965087 3:151359373-151359395 AGATGGGACTACCTAGCAGCAGG - Intronic
970287632 4:14535858-14535880 TTTTGTGACTACATGGAAACAGG - Intergenic
971545691 4:27882200-27882222 AGTTGGGAAAACAGGGAAACTGG - Intergenic
973737154 4:53883445-53883467 AGATGGGACCAGCTGGAAAAAGG - Intronic
978686344 4:111449367-111449389 AGTTGGTTCTAACTGGAAAGTGG - Intergenic
981131272 4:141161083-141161105 ATTTGGGACACCCTAGAAACTGG + Intronic
986411450 5:7484728-7484750 AGCTGAGAATACCTGAAAACTGG - Intronic
990543704 5:56800848-56800870 AATTGTGAATACCTGAAAACAGG - Intergenic
992829139 5:80577457-80577479 AGTTGGGACTAGCTGCTAATTGG + Intergenic
993817503 5:92569615-92569637 AGTTGATATTTCCTGGAAACAGG + Intergenic
994121390 5:96117749-96117771 AGTTGGTGCTTCCTGGAAATGGG - Intergenic
998909128 5:146939146-146939168 AGTTGGAACCACCTGGAGCCTGG - Intronic
998973283 5:147615874-147615896 ATTTGGCAGTACCTGGAAGCTGG + Intronic
999958160 5:156724761-156724783 AGTTAGGTCTTCCTGCAAACTGG + Intronic
1000746003 5:165034947-165034969 AGGTGGGAAAACCTGGAAATTGG - Intergenic
1001263174 5:170250361-170250383 AGTTGACACCACCTGGAAAAGGG - Intronic
1002788219 6:419642-419664 ATTTGGGGTTGCCTGGAAACAGG + Intergenic
1003279837 6:4681605-4681627 TCTTGGGCCTACCTGGAAAGTGG - Intergenic
1006127330 6:31847892-31847914 AGCTGGTACCACCTTGAAACAGG + Intergenic
1007522205 6:42459484-42459506 ATTTGGGACTAACTTGAAGCTGG - Intergenic
1009625414 6:66134311-66134333 AGTTGGAACTCCCTCAAAACTGG - Intergenic
1012907562 6:105085867-105085889 AATTTGGACTGCCTGGAAAATGG + Intergenic
1013397965 6:109762276-109762298 AGTTTGTACTACTTGGAAATTGG + Intronic
1019823185 7:3261472-3261494 AGGTGAGACAACTTGGAAACAGG + Intergenic
1023190877 7:37580873-37580895 GGGTGGGATTGCCTGGAAACTGG + Intergenic
1024216969 7:47256101-47256123 TATTGGGAATAGCTGGAAACAGG + Intergenic
1027774333 7:82444618-82444640 AGTTGGGACTACCTCCAAAAGGG + Intergenic
1030458445 7:109801813-109801835 TGTTGGCACTACTTGGAAATGGG + Intergenic
1031590365 7:123583348-123583370 AGTGGGAACTAACGGGAAACTGG + Intronic
1032742074 7:134749135-134749157 AGTTTGGACTTTCTGGAAAGAGG + Intronic
1033999268 7:147391436-147391458 AGTTGGGACAAAATAGAAACAGG - Intronic
1034468639 7:151244255-151244277 CCCTGGGACTACCTGGCAACAGG + Intronic
1036296715 8:7543442-7543464 AGAGGGGACTTCCTGGACACAGG - Intergenic
1036325852 8:7777577-7777599 AGAGGGGACTTCCTGGACACAGG + Intergenic
1038831570 8:31066973-31066995 ATTTGGTAATACCTGAAAACAGG + Intronic
1040385249 8:46910964-46910986 AGTGGGGACTCCCTGAGAACAGG - Intergenic
1045707132 8:104937330-104937352 ATTTGGGGCTACCAGGAACCAGG + Intronic
1046099621 8:109599773-109599795 AGTTTGGACTTCATGGACACAGG - Intronic
1051054672 9:12970887-12970909 AGTTGAGATTAGATGGAAACTGG - Intergenic
1052054826 9:23893342-23893364 GGTTGGAACTACCTGCAAAATGG + Intergenic
1052661483 9:31438560-31438582 AGTTTGGGTTCCCTGGAAACAGG + Intergenic
1054984765 9:71248649-71248671 AGTTGTGAATAGCTGGAAAAGGG - Intronic
1057696460 9:97326286-97326308 AGATGGGACCCCCTGGAGACAGG - Intronic
1057815041 9:98287912-98287934 AGTTGGGGTCACCTGGTAACAGG + Intergenic
1058226037 9:102365236-102365258 AGTTGGGAAAAACTGCAAACAGG + Intergenic
1186213427 X:7273928-7273950 TGATGGGACTTCCTGGAAAAGGG + Intronic
1189092351 X:38099003-38099025 AGTAGGGACTGACTGCAAACAGG + Intronic
1191642081 X:63436838-63436860 AGTTGAAACTAACTGGAACCAGG - Intergenic
1191940049 X:66468946-66468968 AGTTGGGACTACATTGCACCTGG + Intergenic
1194947085 X:100082001-100082023 GGTTGGGACTAACTGGCTACAGG + Intergenic
1195814309 X:108868478-108868500 ATTTGGGATTTCCTAGAAACTGG - Intergenic
1201586308 Y:15564733-15564755 TGATGGGACTGCCTGGAAAAGGG + Intergenic