ID: 1106057219

View in Genome Browser
Species Human (GRCh38)
Location 13:26249694-26249716
Sequence ATGAATGAACAGATGGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 974
Summary {0: 1, 1: 0, 2: 10, 3: 122, 4: 841}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106057219 Original CRISPR ATGAATGAACAGATGGATAA TGG (reversed) Intergenic
900196561 1:1379365-1379387 ATGAAGGAAAAGCTGTATAATGG + Intergenic
900498136 1:2985870-2985892 GTGAATGAATGGATGGATGATGG - Intergenic
900509584 1:3052193-3052215 ATGAATGAATGGATGGATGATGG - Intergenic
900535872 1:3177032-3177054 ATGAGTTAACAGATGGATGAGGG - Intronic
900821567 1:4893503-4893525 ATCAATGAATGAATGGATAAAGG + Intergenic
900857004 1:5194324-5194346 ATGAACAAACAAATAGATAAAGG + Intergenic
900939011 1:5785693-5785715 ATAAATGAACAGATAGATGATGG + Intergenic
901001213 1:6149647-6149669 ATGAATGGATAAATGGATGATGG + Intronic
901001300 1:6150159-6150181 ATGGATGGACAAATGGATGATGG + Intronic
901001319 1:6150278-6150300 ATGGATGGACAAATGGATGATGG + Intronic
901212127 1:7532746-7532768 ATGAATGAGTGGATGGATCAAGG + Intronic
902063123 1:13661876-13661898 ATGAATGAAATGATGAATGAAGG - Intergenic
902599040 1:17528624-17528646 ATGAATGAATGGATGGAGGATGG - Intergenic
902721208 1:18305383-18305405 ATGGATGGATGGATGGATAATGG + Intronic
902721233 1:18305529-18305551 ATGAATGGATGGATGGATGATGG + Intronic
902873459 1:19327504-19327526 ATGGATGGACGGATGGATGAAGG - Intronic
903234459 1:21940659-21940681 ATGAATGAATGAATGGACAAAGG - Intergenic
903341681 1:22658819-22658841 ATGGATGGACAGATGGACAGAGG + Intronic
903357842 1:22758937-22758959 ATGAATGGATGGATGGATGATGG + Intronic
903371343 1:22837996-22838018 ATGAAAGAACAGAGACATAAAGG - Intronic
903474263 1:23608541-23608563 ATGAATGAATGGATGAATGAAGG + Intronic
903937626 1:26907494-26907516 ATGAATTAATGGATGGATAGTGG + Intronic
904050866 1:27637467-27637489 AGGAATTAACAGATGAACAAAGG + Intergenic
904067076 1:27761649-27761671 ATGAATGAACAGATTAAAAATGG + Intronic
904464491 1:30699831-30699853 ATCAATGAAGGGATGGATAGAGG - Intergenic
904464521 1:30699967-30699989 ATGGATGAAGGGATGGATAGAGG - Intergenic
904586850 1:31585452-31585474 ATGAAGGAGCTGATGGAGAATGG + Exonic
904956983 1:34292795-34292817 ATGGATGAACAAATGGATGTGGG + Intergenic
906141917 1:43539007-43539029 AAGAATGAACGGATGGGCAATGG - Intronic
906557558 1:46725676-46725698 ATGAATGAATGAATGAATAAAGG - Intergenic
906706387 1:47898092-47898114 ATGAATGAGCAGATGAAGGAAGG + Intronic
907040650 1:51256208-51256230 AGGGATGAACAGATGGAACACGG - Intronic
907114001 1:51952657-51952679 AGGAATGAATAAATGAATAAAGG + Intronic
907764135 1:57391717-57391739 AAGAATGCACAGATGGATTAGGG - Intronic
907774266 1:57498029-57498051 ATGGATGAATGGATGGATCAAGG + Intronic
907790129 1:57655368-57655390 ATGAATGGATGGATGGATGATGG - Intronic
907839884 1:58146818-58146840 ATGGATGGATGGATGGATAAAGG - Intronic
907857355 1:58316995-58317017 ATGAATGAACTGATTGGTTATGG - Intronic
907919763 1:58901673-58901695 ATGAGTGGACAGATGGATGATGG - Intergenic
908028953 1:59979774-59979796 TTGTAGGAACAGATGGAAAATGG + Intergenic
908220232 1:61998682-61998704 ATGAAGGAACTGAAGGGTAAAGG - Intronic
909923841 1:81414941-81414963 ATGAATAACCAGATGGGAAACGG - Intronic
910727935 1:90358510-90358532 ATGAATGAATATATAGATTAGGG - Intergenic
910863888 1:91769601-91769623 ATGATTGGAGAGAAGGATAAGGG + Intronic
910994765 1:93092615-93092637 ATGAATGAGGAGAGGAATAAGGG + Intronic
911132931 1:94408993-94409015 AAAAAGGAACAGATTGATAAGGG - Intergenic
912563343 1:110566054-110566076 ATGAATTAACTCATGGATACTGG + Intergenic
914319512 1:146545558-146545580 GACAATGAACAGATGAATAAAGG - Intergenic
914425146 1:147569135-147569157 ATGGGTGAACAAATGGACAAAGG + Intronic
915762647 1:158330450-158330472 ATGATTGAAAAGATGGATTAGGG + Intronic
915776105 1:158488470-158488492 TTGAAAGAACAGATGGTTGATGG + Intergenic
916307328 1:163352431-163352453 ATGAATGAACTGAAGGAAAATGG - Intronic
918070567 1:181131008-181131030 ATAAATGAATAAATGGAGAATGG - Intergenic
918576002 1:186061098-186061120 ATGAATGAAGAGATAGATAGAGG - Intronic
918637240 1:186792431-186792453 ATGAATGAACAAATATATAATGG + Intergenic
918690387 1:187471959-187471981 ATGAATGAATAGTTGCATAGGGG - Intergenic
919032127 1:192255414-192255436 ATGAATTAATACATGCATAATGG - Intergenic
919272444 1:195365689-195365711 ATGAATGAAAACAATGATAAAGG + Intergenic
919675803 1:200381882-200381904 ATGAATGAATGTATGAATAAAGG + Intergenic
920195429 1:204223309-204223331 ATGGATGAATGGATGGATAGTGG + Intronic
920320854 1:205121390-205121412 CTCATTGAACAGATGAATAAAGG - Intronic
920607209 1:207400734-207400756 ATGAATTAAAAGATGGGGAATGG - Intergenic
920722271 1:208398896-208398918 ATGAATGAATGAATGGATGATGG - Intergenic
920755561 1:208727747-208727769 ATGGATGGATAGATGGATAGAGG + Intergenic
921501460 1:215909298-215909320 ATGAATGAATAGATGGAACACGG + Intronic
922223805 1:223628173-223628195 ATGAATAAGCAGATGTGTAAAGG + Intronic
922709899 1:227819237-227819259 ACGAATGAATAGATGGCTATAGG - Intronic
922745730 1:228042528-228042550 ATGAATGTACAGATGATGAAGGG + Intronic
922790597 1:228308871-228308893 AAGAATGAATGGATGGATAATGG - Intronic
923366834 1:233270036-233270058 ATGGATGACCAGATGGACAAAGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924668903 1:246103128-246103150 AAGAATGAACAAATGAATATAGG + Intronic
924743670 1:246813167-246813189 CTGAAAGAACTGATGGAAAAAGG + Intergenic
924820815 1:247488659-247488681 AGCAATGGACAAATGGATAATGG - Intergenic
1063032668 10:2251327-2251349 AAGAAAGAACAAATGGATCAAGG - Intergenic
1063438926 10:6056287-6056309 ATGCATGAATGGATGGATGAAGG + Intronic
1063500447 10:6548966-6548988 ATGAATGGATAAATGGATCATGG - Intronic
1064142389 10:12801463-12801485 ATGAATGGATAGATAGATGACGG - Intronic
1064188596 10:13185660-13185682 ATGAAGGAAAGGATGGAAAATGG + Intronic
1065278383 10:24109526-24109548 AAAAATGAACAGATGGAAACTGG + Intronic
1065658671 10:27981784-27981806 ATGAATGAACAATTGAATGAAGG - Intronic
1066398700 10:35052549-35052571 ATGAATGAATAAATGAATAGTGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067051422 10:43023554-43023576 ATGGATGAATGGATGGATGATGG + Intergenic
1067051505 10:43024176-43024198 ATAGATGGACAGATGGATGATGG + Intergenic
1067169603 10:43895816-43895838 AAGCATGAGCAGAGGGATAAGGG + Intergenic
1067709803 10:48638775-48638797 CTTAATGAACAAAGGGATAATGG + Intronic
1067730516 10:48807207-48807229 GGGAATGAACAAATGGGTAATGG + Intronic
1068076257 10:52258918-52258940 TTAAATGAACAGATGGGGAAAGG + Intronic
1068129643 10:52881630-52881652 ATGAATGAACAAATGGGTACAGG + Intergenic
1068927862 10:62558708-62558730 ATGAATGACTATAAGGATAAGGG + Intronic
1069255718 10:66329635-66329657 ATGAACGAACAGTTGAACAATGG + Intronic
1070448466 10:76532394-76532416 ATGAATAAATAAATGTATAAAGG - Intronic
1070504708 10:77103010-77103032 GTGAATGAACCGATGGAGAGGGG + Intronic
1071477144 10:86034790-86034812 CTGGATGAACAGATGTATGATGG + Intronic
1072450411 10:95535058-95535080 ATAAATGAATGGATGGATGATGG + Intronic
1072691565 10:97575401-97575423 ATGAATGATCGAATGGATGATGG - Intronic
1073467236 10:103701292-103701314 ATGGATGAATGGATGGATGATGG - Intronic
1073467240 10:103701315-103701337 ATGGATGAATGGATGGATGATGG - Intronic
1073467275 10:103701488-103701510 ATGGATGAATGGATGGATGATGG - Intronic
1074066568 10:110020166-110020188 TTGAATGAATAAATGAATAAAGG - Intronic
1074068419 10:110040373-110040395 ATGATTGAACAGATTGACACTGG + Intronic
1074704308 10:116117708-116117730 AGGTATGAATAGATGGATGATGG + Intronic
1074905385 10:117858225-117858247 ATGGATGGATGGATGGATAATGG - Intergenic
1074950516 10:118329810-118329832 ATGAATGCAAACATGGATGACGG - Intronic
1075814321 10:125253227-125253249 AGGAAGGAATGGATGGATAAAGG - Intergenic
1076676756 10:132151094-132151116 GAGAATGAATAGATGGATTATGG - Intronic
1077279919 11:1739105-1739127 ATGAATGGACAGGTGGTTACAGG + Intronic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280559 11:1743165-1743187 ATGGATGGACAGATGAAGAATGG + Intronic
1077280564 11:1743203-1743225 ATGGATGGACAGATGAAGAATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077280579 11:1743297-1743319 ATGGATGGACAGATGAAGAATGG + Intronic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077304201 11:1861544-1861566 ATGGATGGATAGATGGATAATGG + Intronic
1077312124 11:1893557-1893579 ATGAATGGACAGAGGGAGAGAGG + Intergenic
1077312155 11:1893676-1893698 ATGGATGGATAGATAGATAATGG + Intergenic
1077354133 11:2107056-2107078 ATGGATGAATAGATGCATAGAGG + Intergenic
1077479903 11:2808874-2808896 ATGGATGAACACATGGACAATGG + Intronic
1077481951 11:2819094-2819116 ATGAATGAACCAATGAACAAAGG - Intronic
1077924478 11:6667244-6667266 ATACAAGAACAGATGGATAATGG - Intergenic
1078457679 11:11487990-11488012 ATAAATGAACAGCTGGGTATGGG + Intronic
1078521526 11:12067740-12067762 ATGAATGAATATTTGGATACTGG - Intergenic
1079477684 11:20848452-20848474 ATGGCTGGACAGCTGGATAATGG + Intronic
1079488304 11:20959093-20959115 ATGAATGAACCCATAGCTAAAGG + Intronic
1079554102 11:21738411-21738433 ATGAATGAATAAATGAATGATGG + Intergenic
1079807369 11:24950223-24950245 ATAAATGAATGGATGGATGAAGG + Intronic
1080117295 11:28635254-28635276 CTGAATGAATAAATGAATAAAGG - Intergenic
1080185323 11:29476536-29476558 ATGAATAAACAGATTCATAGTGG - Intergenic
1080609241 11:33889527-33889549 ATGAATGAACAAATGAGTGAAGG - Intronic
1080849360 11:36054893-36054915 ATGGATGAATGGATGGATGATGG + Intronic
1081031970 11:38096185-38096207 TTCATTGAACAGAGGGATAAAGG + Intergenic
1081223322 11:40489867-40489889 TTAAATGAATAAATGGATAAAGG - Intronic
1081287183 11:41285246-41285268 ATGAATGAATGGATGGATGATGG - Intronic
1081538299 11:44011581-44011603 GTGAATGAATAAATGAATAAAGG + Intergenic
1081722877 11:45302958-45302980 AGGAAGAAACAGATGGAGAAAGG + Intergenic
1082111040 11:48274365-48274387 ATCAATGAATGAATGGATAAAGG - Intergenic
1082222484 11:49656709-49656731 ATAAATCAACAGATTGGTAATGG + Intergenic
1082647141 11:55741122-55741144 TTGAATGAACTAATGGATCAAGG + Intergenic
1084461919 11:69300995-69301017 ATGCATGGACAGATAGATAGTGG + Intronic
1084464707 11:69315475-69315497 ATGGATGGATGGATGGATAATGG + Intronic
1084543837 11:69803818-69803840 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084543875 11:69804053-69804075 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084543901 11:69804223-69804245 ATGGATGGATAGATGGATGATGG + Intergenic
1084568568 11:69945417-69945439 ATGGATGAACAGATGATGAATGG + Intergenic
1084658835 11:70535525-70535547 ATGAATAGACTGATGGATGATGG - Intronic
1084841126 11:71849383-71849405 GTTTATGAACAGATGGATAAAGG - Intergenic
1084950620 11:72663255-72663277 ATGAATGAACAGGTGGCTTGGGG + Intronic
1084970782 11:72770943-72770965 ATGAATGAACAGGTCCCTAAAGG - Intronic
1085642947 11:78204618-78204640 ATGAATGAATAGAGGCAAAAAGG - Intronic
1085847742 11:80085128-80085150 ATGAATAAAAAGAAGGAAAAAGG - Intergenic
1086019973 11:82215924-82215946 ATGAATGATCAGAAGGCTGAGGG - Intergenic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086288907 11:85282227-85282249 AATAAAGAAGAGATGGATAATGG + Intronic
1086445477 11:86866496-86866518 ATGAATGAATAGATGATGAATGG - Intronic
1086626565 11:88962497-88962519 ATAAATCAACAGATTGGTAATGG - Intronic
1087347496 11:96990342-96990364 GTGAAAAAACAGATGGATCAGGG + Intergenic
1087625557 11:100592196-100592218 ATGAATGAATAGATAAATAAGGG - Intergenic
1087910856 11:103751853-103751875 ATGAATGAATACATGAATAATGG - Intergenic
1088375027 11:109131623-109131645 ATGGATGAATGGATGGTTAAAGG + Intergenic
1088709015 11:112489835-112489857 ATGGATGGATAGATGGATGATGG - Intergenic
1088810647 11:113389371-113389393 ATGAATGAATAGCTGGAAAGAGG - Intronic
1088915895 11:114227460-114227482 AAGGACGAATAGATGGATAAAGG - Intronic
1088948859 11:114544371-114544393 AAGAATGAACAGATTAATCAAGG + Intronic
1090178042 11:124669236-124669258 ATGAATGGACAGACGGATGTAGG + Intronic
1090268016 11:125366407-125366429 ATCAATGAATAGATGAATGATGG - Intronic
1090566931 11:128004940-128004962 GTGAATGAACATATGAATGAAGG - Intergenic
1090675174 11:128985678-128985700 ATGAATGAATGGATGGACAAAGG - Intronic
1090880244 11:130826444-130826466 ATGAATGAATAAAGGGATGAAGG - Intergenic
1091036642 11:132239983-132240005 ATGAATGGATGGATGGATGATGG - Intronic
1091119359 11:133043876-133043898 ATGTATGCACAAATGAATAAAGG - Intronic
1091190674 11:133693132-133693154 AGGAATAAACAGCTGGAAAATGG - Intergenic
1091782257 12:3221203-3221225 TTGAATGAATAAATGAATAAGGG - Intronic
1091949015 12:4576160-4576182 AAGGATGAATAGATGGACAATGG - Intronic
1092310770 12:7349571-7349593 GAGAATGAAAAGATGTATAAGGG + Intronic
1094349793 12:29511436-29511458 ATGAATGAATAAATGAATGATGG + Intronic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095240747 12:39856218-39856240 ATGCATGGATAGATGGATGAAGG - Intronic
1095251949 12:39989339-39989361 TTTAATGAGCAGATTGATAAAGG - Intronic
1095349607 12:41192674-41192696 ATGAATGAACAGTTGAAACAAGG + Intronic
1096611227 12:52803312-52803334 ATGGATGAATAGATGGATGATGG + Intergenic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097064809 12:56313175-56313197 ATTAATGAACACATGGACACAGG - Intronic
1098079306 12:66766918-66766940 GAGAATGAACAAATGGATAAGGG + Intronic
1098617513 12:72547193-72547215 ATTAAGGAAGAGATGAATAAAGG - Intronic
1098643283 12:72865195-72865217 ATGAATGAATAAATGGCTATTGG - Intergenic
1098750607 12:74289338-74289360 ATAAATGAGTAGATGAATAAAGG - Intergenic
1100095220 12:91025748-91025770 AAGAATGAAAAGATGCAGAATGG + Intergenic
1100116155 12:91307018-91307040 ATGAATGAAAAAATTGGTAAAGG + Intergenic
1100359709 12:93864985-93865007 ATGAATAAACAAATGAATGAGGG + Intronic
1100569443 12:95833289-95833311 AGCAATGAACAGAAGGAAAATGG - Intergenic
1100664829 12:96739634-96739656 ATGAGTGAATAGAAGAATAAAGG - Intronic
1100711011 12:97256998-97257020 AGGGATGAAAAGAAGGATAATGG - Intergenic
1100866024 12:98857655-98857677 ATGAATGAATAAATGAATGAAGG + Intronic
1102043168 12:109813845-109813867 ATGAATGGATGGATGGATGATGG + Intronic
1102507192 12:113391005-113391027 ATGAATGAATGGATGGCTGATGG - Exonic
1102514748 12:113438895-113438917 ATGAATGCATGGATGGATTATGG - Intergenic
1102664555 12:114559840-114559862 AAGAATGAGCAAATTGATAATGG - Intergenic
1102738432 12:115184063-115184085 ATCAATGAACAAATGGATAAAGG + Intergenic
1102785954 12:115604982-115605004 ATAAATGGACAGATAGATGATGG + Intergenic
1102879451 12:116473097-116473119 ATTAATGAACAGATTGGTGAAGG + Intergenic
1103002471 12:117395863-117395885 ATGAATGGATGGCTGGATAATGG - Intronic
1103745154 12:123117729-123117751 ATGAATGAACAAATCCATGAAGG - Intronic
1104034648 12:125089902-125089924 ATGGATGGATAGATGGATAATGG - Intronic
1104034698 12:125090204-125090226 ATGGATGGATAGATGGATAATGG - Intronic
1104034722 12:125090357-125090379 ATGGATGAATAGATGGATGACGG - Intronic
1104034761 12:125090630-125090652 ATGGATGGAGAGATGGATGATGG - Intronic
1104075695 12:125387792-125387814 ATGGATGGATGGATGGATAACGG - Intronic
1104297444 12:127529760-127529782 ATGAATGGACAGATGACAAATGG - Intergenic
1104803159 12:131568547-131568569 ATGAATGGATGGATGGATAGGGG - Intergenic
1104836222 12:131793406-131793428 TTGCATGAACAGCTGGATATCGG + Intronic
1104896439 12:132167148-132167170 GTGGATGAATGGATGGATAAGGG - Intergenic
1105279768 13:18956596-18956618 ATGAATGAACAAATGGTGAGTGG - Intergenic
1105520843 13:21129577-21129599 TTGAATGATTAGATGGAAAATGG - Intergenic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106100456 13:26690892-26690914 ATTGATGAACAGATGGAGAGGGG - Intergenic
1106776030 13:33010722-33010744 ATGAATGAACCCATTGGTAAGGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106900610 13:34351423-34351445 ATGAATGAGTAGAGGGATGATGG + Intergenic
1107836957 13:44420070-44420092 ATGAATGAATGAATGGAAAAGGG - Intergenic
1107963168 13:45576550-45576572 ATGAATGAACTGGTAGAAAAGGG + Intronic
1108106238 13:47013771-47013793 AAGAAGGAAGAGATGGAGAAAGG + Intergenic
1108158167 13:47609896-47609918 ATCAATGGATAAATGGATAAAGG + Intergenic
1108482586 13:50889836-50889858 TTGAATGAATAGATAGATATTGG + Intergenic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1109575459 13:64250545-64250567 ATGAAGGAACAGATGACTAATGG + Intergenic
1109664253 13:65509939-65509961 ATCAATGAATGAATGGATAAAGG - Intergenic
1109747275 13:66641704-66641726 ATGAAGGGACAGATAGATGATGG + Intronic
1110133021 13:72029981-72030003 ATGTATGAACTGCTGGACAAAGG + Intergenic
1110373334 13:74764134-74764156 TTGAATGAATAAATGTATAAGGG - Intergenic
1110457063 13:75700995-75701017 ATGAATGAACAAATAGAACATGG - Intronic
1110752517 13:79131803-79131825 TTGAATGAATGGATGGATGAAGG - Intergenic
1111095482 13:83508887-83508909 ATGAATGAACAAATGCATTGGGG + Intergenic
1111447002 13:88359597-88359619 ATCAATGGATAAATGGATAAAGG + Intergenic
1112216673 13:97437738-97437760 ATGAAGGATCTGATGGAAAAGGG + Intronic
1112678774 13:101737530-101737552 ATGAAAGAAAATATTGATAAAGG - Intronic
1113179161 13:107605881-107605903 ATGAATTAACTGGTGCATAAGGG - Intronic
1113195421 13:107798492-107798514 AAGAAAGAAGAGATTGATAAGGG - Intronic
1113224762 13:108147503-108147525 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224791 13:108147699-108147721 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224821 13:108147845-108147867 ATGATTGAATAGATGGAGGATGG - Intergenic
1113224862 13:108148040-108148062 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224873 13:108148089-108148111 ATGACTGAATAGATGGAGGATGG - Intergenic
1113370434 13:109720122-109720144 ATGAATGGACGGATGGATCTGGG - Intergenic
1113641469 13:111960490-111960512 ATGAATGAATAGATGGATGGAGG + Intergenic
1113641474 13:111960530-111960552 ATGAATGAATGGGTGGATAGAGG + Intergenic
1113649346 13:112024689-112024711 GGGAATGAACAGGTGAATAAAGG - Intergenic
1113653023 13:112050639-112050661 ATGAATGAAGAAATGAATGAAGG + Intergenic
1113901059 13:113798357-113798379 ATGAATAGAAGGATGGATAATGG + Intronic
1113901073 13:113798443-113798465 ATGAATCGAAGGATGGATAATGG + Intronic
1113901087 13:113798514-113798536 ATGAATGGAAGGATGGATGATGG + Intronic
1113901113 13:113798649-113798671 ATGAATGGAAGGATGGATAATGG + Intronic
1113901138 13:113798771-113798793 ATGAATGGAAGGATGGATGATGG + Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115049635 14:29042066-29042088 ATGGATGAATAAATGAATAAAGG + Intergenic
1115292366 14:31786668-31786690 ATGAATGAACAGGTGATTAGGGG + Intronic
1116025935 14:39514832-39514854 ATAAATGAACAGACACATAAAGG - Intergenic
1116140431 14:40986606-40986628 ATGCATGAACAGATGAGTTAAGG + Intergenic
1116149627 14:41123614-41123636 ATGAATGAACAGTTGAGTGAAGG + Intergenic
1116236724 14:42287950-42287972 GTTAAAGAACAGATGAATAAGGG - Intergenic
1116566038 14:46445567-46445589 AAGAATTAACAGACTGATAATGG + Intergenic
1116835088 14:49762642-49762664 ATGCAAGAACAGATGGGTAATGG - Intergenic
1117016636 14:51525172-51525194 ATGGATGGATGGATGGATAAAGG + Intronic
1119174781 14:72561108-72561130 ATTGATGAATTGATGGATAACGG - Intronic
1119948776 14:78722954-78722976 CAGAAGGAACAGATGTATAAAGG + Intronic
1119977283 14:79039209-79039231 ATAAAAGAACAGAAGGATATAGG - Intronic
1120091532 14:80337783-80337805 ATGTATGTACAGATTGGTAAAGG - Intronic
1120489577 14:85160299-85160321 ATGAATTAACAAATGGAAGAAGG - Intergenic
1120600417 14:86498127-86498149 ATGAATGGACAAATGAATTATGG + Intergenic
1120795889 14:88632491-88632513 ATGAATGTAGAGAGGGATAGTGG - Intronic
1121365317 14:93303787-93303809 TTGAAGCAACAGATGGAAAATGG + Intronic
1121393941 14:93601486-93601508 ATTAATCAACAAGTGGATAAAGG - Intronic
1121416322 14:93781585-93781607 ATGAAGGCACAGATGTATAAGGG + Intronic
1121504755 14:94468354-94468376 ATGAGTGAACATGTGGATGAAGG + Intronic
1121786872 14:96668533-96668555 ATGAATGAACTGATGGGGGACGG - Intergenic
1121828666 14:97031281-97031303 AGAAAGGAAGAGATGGATAAAGG - Intergenic
1121925703 14:97925505-97925527 CAGAATGAACAGATGGGTAATGG - Intergenic
1122109083 14:99482431-99482453 ATGAAAGAATGGATGGATGATGG + Intronic
1122877508 14:104675641-104675663 ATGGATGGACAGATGGATAATGG + Intergenic
1122958572 14:105084031-105084053 AGGAATGGAAAGATGGATAGAGG - Intergenic
1123103736 14:105825693-105825715 ATCAATCAACAAGTGGATAAAGG - Intergenic
1123627033 15:22234354-22234376 AAGAATGAGAAGATGGATATTGG - Intergenic
1123755573 15:23395283-23395305 AGGAATGAGCAAATGGAAAAGGG - Intergenic
1123759591 15:23422205-23422227 CTGAACGAACAGATGAATGAGGG + Intergenic
1124805497 15:32877855-32877877 ATGAATGAGCAAATGAACAATGG - Intronic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1126103248 15:45132179-45132201 TTGAAGAAATAGATGGATAATGG + Intronic
1126463126 15:48935188-48935210 ATGTATGAATGGATGAATAATGG + Intronic
1126683066 15:51222725-51222747 ATGAATGAACGGAAGGAGATAGG + Intronic
1126711072 15:51456776-51456798 ATGAATAAACAGATACAAAATGG - Intronic
1126728922 15:51661739-51661761 ATGGATGAATAGATAGATAAAGG - Intergenic
1127473643 15:59312438-59312460 ATGAAGAAACAGAAGCATAAAGG + Intronic
1128773834 15:70303599-70303621 ATGAATGAATGGGTGGATATGGG + Intergenic
1128921647 15:71615919-71615941 ATGAATGCACAGAAGGTTACAGG - Intronic
1129999045 15:80031586-80031608 ATGAATGAAGAGATGGGTGGTGG + Intergenic
1130353615 15:83111287-83111309 ATGGATGAATTGATGGATGATGG - Intronic
1130353623 15:83111339-83111361 ATGGATGAATTGATGGATGATGG - Intronic
1130353634 15:83111400-83111422 ATGAATGGATGGATGGATGATGG - Intronic
1130387294 15:83422912-83422934 ATGAAAGAACACAGGGATCATGG - Intergenic
1131626856 15:94129506-94129528 ATAAATTAACAGGTGGGTAAAGG - Intergenic
1131792357 15:95978969-95978991 ATGAATAAAGAAATGAATAAAGG - Intergenic
1131816178 15:96223574-96223596 ATAAATGAGCTGATGAATAAAGG - Intergenic
1132030842 15:98437664-98437686 ATGGATGGACGGATGGATGACGG + Exonic
1132319062 15:100911491-100911513 ATGAATGAGCAAATGAATGATGG - Intronic
1132653923 16:1033813-1033835 ATGGATGGATAGATGGATGATGG - Intergenic
1133121413 16:3611158-3611180 ATGAATGAATGGATCGGTAAGGG + Intronic
1133554397 16:6891096-6891118 ATGAATGAATGGATGGATATTGG - Intronic
1133563022 16:6967216-6967238 ATGTATAAACAAATGGATGATGG - Intronic
1133617216 16:7488703-7488725 ATGAATGTATAGCTAGATAAGGG - Intronic
1133617225 16:7488842-7488864 ATGAATGTATAGATAGATAATGG - Intronic
1134231180 16:12431848-12431870 ATGAAAGAACAAATGAATGAAGG - Intronic
1134309910 16:13066547-13066569 TTGAATGAACTGATTGATAATGG + Intronic
1134315366 16:13113926-13113948 ATGAATGAACAAATGAATAATGG - Intronic
1134460803 16:14427742-14427764 AGGAATGAGCAAATGGAAAAGGG + Intergenic
1134488468 16:14677903-14677925 AAGAATGAATGGATGGATGATGG + Intronic
1134632236 16:15765157-15765179 ATGAATGAATAAATGGATAGAGG + Intronic
1134685539 16:16155592-16155614 ATGAATGGAAGGATGGATGAGGG - Intronic
1136071373 16:27789544-27789566 ATAAATGAAGAAATGCATAATGG + Exonic
1136071407 16:27789776-27789798 ATGGATGAATGGATAGATAATGG + Exonic
1136071468 16:27790214-27790236 ATGAATGGATGGATGGATAATGG + Exonic
1136227678 16:28869953-28869975 GTGAATGAACACATGAATCATGG + Intronic
1136290811 16:29270303-29270325 ATGGATGGATGGATGGATAAAGG + Intergenic
1137386142 16:48044181-48044203 ATGAATGGATGGATGGATGATGG - Intergenic
1138244035 16:55453097-55453119 ATGGATGGATGGATGGATAAAGG - Intronic
1138512367 16:57516041-57516063 ATGGATGAACCAATGGGTAAAGG - Intronic
1138537938 16:57669679-57669701 ATGAATGCGCAAATGGAGAATGG - Intronic
1139218774 16:65157381-65157403 ATGAATGAATGAATGTATAAGGG + Intergenic
1140014011 16:71164523-71164545 GACAATGAACAGATGAATAAAGG + Intronic
1140413607 16:74757172-74757194 ATCAATAGAAAGATGGATAAAGG + Intronic
1140578614 16:76202368-76202390 ATGTATGATCAGATGGAACAGGG + Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141031964 16:80596923-80596945 ACGAATGAACAGAAGAATGACGG + Intergenic
1141042894 16:80687418-80687440 ATGAATGGATAGATGGATGGTGG + Intronic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1141483729 16:84324964-84324986 ATGGATGAATAGATTGATAGAGG - Intronic
1141619786 16:85231001-85231023 ATGGATGGACAGATGGATGATGG + Intergenic
1141619820 16:85231182-85231204 ATGGATGGACAGATGGATGATGG + Intergenic
1141619847 16:85231335-85231357 ATGGATGGACAGATGGATGATGG + Intergenic
1141650012 16:85387932-85387954 ATGGATGGATGGATGGATAAAGG + Intergenic
1141854770 16:86673574-86673596 GTGAATGGACAAATGGATCAAGG - Intergenic
1141854832 16:86673856-86673878 ATGAATGAGTAGATGGATGAAGG - Intergenic
1141854847 16:86673943-86673965 AGGGATGAACAGATGGATGGGGG - Intergenic
1141854894 16:86674102-86674124 ATGAATGGGTAGATGGATGAAGG - Intergenic
1203142273 16_KI270728v1_random:1775896-1775918 ATGAATGGATGAATGGATAAAGG - Intergenic
1143533155 17:7517967-7517989 ATGAATGAAAAAATGGAGAGAGG - Intergenic
1143766321 17:9139903-9139925 ATGGATGAATGGATGGATGATGG - Intronic
1144354544 17:14432383-14432405 ATGAATGAGCACATGAATGAAGG + Intergenic
1144482846 17:15641754-15641776 ATGAATGGATGGATGGATGATGG + Intronic
1144580655 17:16457218-16457240 ATGAATGAATTTATGGATGAGGG - Intronic
1144915840 17:18723277-18723299 ATGAATGGATGGATGGATGATGG - Intronic
1145262410 17:21362340-21362362 ATGAATGGATGGATGGATGATGG + Intergenic
1146826734 17:36029614-36029636 GTGGATGAACAGATGGACAGAGG - Intergenic
1146939193 17:36832296-36832318 ATGGATGGACAGATGGATGGTGG - Intergenic
1147027977 17:37605500-37605522 ATACATAAACAGATGTATAAAGG + Intronic
1147977503 17:44256183-44256205 ATGGATGAATAGATGGATAATGG - Intronic
1148236049 17:45969896-45969918 ATGTATGATCAAATGGATAATGG - Intronic
1148823047 17:50371776-50371798 ATGAATGAATAGATGTTTAAAGG - Intronic
1149064275 17:52461536-52461558 ATGAATTAACAGATTGTCAAGGG - Intergenic
1149259320 17:54861705-54861727 ATGAATGAAATGAAGGAAAATGG - Intergenic
1149295322 17:55256860-55256882 ATGCATTAACAGATGGGGAATGG + Intergenic
1149382787 17:56110596-56110618 ATGAATGAACAAATGAGTGAAGG + Intergenic
1149453737 17:56770531-56770553 GTGTATGAATAGATGGATGATGG - Intergenic
1149453747 17:56770610-56770632 ATGGATGGATAGATGGATGATGG - Intergenic
1149466367 17:56883013-56883035 ATTAATGAATACATGGATATTGG + Intergenic
1150584142 17:66502161-66502183 ATCCATGCACAGATGCATAATGG - Intronic
1150752279 17:67875825-67875847 ATGAATGAACACATAGTTTAAGG - Intronic
1151353377 17:73544599-73544621 ATACATGGACAGATGGATAATGG + Intronic
1152251609 17:79215473-79215495 CTCAAGGAACAGATGGAGAAAGG - Intronic
1152314051 17:79569798-79569820 GTGTATGAACAGATGAATTATGG + Intergenic
1152314060 17:79569854-79569876 AGGAATGGACAGATGGATTATGG + Intergenic
1152314090 17:79570076-79570098 AGGAATGGACAGATGGATTATGG + Intergenic
1152314119 17:79570294-79570316 AGGAATGGACAGATGGATTATGG + Intergenic
1152473806 17:80504454-80504476 ATGGATGCACAGAGGGAAAAAGG + Intergenic
1153065924 18:1045093-1045115 ATCAATGAACGAGTGGATAAAGG + Intergenic
1153381338 18:4442993-4443015 ATGAATGAATGGATTGACAATGG + Intronic
1153466072 18:5389180-5389202 ATGAATGAACACATTGATAAAGG - Intergenic
1153744303 18:8161765-8161787 ATGAATGAGCACGTGGGTAAAGG - Intronic
1153758008 18:8302740-8302762 ATGAATGGTTAGATGGATGATGG + Intronic
1154508748 18:15070891-15070913 ATGAATGAATAGTTGCATAATGG - Intergenic
1156926114 18:42582025-42582047 ACAAATGAACAGATAGATATGGG + Intergenic
1157133605 18:45032513-45032535 ATGAGTGAAGAGATGAATGAAGG - Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158258729 18:55585536-55585558 AAGAAAGAACAGAGTGATAATGG - Intronic
1158430449 18:57380754-57380776 ATGAAAGAACAAATGGGTAATGG + Intergenic
1158897405 18:61927962-61927984 ATGTGAGAACAGATTGATAAAGG - Intergenic
1158975876 18:62711386-62711408 TTGAAAGAACAAATTGATAAAGG - Intergenic
1159174003 18:64811207-64811229 AGGAATTAAAAGTTGGATAAAGG + Intergenic
1159526630 18:69600415-69600437 ATGCCGGGACAGATGGATAAAGG - Intronic
1159614104 18:70560327-70560349 GTCTATCAACAGATGGATAAAGG + Intergenic
1160253588 18:77226666-77226688 ATGAAGAAACTGATGGATATGGG + Intergenic
1160526659 18:79542553-79542575 ATGAATGAATGGATGGATGGTGG - Intergenic
1160681772 19:414952-414974 ATGGATGGACAGATGGAAAATGG + Intergenic
1161227518 19:3153953-3153975 ATGTATGAGTAGATGGATAATGG + Intronic
1161242828 19:3231988-3232010 ATGAATGGATGGATGGATGATGG + Intronic
1161258516 19:3322891-3322913 GTGGATGGATAGATGGATAAAGG + Intergenic
1161287552 19:3476822-3476844 ATGAGTGAATAGATGGGTGATGG + Intronic
1161449218 19:4335247-4335269 ATGAATGCATGGATGGATGATGG - Intronic
1161498838 19:4602114-4602136 ATAAATGAATGGATGGATTATGG + Intergenic
1161633119 19:5369343-5369365 GTGGATGAATAGATGGATGATGG - Intergenic
1161768977 19:6221247-6221269 ATGAATGAATGGATGGATGAGGG - Intronic
1161785082 19:6319498-6319520 ATGAATGAACGAATGAATGAAGG - Intronic
1161857888 19:6776197-6776219 ATGGATGAGCAGATGGATGGAGG - Intronic
1161982882 19:7638988-7639010 ATGGATGGACAGATGGATGGAGG - Intronic
1161999404 19:7733673-7733695 TTAAATGAAAAAATGGATAAGGG - Intronic
1162062871 19:8107378-8107400 ATGAATGGGTAGATGGAGAATGG + Intronic
1162085816 19:8248562-8248584 ATGGGTGGACAGATGGATGATGG + Intronic
1162085902 19:8248974-8248996 ATGAATTAACAGATGAATGATGG + Intronic
1162085923 19:8249094-8249116 ATGGGCGAACAGATGGATGATGG + Intronic
1162216913 19:9142562-9142584 ATCAATAAACAGATACATAATGG - Intronic
1162362779 19:10229991-10230013 ATGAATGAACCAATGAACAAAGG + Intronic
1162535296 19:11260070-11260092 ATGGATGAACAGATGAATATAGG + Intronic
1163382681 19:16979163-16979185 ATGAATGGATGGATGGATAGTGG - Intronic
1163382706 19:16979295-16979317 ATGGATGAATAGATGGATGGAGG - Intronic
1164516357 19:28939594-28939616 ATCAATCAACAAGTGGATAAAGG + Intergenic
1164811692 19:31162472-31162494 ATGAATGAGTAAATGGATGACGG + Intergenic
1165204273 19:34170749-34170771 ATGAATGAACAGCAGGATGAAGG - Intergenic
1165843095 19:38801144-38801166 ATGGATGGGTAGATGGATAAAGG + Intergenic
1165931205 19:39360359-39360381 ATGAATGAATATATGAATCAAGG + Intronic
1165988238 19:39789456-39789478 ATCAATCAACAAGTGGATAAAGG + Intergenic
1166273369 19:41732987-41733009 ATGAAGGAGCAGATGGATGAGGG - Intronic
1166449513 19:42886233-42886255 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166460811 19:42986526-42986548 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166478106 19:43146516-43146538 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1167077605 19:47258813-47258835 ATGAATGAATGAATGAATAATGG - Intronic
1167086853 19:47315932-47315954 ATGGATGGATGGATGGATAATGG - Intronic
1167218680 19:48182875-48182897 ATGAATGAACGGATGAATGGAGG - Intronic
1167233755 19:48301637-48301659 ATGGATGAACAGATGGATGTGGG + Intronic
1167233848 19:48302112-48302134 ATGAATGGATGGATGGATATAGG + Intronic
1167981535 19:53280278-53280300 ATCAATCAACCGGTGGATAAAGG - Intergenic
1168508267 19:56954585-56954607 ATGGATGGATGGATGGATAAGGG - Intergenic
925299513 2:2800658-2800680 ATAAATCACCAGAAGGATAATGG + Intergenic
925358552 2:3261341-3261363 ATGAATGAGCAGAAGGCTGAGGG + Intronic
925745375 2:7039237-7039259 ATGGATGGAGAGATGGATGATGG + Intronic
925847833 2:8049718-8049740 CTGAAAGAAGAGATGGATGAAGG - Intergenic
925925605 2:8667993-8668015 ATGAATGGATGGATGGATGAAGG + Intergenic
925925634 2:8668156-8668178 AGGAATGGACATATGGATAAAGG + Intergenic
925925640 2:8668184-8668206 ATGGGTGAATGGATGGATAAAGG + Intergenic
925925649 2:8668234-8668256 ATAAATGAATGGATGGATGAAGG + Intergenic
925925667 2:8668328-8668350 ATGGATGGACGGATGGATGAAGG + Intergenic
925925686 2:8668416-8668438 ATGGATGGACGGATGGATGAAGG + Intergenic
926267584 2:11339233-11339255 ATGTATTGATAGATGGATAAAGG + Intronic
926378465 2:12259868-12259890 ATGAATGAATAAATGAATGAGGG + Intergenic
926887086 2:17607747-17607769 ATAAATTAACAAATGAATAAAGG + Intronic
927462472 2:23310869-23310891 ATGACTGAACAAATGAATAAGGG + Intergenic
928621104 2:33088689-33088711 ATTAATGAACAGGTACATAAAGG + Intronic
931160660 2:59686724-59686746 ATGAATGAACAGATGAATAGAGG - Intergenic
931494500 2:62787684-62787706 ATGAAAGAATAGATGAAAAAAGG + Intronic
931856049 2:66302727-66302749 ATGAGTAAACAGATGAATAAAGG - Intergenic
931880598 2:66566221-66566243 ATGAAAGAACACAAGGATACAGG + Intronic
931956432 2:67431214-67431236 ATAAATAAACATATGTATAAAGG - Intergenic
932027609 2:68151365-68151387 CTGAATGAAGAGAAGGATAGAGG - Intronic
932323209 2:70837116-70837138 ATGGATGAATGGATGGATAGAGG + Intergenic
933296807 2:80500325-80500347 ATGAATGAATAAATGGATGGTGG - Intronic
933563806 2:83924185-83924207 ATGAATGAATGGAGGGATGATGG - Intergenic
933820046 2:86102966-86102988 GTGTATGAATAGATGGATAGAGG - Intronic
934613895 2:95759599-95759621 ATGAATGAATGGATGGATGGAGG + Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935610284 2:105016109-105016131 ATGAGTGTCTAGATGGATAAAGG + Intergenic
935637136 2:105257998-105258020 ATGAATGAATGAATGGAAAATGG + Intergenic
936244610 2:110815958-110815980 GTGAATGGACAGATGGATGATGG + Intronic
936523065 2:113224242-113224264 ATGAATTAAAAGATGGATGGAGG + Intronic
937065820 2:119016803-119016825 ATGAATAGATAGATGGATACAGG + Intergenic
937436709 2:121887430-121887452 CTGAATGAACAAATGAATGATGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938108034 2:128546613-128546635 ATGGATGCATGGATGGATAATGG - Intergenic
938108082 2:128546855-128546877 ATGAATGAATGGGTGGATAATGG - Intergenic
938108109 2:128546969-128546991 ATGGATGCATGGATGGATAATGG - Intergenic
938108119 2:128547012-128547034 ATGGATGAATGGGTGGATAATGG - Intergenic
938108156 2:128547180-128547202 ATGGATGGATAGATGGAGAATGG - Intergenic
938737592 2:134200587-134200609 ATGAGTGAATAAATGGAGAAAGG - Intronic
938771411 2:134504394-134504416 ATGAATATACACATGGATGATGG + Intronic
939085101 2:137708942-137708964 ATGAGTGGAAAGATGAATAAAGG + Intergenic
939283274 2:140093054-140093076 AGGAATGCAAATATGGATAAGGG + Intergenic
939310776 2:140472228-140472250 ATGAATGAATAAATGAATGATGG + Intronic
939514060 2:143144218-143144240 ATGAATATACACATGCATAAAGG + Intronic
940051006 2:149464770-149464792 AGAAAAGACCAGATGGATAATGG + Intronic
940090194 2:149906904-149906926 TTGACTGAAGAGAAGGATAATGG - Intergenic
940535750 2:154941433-154941455 ATGAGTGAACATATGCCTAAGGG - Intergenic
941503796 2:166314566-166314588 ACCAATGAATAAATGGATAAAGG + Intronic
941560564 2:167039295-167039317 ATAAATGAATAGATTAATAAAGG - Intronic
941618109 2:167745793-167745815 ATGCATCCACAGATAGATAATGG - Intergenic
941949813 2:171143111-171143133 ATGAATGCACGAATGGACAAAGG + Intronic
942122034 2:172787548-172787570 ATGAATGAATAGATAAATGAAGG + Intronic
942662660 2:178282620-178282642 AGGAAGGAAGAGATGGCTAAGGG + Intronic
942779573 2:179625518-179625540 ATATATAAACAGATGAATAAAGG + Intronic
942871598 2:180740821-180740843 ATGAATCACAAGATGTATAATGG - Intergenic
943169830 2:184384656-184384678 ATGTGAGAACAGATGGAGAACGG - Intergenic
943887468 2:193239959-193239981 ATGATTGAACAGATCAATGAGGG - Intergenic
944383123 2:199134804-199134826 ATGAATTCACAGATGCAAAATGG + Intergenic
945000685 2:205346845-205346867 ATGCATGAACTGAAGGATAATGG - Intronic
945341759 2:208664431-208664453 ATAGATGAACAGATGGGTGAGGG + Intronic
945690505 2:213028654-213028676 AGGAATGAACAGTTGGACATTGG - Intronic
945901389 2:215541544-215541566 ATGAATTAACATATTGATAATGG - Intergenic
947062638 2:226183559-226183581 CTGAATGAATAAATGAATAACGG + Intergenic
947938816 2:234030745-234030767 ATGAATAAATAAATGCATAAAGG - Intergenic
1168865712 20:1084717-1084739 ATGAATGAATAAATGAATGATGG + Intergenic
1169012429 20:2261544-2261566 ATGAAATAATGGATGGATAAGGG - Intergenic
1169649307 20:7849248-7849270 ATGAGTGAAAGGATGGAAAAAGG + Intergenic
1170011060 20:11724483-11724505 AGGAATGCAAATATGGATAATGG - Intergenic
1170590636 20:17768751-17768773 ATAAATAAACAGATGAAAAAGGG + Intergenic
1170757744 20:19219373-19219395 TTGAATGAACAAATGGGTGAAGG - Intronic
1171289616 20:23974704-23974726 ATGGGTGGACAGATGGACAATGG - Intergenic
1172179914 20:32996607-32996629 TTGGAAGAACAGATGGATAAGGG - Intronic
1172783316 20:37450184-37450206 ATGGATGAATGGATGGACAAAGG - Intergenic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1172978777 20:38925961-38925983 ATGAATGAATACATGGTTAAAGG + Intergenic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1173057691 20:39632049-39632071 ATTAATGAACAAATGAATGAAGG - Intergenic
1173556239 20:43968065-43968087 GTGAATGAATAGATGGGTGAGGG - Intronic
1173564949 20:44032036-44032058 AAGAAAGAACAGAAGCATAATGG + Intronic
1173871520 20:46344999-46345021 ATGGATGGAGAGATGGATAATGG - Intergenic
1173951056 20:46993532-46993554 ATGAATGAACAAATGAATGAAGG - Intronic
1174174050 20:48633964-48633986 ATGGATGGACGGATGGATGATGG + Intronic
1174288176 20:49486808-49486830 ATAAATGAACTGATGGAGAAAGG - Intergenic
1174405542 20:50300714-50300736 ATAAATGGAGAGATGGATGATGG + Intergenic
1175086500 20:56463861-56463883 ATGAATGAACGAAAGGAAAAGGG - Intergenic
1175131302 20:56791744-56791766 ATGGGTGGACAGATGGATAGAGG - Intergenic
1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG + Intergenic
1175302408 20:57952291-57952313 ATGGATGGATAGATGAATAATGG - Intergenic
1175754151 20:61518765-61518787 ATGGATGAAAGGATGGATGATGG - Intronic
1175754183 20:61518980-61519002 ATGGATGAATGGATGGATGAAGG - Intronic
1175779195 20:61671645-61671667 ATGGGTGAATGGATGGATAATGG + Intronic
1175817351 20:61890245-61890267 ATGGATGCATAGATGGATAATGG + Intronic
1175817363 20:61890306-61890328 ATGGATGGATAGATGGATGATGG + Intronic
1175817369 20:61890345-61890367 ATGTATGGATAGATGGATAATGG + Intronic
1176421447 21:6519466-6519488 ATGAATGAACAGATGAAGGGAGG - Intergenic
1176789328 21:13300856-13300878 ATGAATGAATAGTTGCATAATGG + Intergenic
1177093785 21:16805277-16805299 ATAAATAAACAGATGAAAAAAGG + Intergenic
1177237283 21:18409026-18409048 ATGAATGAACTCATGGAATATGG - Intronic
1177521164 21:22228097-22228119 ATGGATGGACGGATGGATGATGG - Intergenic
1177717631 21:24860048-24860070 ATGAATGATTACATGTATAATGG + Intergenic
1177988488 21:28009017-28009039 ATGAATGAATAGTTGCATAATGG + Intergenic
1179125937 21:38590648-38590670 ATGGATGAATACATGGATGATGG - Intronic
1179343407 21:40533630-40533652 ATGGATGGACAGATGGATGGAGG - Intronic
1179474340 21:41633678-41633700 ATGGATGGACAAATGGATAATGG - Intergenic
1179623649 21:42634720-42634742 GTGGATGAATAGATGGACAATGG - Intergenic
1179623662 21:42634834-42634856 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623676 21:42634944-42634966 GTGGATGAATAGATGGACAATGG - Intergenic
1179623690 21:42635050-42635072 GTGGATGAATAGATGGACAATGG - Intergenic
1179623705 21:42635164-42635186 GTGGATGAACAGATGGACAATGG - Intergenic
1179623720 21:42635278-42635300 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623732 21:42635384-42635406 GTGGATGAATAGATGGACAATGG - Intergenic
1179623744 21:42635490-42635512 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623759 21:42635604-42635626 GTGGATGAATAGATGGACAATGG - Intergenic
1179679520 21:43008965-43008987 ATGAATGAACAGACACATTATGG + Intronic
1179696937 21:43127782-43127804 ATGAATGAACAGATGAAGGGAGG - Intergenic
1180024918 21:45155630-45155652 ATGCATGGAGAGATGGATGATGG - Intronic
1180024926 21:45155700-45155722 ATGGATGAATAGATGGGTGATGG - Intronic
1180948399 22:19709245-19709267 ATGAATGAAGAGATGTGAAATGG - Intergenic
1181298649 22:21863088-21863110 ATGACTGGTCAGATGTATAAGGG - Intronic
1181363986 22:22359719-22359741 ATAAACCAACAAATGGATAAAGG - Intergenic
1181536744 22:23550218-23550240 ATGAATGGAAAGATGGATGGAGG - Intergenic
1181787885 22:25240508-25240530 ATGAAAGAGAAGTTGGATAATGG - Intergenic
1181819620 22:25465544-25465566 ATGAAAGAGAAGTTGGATAATGG - Intergenic
1181885772 22:26021303-26021325 TTAAATGAACTGATGAATAAGGG - Intronic
1181958979 22:26609466-26609488 ATGAATGGATGCATGGATAAAGG + Intronic
1182006529 22:26964797-26964819 ATGAATGGATAGATAGATTAGGG - Intergenic
1182006546 22:26964873-26964895 ATGAATGGATAGATAGATTAGGG - Intergenic
1182048503 22:27295734-27295756 ATGGATGGATGGATGGATAATGG + Intergenic
1182060690 22:27395040-27395062 GTGAGTGAGCAGATGGATGAGGG + Intergenic
1182594192 22:31405521-31405543 ATGAATAAACTGAGGGAAAAAGG - Intronic
1183303975 22:37072197-37072219 ATGAATGGATGGATGGATGATGG + Intronic
1183303999 22:37072322-37072344 ATGGATGAATGGATGGATGATGG + Intronic
1183304035 22:37072523-37072545 ATGGATGAATGGATGGATGATGG + Intronic
1183304038 22:37072542-37072564 ATGGATGAATGGATGGATGATGG + Intronic
1183304080 22:37072749-37072771 ATGGATGGATAGATGGATGATGG + Intronic
1183304122 22:37072980-37073002 ATGGATGGATAGATGGATGATGG + Intronic
1184321301 22:43744104-43744126 ATGAATGAATGGATGGGTTATGG + Intronic
1184414668 22:44345394-44345416 ATGAGTGAACAGATGGTAGATGG + Intergenic
1184460850 22:44637030-44637052 GTGAATGGATAGATGGATGATGG + Intergenic
1184460873 22:44637129-44637151 GTGAATGGATAGATGGATGATGG + Intergenic
1184828435 22:46968926-46968948 ACGAGTGGACAGATGGATATGGG - Intronic
1184991045 22:48170278-48170300 ATGAATGAATGGATGGAAAGAGG - Intergenic
1185005498 22:48274179-48274201 ATGAATGGATGGATGGATGAAGG - Intergenic
1185018791 22:48361145-48361167 ATGAATGGATAGATAGATGATGG + Intergenic
1185018810 22:48361329-48361351 ATGAATGGATAGATAGATGATGG + Intergenic
1185018852 22:48361708-48361730 ACGAATGGATAGATGGATGATGG + Intergenic
1185104449 22:48859291-48859313 ATGAATGGATGGATGGATGATGG - Intergenic
1185165589 22:49260430-49260452 ATGGATGAATGGATGGATGATGG - Intergenic
1185212921 22:49581940-49581962 ATGGATGGACAGATGAATAATGG - Intronic
949543752 3:5054553-5054575 TTGAATGAACTGATGAAGAAGGG - Intergenic
949629076 3:5902840-5902862 TTGAATGAACAGATCGTTGAAGG + Intergenic
949845357 3:8364686-8364708 ATGAATGAATGGATGGATGAAGG - Intergenic
950083066 3:10237350-10237372 ATGAAAGAACAGCTGGGTCAGGG + Intronic
950175697 3:10872726-10872748 ATGAATGAACAAATGGGTGGAGG + Intronic
950526920 3:13529589-13529611 TTGAATAAATAAATGGATAAAGG - Intergenic
951798695 3:26571146-26571168 ATGAATGGATGAATGGATAAAGG - Intergenic
952088729 3:29858193-29858215 ATGAATTAAAAAATGGAAAAAGG - Intronic
952573453 3:34745382-34745404 ATGGATGGAAAGATGGATAGTGG + Intergenic
952683796 3:36126091-36126113 ATGACTGAAAAGATGGAAAAAGG + Intergenic
952977911 3:38711674-38711696 CTGAATGAACAGGTAGATGAAGG + Intronic
953370961 3:42388061-42388083 ATGAATGAACAGGGGGGAAAAGG - Intergenic
954623675 3:52010403-52010425 ATGGATGGACAGATGGATAGAGG - Intergenic
954718200 3:52537580-52537602 ATGGATGAACAGAAGGACTAAGG - Intronic
954975314 3:54688449-54688471 ATGAATGAACAAATGAAGGAGGG + Intronic
955200284 3:56845821-56845843 ATGAATAAAGAAATGAATAAAGG + Intronic
955215580 3:56982698-56982720 ATGAATGAGGAAATGGATGATGG + Intronic
955216874 3:56991265-56991287 ATGAATGAGCAAATGGGGAAAGG - Intronic
955824263 3:62928672-62928694 ATGGATGAATAGATGGATGGGGG + Intergenic
956819257 3:72938225-72938247 ATGGATGTATAGATGGATAGGGG + Intronic
956900830 3:73714292-73714314 ATGGATTAAGAGATGGAGAAAGG - Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957642671 3:82877234-82877256 ATGACTGAATAAATGGCTAAAGG + Intergenic
958457630 3:94351473-94351495 ATGCATGATTAGATGGGTAATGG - Intergenic
958955666 3:100463655-100463677 ATGAATGAAATGAGGGAAAAGGG + Intergenic
960269623 3:115659487-115659509 ATGAATGAACAAATGCATGCTGG - Intronic
960440273 3:117678317-117678339 ATGAATGAAAGGATGAATAAAGG - Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
962170347 3:133095106-133095128 ATTAATGAAGAGATTGTTAATGG + Intronic
962410100 3:135133413-135133435 ATGGATGGACAGATGGACAGAGG + Intronic
962543932 3:136412238-136412260 ATGAATGAATAAATGGAGAAAGG + Intronic
962804076 3:138914887-138914909 ATGGATGAATGGATGGATGAAGG + Intergenic
963059815 3:141216309-141216331 ATGAATGAATGAATGGATGATGG + Intergenic
963565753 3:146928206-146928228 CTGAATGAATAAATGAATAAAGG - Intergenic
963859313 3:150291340-150291362 ATCAATGAAGGGTTGGATAAAGG - Intergenic
964371658 3:156006391-156006413 ATGAATGAACCAATGAAGAAAGG + Intergenic
964555118 3:157928662-157928684 ATGAAGGGAAAGATGGATATTGG - Intergenic
964946136 3:162225990-162226012 ATGAATTAAAAGATAGATATAGG - Intergenic
965115264 3:164480338-164480360 ATGAATCAACATACAGATAATGG - Intergenic
965129699 3:164681264-164681286 ATGAATGTATGGATGAATAAAGG + Intergenic
965315568 3:167185821-167185843 ATTAATGTACATATGGAAAATGG - Intergenic
965356563 3:167681487-167681509 ATGAATGAATGGATGGATCAGGG + Intergenic
965428503 3:168557703-168557725 ATCAATGGATTGATGGATAAAGG + Intergenic
966010207 3:175065979-175066001 ATGAGTGAAAGGATGTATAACGG + Intronic
966045431 3:175542885-175542907 ATGAATAAACAGGAGGAAAATGG + Intronic
966063336 3:175786426-175786448 ATGAATGAAATGAAGGAGAAGGG - Intronic
967410444 3:189161611-189161633 AAGAGTGAAAAAATGGATAAAGG - Intronic
968189035 3:196654090-196654112 ATGAATGAACAACTGGAGAGTGG - Intronic
968598371 4:1496920-1496942 ATGGATGGATGGATGGATAATGG + Intergenic
968598424 4:1497280-1497302 ATGGATGGATGGATGGATAATGG + Intergenic
968598469 4:1497552-1497574 ATGGATGAAGATATGGATGATGG + Intergenic
969510739 4:7616392-7616414 ATGGATGGATAGATGGATTATGG - Intronic
969528493 4:7716524-7716546 GTGAATGAATAGATGGATGGTGG - Intronic
969528517 4:7716657-7716679 ATGAATGAATAGATAGATGGTGG - Intronic
969571570 4:8012025-8012047 ATGAATGGACAGATAGTTAAAGG - Intronic
969571584 4:8012087-8012109 ATGGATGGGCAGATGGATGATGG - Intronic
969612265 4:8234017-8234039 ATGAATGGATGGATGGATGATGG - Intronic
969612291 4:8234179-8234201 ATGGATGAATGGATGGATGATGG - Intronic
969674077 4:8605377-8605399 ATGAATGAATGGGTGGATGATGG - Intronic
969782223 4:9415409-9415431 GTTTATGAACAGATGGATAAAGG - Intergenic
969837104 4:9850884-9850906 ATGAATGCACAAATGGACACTGG + Intronic
970311004 4:14782481-14782503 ATGGATAAACAGATGAATATAGG + Intergenic
970452529 4:16185172-16185194 ATGCTGGAACAGTTGGATAAAGG - Intronic
970705789 4:18800507-18800529 AAGACTGGACAGATGGATCAGGG - Intergenic
971198632 4:24492295-24492317 ATGAATGGATAGATAGATATAGG + Intergenic
971787240 4:31120247-31120269 AAGAATGGAAAGATGTATAAGGG - Intronic
971990515 4:33886565-33886587 ATGAAAGAACAGCTGGAAGAGGG - Intergenic
972058102 4:34829242-34829264 ATGAATGAATAAATTAATAATGG - Intergenic
972214106 4:36875534-36875556 ATGAATGAATAAATGAATAGAGG + Intergenic
972752487 4:42005798-42005820 ATTAATGAATAAATGAATAAAGG - Intronic
972820919 4:42701015-42701037 ATGAATGAAATGAAGCATAAAGG - Intergenic
972920893 4:43940052-43940074 ATGAATAAATAGATAGGTAATGG - Intergenic
973011809 4:45084867-45084889 ATGAATGAATAGACGGACACTGG + Intergenic
973198886 4:47477391-47477413 ATGAATGAACATCCTGATAATGG + Intergenic
974734021 4:65905309-65905331 ATGAAAGAACATATAGACAAAGG + Intergenic
975436785 4:74363204-74363226 ATCAATGAACAGTAGGATAGAGG - Intergenic
975462507 4:74670942-74670964 ATGAATGAATATATGAAGAAAGG + Intergenic
975517766 4:75265925-75265947 ATTAATCAACAAGTGGATAAAGG + Intergenic
976169467 4:82288015-82288037 ATGAATGAACAGATGTGAAGCGG - Intergenic
976256415 4:83105255-83105277 ATCAATGAACAAATGAATGAAGG - Intronic
976449329 4:85168664-85168686 TTGAATGATCAGATGGATGTTGG + Intergenic
976526601 4:86099257-86099279 ATGAATTAGCACATGTATAAAGG + Intronic
976781462 4:88763264-88763286 ATGAATGAACGAATGGGAAAGGG - Intronic
977919984 4:102632301-102632323 ATGAATGAAGTGAAGGATGAGGG + Intronic
978151733 4:105444167-105444189 ATGAATGAACAGTTTGGTGAAGG + Intronic
978260699 4:106754031-106754053 ATCAATTATCAAATGGATAAGGG + Intergenic
978695707 4:111575480-111575502 AGGAATTAATAGATGGATAGAGG - Intergenic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
979026541 4:115584537-115584559 ATGAATAAACAGAAGGCTAGTGG - Intergenic
979427981 4:120591614-120591636 GTGAATGAACAAATGGATACAGG + Intergenic
979588287 4:122446706-122446728 AAGAATGAAGAGAGGAATAAAGG - Intergenic
980245695 4:130238093-130238115 TTGAATGAATGCATGGATAAAGG + Intergenic
980523344 4:133959127-133959149 ATGAATGAACAAATGTATTTTGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981777112 4:148381876-148381898 TTGCATGAACAGATGCATAGAGG - Intronic
982587820 4:157264850-157264872 ATTTATGAACAAATGGCTAAAGG - Intronic
982929303 4:161382269-161382291 CAGAATGAAGACATGGATAAGGG - Intergenic
983249965 4:165332138-165332160 AAAAATGTACATATGGATAAAGG - Intronic
983622127 4:169772920-169772942 CTGAATGAATGGATGGATGAAGG - Intergenic
984041083 4:174734551-174734573 ATAATTGTACATATGGATAATGG - Intronic
984136555 4:175947943-175947965 ATGAATAAAAAGATGAATGAAGG + Intronic
984317890 4:178151333-178151355 ATAAATGAACAAATGAATAGAGG - Intergenic
984674341 4:182529672-182529694 ATAAATGAACAAATGAATGAAGG - Intronic
985075383 4:186208944-186208966 ATAAAGGAACAGAAGGAAAAAGG - Exonic
985314430 4:188640493-188640515 AGGAAGGGACAGATGGAGAAAGG - Intergenic
985480502 5:107502-107524 CTGCATGAGCAGATGGGTAAGGG - Intergenic
985709207 5:1418855-1418877 ATGGATGGATGGATGGATAATGG - Intronic
985709249 5:1419062-1419084 TAGGATGGACAGATGGATAATGG - Intronic
985837191 5:2280239-2280261 ATGAATGGACAGATGGGTGGTGG + Intergenic
986072880 5:4304434-4304456 CTGGATGAATAGATGGATGATGG - Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986659676 5:10047780-10047802 CTGAATGATGAGCTGGATAATGG + Intergenic
987451914 5:18095590-18095612 ATGAATAAAAAGATGAATACAGG + Intergenic
987946884 5:24621290-24621312 ATGAATAAATAAATGGATATGGG - Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988495681 5:31743682-31743704 ATGGATGAACTGAAGGATGAAGG - Intronic
988865929 5:35335050-35335072 ATGAATGAACCAATGAATGAAGG - Intergenic
989126211 5:38054613-38054635 ATAAATCAACAGCCGGATAAAGG - Intergenic
989321493 5:40139934-40139956 ATGAATGTACAGATGAGTAGAGG + Intergenic
989437627 5:41433431-41433453 AGCCATGAACAGATGGATATTGG + Intronic
990887398 5:60610148-60610170 ATGAATGAATACATGAATGAAGG + Intronic
991234357 5:64376783-64376805 CTGAATGAACAGACAAATAAGGG + Intergenic
991405419 5:66296462-66296484 AGGAATGAAGAGATGGAGCATGG - Intergenic
992389839 5:76320296-76320318 AGGAATGAATAGATGGAGCATGG + Intronic
992846606 5:80755647-80755669 CTGAGGGAACAGATGGAAAAAGG + Intronic
993096417 5:83484322-83484344 ATGGATGAATAGATAGATGATGG - Intronic
994717886 5:103345960-103345982 ATGCAAAAACAGATGGATAATGG - Intergenic
995806873 5:116063215-116063237 ATGAATGAATAAATGAATAATGG - Intergenic
996139664 5:119890712-119890734 AAGAATGAACAGAGGGAATATGG - Intergenic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996876258 5:128243597-128243619 ATGAGTGGATAGATGGATGATGG + Intergenic
997487940 5:134247697-134247719 ATGAAGGAACAGAGGGAGAAAGG + Intergenic
997569388 5:134914541-134914563 ATGGAGGAACAGAGGGACAAGGG + Intronic
997890146 5:137668847-137668869 ATGAATCAACAGATGAATCAGGG + Intronic
998522018 5:142809731-142809753 ATGGATGGACAGATGAATGAAGG - Intronic
998578237 5:143341183-143341205 AAGAATGAACAATAGGATAATGG + Intronic
998602586 5:143600272-143600294 TTGAATGAATAAATGGATTAAGG + Intergenic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
999445012 5:151632319-151632341 ATGGATGCATGGATGGATAATGG + Intergenic
999726339 5:154441361-154441383 ATGGATGGATAGATGGATGATGG - Intergenic
999746741 5:154598182-154598204 ATGGATGAATGGATGGATGATGG + Intergenic
999749752 5:154618895-154618917 ATGAATCAGCAGATGGATGTGGG + Intergenic
999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG + Intergenic
1000865877 5:166514127-166514149 CTGAATGAACACATCAATAAAGG - Intergenic
1000901958 5:166921903-166921925 ATGAATGAACAAATGAATGAAGG + Intergenic
1000956463 5:167549833-167549855 ATGAATGCATAGAAGTATAATGG - Intronic
1001487444 5:172129540-172129562 ATGAATGAACAAGTGGATGGAGG - Intronic
1001517038 5:172363163-172363185 ATGGATGGACAGATGGATGGAGG - Intronic
1001751459 5:174134668-174134690 ATGGATGGATGGATGGATAATGG - Intronic
1001865677 5:175103022-175103044 ATGAATGGATAGATGGATGATGG + Intergenic
1001872867 5:175171882-175171904 ATGGATGAATAAATTGATAATGG - Intergenic
1001899772 5:175416890-175416912 ATCAATGAACAAATGGATCGTGG - Intergenic
1002598469 5:180339656-180339678 ATGAAAGGACAGAGGGATGATGG - Intronic
1002641936 5:180634713-180634735 AAGAATGGTCAGATGGATGATGG + Intronic
1002819944 6:715599-715621 ATGCATAAACAGATGGAAAATGG + Intergenic
1003171316 6:3723964-3723986 ATGAATGAAGGAATGGATGAAGG - Intronic
1003520586 6:6855434-6855456 TTGAATGAATGGATGGAAAATGG - Intergenic
1004088855 6:12478949-12478971 ATGAATATATAGATGGATGAAGG + Intergenic
1005118089 6:22360502-22360524 ATGAATGAATATTTGGAAAAAGG + Intergenic
1005228719 6:23673942-23673964 AGGCAAGAACAGGTGGATAAGGG - Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1005695043 6:28343938-28343960 AAGCATGAAAAGATGGACAAAGG + Intronic
1006285836 6:33093142-33093164 ATGAAGGAGAAGATGGAGAATGG + Intergenic
1006706141 6:36023158-36023180 ATGGATGGATGGATGGATAAGGG - Intronic
1006865195 6:37203747-37203769 ATGAATGATGTGATGGAGAATGG - Intergenic
1007283887 6:40733616-40733638 ATGGATTAATAGATGAATAAGGG + Intergenic
1008351245 6:50492869-50492891 ATGAATGAATAGATGATCAATGG + Intergenic
1008419276 6:51278305-51278327 ATGAATAAACAAAAGCATAAAGG - Intergenic
1008422135 6:51313640-51313662 ATGGATGAATGGATGGATGATGG - Intergenic
1008463222 6:51800179-51800201 ATGGATGAACAAGTGGTTAAAGG - Intronic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008741163 6:54610117-54610139 ATGAATGAATGGAGGGATCAAGG - Intergenic
1008752517 6:54753688-54753710 ATTAATGAAGAAATTGATAACGG - Intergenic
1008832609 6:55785184-55785206 ATGAAAGAACAAATTGATATTGG + Intronic
1008835515 6:55822545-55822567 ATTAATGAAAAAATGAATAATGG - Intronic
1009784220 6:68311286-68311308 ATTTATGAACAAATGGTTAAAGG + Intergenic
1009797397 6:68488758-68488780 ATAAATGAATAAATGGATATTGG + Intergenic
1010816733 6:80366679-80366701 ATGGATGAATGGATGGATAGAGG - Intergenic
1011477524 6:87762640-87762662 ATGCCTGAAAAGATGGAGAAAGG - Intergenic
1012442684 6:99276257-99276279 ATGAATGAATAAATGAATACAGG + Exonic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013783716 6:113756268-113756290 GTGAGTGAACAGGTGGATGAGGG - Intergenic
1015038023 6:128681111-128681133 ATCAATCAACAAGTGGATAAGGG - Intergenic
1015141544 6:129939856-129939878 ATGAATGAATGGATGGATGATGG - Intergenic
1015418124 6:132973769-132973791 ATGAATGGACAGATCTAAAAAGG + Intergenic
1015651877 6:135471598-135471620 ATGAATGAACAAATGTATTTGGG - Intronic
1015856200 6:137627046-137627068 ATGAATGGATACATGGATAGAGG - Intergenic
1015987923 6:138904260-138904282 ATGAGTGACAAGATGGCTAAAGG + Exonic
1016423625 6:143911691-143911713 ATGAAAGAAAAAATGGTTAAGGG - Intronic
1016620373 6:146102474-146102496 TGGAATGAGCAAATGGATAAAGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017233479 6:152096566-152096588 ATGGATGAACAAATGGCTCATGG + Intronic
1017305691 6:152915903-152915925 ATAAATGACCACATTGATAAGGG - Intergenic
1017659036 6:156656056-156656078 ATGAATGAATGGATGGATGAGGG - Intergenic
1017788601 6:157776042-157776064 GTGGATGAACAGAAGGAAAATGG + Intronic
1017821766 6:158054062-158054084 ATGGCTGAATGGATGGATAATGG - Intronic
1018257034 6:161931112-161931134 ATGAATGAACTCATGGATGTGGG + Intronic
1018853166 6:167655635-167655657 ATGGATGAATGGATGGATGATGG + Intergenic
1019345542 7:528314-528336 ATGAATGGATGGATGGATTATGG + Intergenic
1019776027 7:2912715-2912737 ATGGATGGATGGATGGATAAGGG - Intronic
1020365095 7:7372466-7372488 ATGAATAAACAGGTTGATATCGG - Intronic
1020885896 7:13819065-13819087 AAGAAGCAGCAGATGGATAAGGG + Intergenic
1022052643 7:26692950-26692972 ATAAATTAAAAAATGGATAAAGG + Intronic
1022133852 7:27429165-27429187 ATGGATGAACAGAAAAATAATGG + Intergenic
1022327073 7:29342180-29342202 ATGAATGGGTAGATGGATGAGGG + Intronic
1022908979 7:34882095-34882117 ATGAATGGATGGATGGATGATGG + Intergenic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1023150201 7:37194910-37194932 ATGAATGAATAGATCAATTAAGG - Intronic
1023504168 7:40882913-40882935 ACGAAGGAACAGATGGAGATGGG - Intergenic
1023523710 7:41075745-41075767 AGGACTGAAGAGTTGGATAAAGG + Intergenic
1024189550 7:46992228-46992250 ATACATGTACAAATGGATAATGG + Intergenic
1024367960 7:48544639-48544661 AGAAATGAAAAGATGTATAAGGG - Intronic
1025120088 7:56294529-56294551 ATGGAGAGACAGATGGATAAAGG + Intergenic
1025851655 7:65249514-65249536 ATGTATGAAAAGATGGAAATGGG + Intergenic
1026203561 7:68235896-68235918 ATGAATGAATGGATGGATGAAGG + Intergenic
1026244731 7:68609110-68609132 ATACATGGATAGATGGATAATGG + Intergenic
1026275188 7:68870217-68870239 ATGGATGGATAGATGGATGATGG + Intergenic
1026696941 7:72603305-72603327 ATGGATGGACAGATAGATGATGG + Intronic
1026782463 7:73278453-73278475 ATGGATGGATAGATAGATAAGGG - Intergenic
1026903596 7:74050238-74050260 ATGAATGAGTGGATGGATAGAGG - Intronic
1026904276 7:74053907-74053929 ATGAATGGGTAGATGGATGAGGG + Intronic
1026956575 7:74380060-74380082 ATGTATGAACAGAAGTATGAGGG + Intronic
1027215631 7:76181720-76181742 ATGAATCAACAAATAGAAAAAGG + Intergenic
1027536836 7:79413885-79413907 TGGAATAAACAGATGAATAATGG - Intronic
1027760649 7:82274872-82274894 ATGAATGAATGAATGAATAATGG + Intronic
1027830263 7:83168004-83168026 AAAAATGCACAGATGGATAGAGG - Intergenic
1028894472 7:96025699-96025721 ATGAATGAACAAATAGGTATTGG + Intronic
1029599822 7:101557213-101557235 ATGAATGAATGAATGCATAAGGG + Intronic
1030350236 7:108476742-108476764 ATGGATGAATGAATGGATAAAGG + Intronic
1030487137 7:110183750-110183772 AACAATGAACAGATTGAAAAGGG - Intergenic
1030542932 7:110855633-110855655 ATAAATTGACAGATGGCTAAGGG - Intronic
1030996687 7:116367986-116368008 ATGAATGAAAACAAGGAAAAGGG - Intronic
1031090015 7:117343095-117343117 ATCAATCAACAAATGGATAAAGG - Intergenic
1031165223 7:118219820-118219842 ATGAAAGAATTAATGGATAAAGG + Intronic
1032495486 7:132358601-132358623 TTGAATGAACACATGCATTAAGG - Intronic
1032911827 7:136441153-136441175 ATCAATGAGTAGATAGATAAAGG - Intergenic
1033423226 7:141220819-141220841 ACAAATGAACAAATGGATGAAGG - Intronic
1034516782 7:151587314-151587336 ATAAACAAACAGATGGAGAAGGG + Intronic
1034883634 7:154780991-154781013 ATGAGTGAATGGATGGATGATGG + Intronic
1035014362 7:155751954-155751976 ATAAATGAACAAATAGATGAAGG - Intronic
1035288554 7:157822215-157822237 ATGAGTGTATAGATGGATAATGG - Intronic
1035288587 7:157822445-157822467 ATGAGTGGATAGATGGATGATGG - Intronic
1036054993 8:5241855-5241877 ATGAATAGACAGATACATAATGG + Intergenic
1036076665 8:5509698-5509720 ATCAAGGTAGAGATGGATAATGG + Intergenic
1036645623 8:10610156-10610178 AAGAAGGAACAGAAGGAGAAGGG - Exonic
1036836907 8:12079034-12079056 GTTTATGAACAGATGGATAAAGG + Intergenic
1036858699 8:12325280-12325302 GTTTATGAACAGATGGATAAAGG + Intergenic
1036896990 8:12644151-12644173 ATGAGTGAATAGGTGGATAGAGG + Intergenic
1037747597 8:21659317-21659339 ATGAATGAATAAATAGATAAAGG - Intergenic
1037921302 8:22808083-22808105 CTGAATGAATGGATGGATAGAGG - Intronic
1038440913 8:27570192-27570214 ATGGATGAAGGGATGGATGAAGG + Intergenic
1038619948 8:29132616-29132638 ATGAATGCTCAGATGGCAAAAGG + Intronic
1038694642 8:29795519-29795541 ATAAATGAACAAAGGGATAAAGG + Intergenic
1038774609 8:30517351-30517373 CAGAATGAAAAGAAGGATAAGGG - Intronic
1039209205 8:35192824-35192846 CTGATTGAAAAAATGGATAAAGG - Intergenic
1041046335 8:53890409-53890431 ATGAATAAAAAAATGGATACAGG - Intronic
1041413749 8:57584678-57584700 ATGAATGAATGAATGGAGAACGG + Intergenic
1041540773 8:58982389-58982411 AAGAATGAAAAGATGGAGATAGG - Intronic
1041638252 8:60168004-60168026 ATCAATCAACAAGTGGATAAAGG + Intergenic
1042964821 8:74339217-74339239 AGGAAAGAAAAGATGGATAAAGG - Intronic
1042966806 8:74362357-74362379 AGGAATCAACAGAAGGAGAAAGG - Intronic
1043338834 8:79211915-79211937 ATGAAAGAAAAGATAGAGAAGGG + Intergenic
1044124122 8:88437038-88437060 ATGAAAGAAAAAATGGGTAAAGG + Intergenic
1044789973 8:95837302-95837324 ATGAATGAATAGATGAATCAAGG - Intergenic
1044953460 8:97455802-97455824 ATGGATAAATAGATGAATAAAGG - Intergenic
1045397579 8:101776173-101776195 ATGAATGATCAGACTGAAAATGG + Intronic
1045692326 8:104772851-104772873 ATGAATGAATAAAGGAATAAAGG + Intronic
1045808726 8:106196505-106196527 ATGTAAGAAGAGATGGATAGAGG + Intergenic
1045937686 8:107700413-107700435 ATGGATCAACAGATGGATGATGG + Intergenic
1046041974 8:108916658-108916680 GTGAATTAACAAATGGATGAAGG - Intergenic
1046089868 8:109488886-109488908 ATGAACAAACAGATGATTAAAGG + Intronic
1046485223 8:114878863-114878885 TTGAATGAACTGATTGATGATGG - Intergenic
1046772039 8:118126023-118126045 GTGAATGAACAAATGAATCAAGG + Intergenic
1046844346 8:118899353-118899375 ATGACTGAATAAATGAATAAAGG - Intergenic
1046935944 8:119885835-119885857 ATTAATTGACAGATGGATAGAGG - Intronic
1047306781 8:123659075-123659097 ATGGATGGATAGATGGATGATGG - Intergenic
1047306784 8:123659094-123659116 ATGAATGGATGGATGGATGATGG - Intergenic
1047306802 8:123659191-123659213 ATGGATGGATAGATGGATGATGG - Intergenic
1047333774 8:123917148-123917170 ACGGATGAATGGATGGATAAAGG - Intronic
1047351654 8:124080110-124080132 ATGAATGACCAAATGAACAATGG + Intronic
1047926799 8:129690081-129690103 ATGAATGACCAGATAAATGATGG + Intergenic
1047952339 8:129945237-129945259 ATGAATGAACAAATGGATTAGGG - Intronic
1048169808 8:132095384-132095406 ATGAATGAGCACATGGTTAAGGG + Intronic
1048196961 8:132339299-132339321 ATGAATGAATAAATGAGTAACGG - Intronic
1048294169 8:133202469-133202491 ATGAGTGAACACATGGACTAGGG + Intronic
1048787959 8:138071729-138071751 ATGAGTGAACAGGTGGGTAGAGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049042169 8:140120762-140120784 ATGAATGAATGGATGGATGTTGG - Intronic
1049320653 8:141994541-141994563 ATGAATGGATGCATGGATAATGG - Intergenic
1049320685 8:141994658-141994680 ATGAATGGATGGATGGATAGTGG - Intergenic
1049320720 8:141994808-141994830 ATGAATGGATGGATGGATAGTGG - Intergenic
1049320748 8:141994905-141994927 ATGAATGGATGGATGGATAGTGG - Intergenic
1049364272 8:142229175-142229197 ATGGATGGACAGATGGTGAATGG + Intronic
1049833131 8:144714586-144714608 ATGGATGAACAGATACAGAATGG - Intergenic
1050015621 9:1230280-1230302 ATGAATGATCAGTTAGACAATGG + Intergenic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1050411117 9:5366226-5366248 ATGAATGTACACATAGTTAAAGG - Intronic
1051121511 9:13757090-13757112 ATGAACGAACAAATGGATGATGG - Intergenic
1051372525 9:16370672-16370694 ATGAATGCACAGTTGAATCATGG - Intergenic
1051842247 9:21412264-21412286 GTGAATGGGCAGAAGGATAAAGG - Intronic
1052333046 9:27290541-27290563 ATGGATGTACACATGTATAAAGG - Intronic
1052646794 9:31246658-31246680 AGGAAAGAAGAGATGGTTAATGG - Intergenic
1053896867 9:42751081-42751103 ATCAATGAATGAATGGATAAAGG + Intergenic
1054454248 9:65421401-65421423 ATGGATGAGTGGATGGATAATGG + Intergenic
1054729569 9:68687037-68687059 ATGAATGACCAGATGGCGACAGG - Intergenic
1054918877 9:70522019-70522041 ATGAATGAACAAATGAATAATGG - Intergenic
1054970862 9:71084979-71085001 GTCAATGATCAGATGGCTAAAGG - Intronic
1054987063 9:71274096-71274118 ATGGATGAACTAATGGATAAGGG - Intronic
1055858585 9:80722252-80722274 ATGAATGAACAAAAGAACAAAGG - Intergenic
1057082630 9:92184424-92184446 ATGGATAAATGGATGGATAATGG - Intergenic
1057278321 9:93688997-93689019 AGCAATGAACAAATGGAAAATGG + Intergenic
1057715408 9:97491277-97491299 ATTTAAGAACAGATGGATAATGG - Intronic
1058078570 9:100676228-100676250 ACAAATGAACAGATGGATCTGGG + Intergenic
1058756509 9:108087747-108087769 ATGAATGAACAAATTAATTAAGG + Intergenic
1058909965 9:109511971-109511993 ATAAATGAACAAATGGATCTTGG + Intergenic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059365505 9:113783693-113783715 ATAGATGAATAGATGGATGATGG + Intergenic
1059849235 9:118318709-118318731 ATGGATCAACGGATGGAAAAAGG + Intergenic
1059934885 9:119299780-119299802 ATCAGTGGACATATGGATAAAGG - Intronic
1060399070 9:123337120-123337142 ATGAATGAACAAATGAATGAAGG - Intergenic
1060743712 9:126116355-126116377 ATGAATGAATGCATGGCTAATGG + Intergenic
1061244647 9:129395186-129395208 ATGAATGAAAAAATGGATGGAGG + Intergenic
1061417477 9:130454914-130454936 ATGAATGGATGGATGGATAATGG - Intronic
1061417499 9:130455029-130455051 ATGGATGAATGGATGGATGATGG - Intronic
1061417514 9:130455113-130455135 ATGGATGAATAAATGGATGATGG - Intronic
1061417529 9:130455215-130455237 ATGAATAGACGGATGGATGATGG - Intronic
1061572889 9:131488561-131488583 AAGAATAAAGAGATGGATGAGGG - Intronic
1062092369 9:134685161-134685183 ATGAATGAATGGATGGATGGTGG - Intronic
1062092488 9:134685707-134685729 ATGGATGGATAGATGGATGATGG - Intronic
1062092506 9:134685793-134685815 ATGGATGGATAGATGGATGATGG - Intronic
1062092820 9:134687455-134687477 ATGAATGGATGGATGGATGATGG - Intronic
1062172270 9:135141566-135141588 ATGAGTGGACAGATGGATGATGG + Intergenic
1062201320 9:135304333-135304355 ATGAGTGGATAGATGGATGATGG + Intergenic
1062201342 9:135304435-135304457 ATGAATGGATAGATGGATGATGG + Intergenic
1062201393 9:135304644-135304666 ATGAGTGGATAGATGGATGATGG + Intergenic
1062281326 9:135753106-135753128 ATGGATGGAGAGATGGATGATGG + Intronic
1185481895 X:452689-452711 ATGATAGAATAGATGGATGATGG - Intergenic
1185546998 X:953845-953867 CTGAATGAATGGATGGATGAGGG - Intergenic
1185611443 X:1395726-1395748 ATGGATGGATGGATGGATAATGG + Intergenic
1185611447 X:1395745-1395767 ATGGATGGATGGATGGATAATGG + Intergenic
1185611456 X:1395802-1395824 ATGGATGGATGGATGGATAATGG + Intergenic
1185638903 X:1575471-1575493 ATGAATGAACAGATGATGGATGG + Intergenic
1185762670 X:2700597-2700619 GTGCATTAACGGATGGATAAAGG - Intronic
1185778462 X:2825233-2825255 ATAAATAAATAGATAGATAATGG - Intergenic
1185832952 X:3318792-3318814 ATCAATGAATGAATGGATAAAGG + Intronic
1185883520 X:3761207-3761229 ATGAATGTATGGATGGATGAGGG + Intergenic
1185918221 X:4059854-4059876 ATATATGGATAGATGGATAAGGG - Intergenic
1186150435 X:6669189-6669211 ATGAATGGATAGATTGATGATGG + Intergenic
1186150470 X:6669474-6669496 ATGAATGAATGGATGGAGAGTGG + Intergenic
1186188187 X:7042097-7042119 ATAAATGAAAAGAGGGAGAAGGG - Intergenic
1186669657 X:11756848-11756870 ATGAATGAACAGATTGATTTAGG - Intergenic
1186697411 X:12051749-12051771 TTGAATAAACAGATGGATGGAGG - Intergenic
1187048523 X:15674126-15674148 ATGAATGAATGAATGGCTAATGG + Intergenic
1187094490 X:16132118-16132140 ATGCATGAAGAGAGGAATAAAGG + Intronic
1187761215 X:22587887-22587909 ATGAATGTGCAAATGTATAAGGG - Intergenic
1188029951 X:25253202-25253224 ATGAATGAACAAATGAATGAGGG + Intergenic
1188761500 X:34037105-34037127 ATCAATGGATAAATGGATAAAGG + Intergenic
1189214943 X:39314849-39314871 AGGAGTGGACAGATGGAGAAAGG - Intergenic
1189301303 X:39954510-39954532 ATGAATGAACAAATGAAGGAAGG + Intergenic
1189728937 X:43998387-43998409 ATAAATAAACATATGGATGAAGG - Intergenic
1190110299 X:47585193-47585215 ATCCATCAACAGATGTATAAAGG + Exonic
1190219072 X:48499355-48499377 ATGGATGGACAGATGGACAGTGG + Intergenic
1190473506 X:50806073-50806095 ATGAATGAACAAAGGGGCAATGG + Intronic
1190708097 X:53047663-53047685 ATGAAGGAACCAATGGATGAAGG + Intergenic
1190936910 X:55005981-55006003 ATGGATGGACTGATGGATGATGG + Intronic
1190952450 X:55160643-55160665 ATGAAAGAATACATTGATAAAGG + Intronic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193853997 X:86576043-86576065 ATGAATGAATGGATGAAGAAAGG - Intronic
1194341418 X:92711033-92711055 ATCACTGAACAAATGTATAATGG + Intergenic
1195001580 X:100647987-100648009 ATGAATGAACAAAGGCATGAAGG - Intronic
1195086179 X:101416606-101416628 ATCAATGAATGGGTGGATAATGG - Intergenic
1195089156 X:101442014-101442036 ATAAATGAATGGGTGGATAACGG - Intronic
1195235814 X:102897224-102897246 ATGAAGGAGAAGAAGGATAAGGG + Intergenic
1195858200 X:109353192-109353214 ATGAATGAGAAAATGGATAGAGG - Intergenic
1196632176 X:117954414-117954436 ATGGATGGATGGATGGATAAAGG + Intronic
1196798793 X:119523871-119523893 ATGAATGAACAAGTGGAGACTGG + Intergenic
1196800793 X:119541549-119541571 ATTACTGAAAAGATGGAGAATGG - Intronic
1197164753 X:123364721-123364743 GTCCATGAACAAATGGATAAAGG + Intronic
1197909790 X:131468983-131469005 AGGAATAAACAGATGGAGTAAGG - Intergenic
1198558033 X:137816880-137816902 ATCAATGGATAAATGGATAATGG - Intergenic
1198709648 X:139487456-139487478 ATAAATGGACAGGAGGATAAGGG + Intergenic
1198954521 X:142113260-142113282 ATGGATGAATAGATGGAACACGG - Intergenic
1199450717 X:147976227-147976249 TTGAGTGAATGGATGGATAAAGG - Intergenic
1199595760 X:149504818-149504840 ATGGATGAATAGATGGAAAGAGG + Intronic
1199664041 X:150082575-150082597 GTGACTGAATAGATGGATGAGGG + Intergenic
1199921539 X:152409968-152409990 ATCAATGAATAAATGGGTAAAGG + Intronic
1199951471 X:152709543-152709565 AAGAATGGACAGATTAATAAAGG - Intergenic
1199958212 X:152758917-152758939 AAGAATGGACAGATTAATAAAGG + Intergenic
1200649769 Y:5827736-5827758 ATCACTGAACAAATGTATAATGG + Intergenic
1200781575 Y:7221077-7221099 ATGGATGAATGGATGGATGATGG + Intergenic
1200781624 Y:7221469-7221491 ATGTATGAATAGATGTAAAATGG + Intergenic
1202332180 Y:23766257-23766279 ATGAAAGAAATGATAGATAAAGG + Intergenic
1202538589 Y:25903806-25903828 ATGAAAGAAATGATAGATAAAGG - Intergenic