ID: 1106067500

View in Genome Browser
Species Human (GRCh38)
Location 13:26369500-26369522
Sequence GTGGTGCACTGAACTGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106067497_1106067500 -3 Left 1106067497 13:26369480-26369502 CCATCTGTAAAACTCTTATTGTG 0: 1
1: 0
2: 0
3: 21
4: 261
Right 1106067500 13:26369500-26369522 GTGGTGCACTGAACTGAGGTTGG 0: 1
1: 0
2: 1
3: 14
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106067500 Original CRISPR GTGGTGCACTGAACTGAGGT TGG Intronic
900486888 1:2926905-2926927 GTGCTGAACTGAGCTGAGCTGGG + Intergenic
901148923 1:7087437-7087459 CTGGTCCACTGAAGGGAGGTGGG + Intronic
902016407 1:13311152-13311174 GTGGTGGAATAACCTGAGGTTGG - Intronic
902254759 1:15180927-15180949 ATGGTGCAGTGAACAGAGGCAGG - Intronic
902582800 1:17419375-17419397 GCAGTGCACTGAACTGGGCTGGG - Intronic
902991090 1:20187367-20187389 GTGGTGAAGTGAACTGAGCAGGG + Intronic
904811965 1:33169245-33169267 GGGGTGCACTTCACTGAGATGGG - Intronic
905603410 1:39273660-39273682 GAGGTTCAGTGAGCTGAGGTAGG - Intronic
910833727 1:91486450-91486472 GTGGTGCACTGTCCAGAGCTGGG - Intergenic
911105032 1:94122960-94122982 GTGGTGCTCATAACTGAGGAGGG + Intergenic
912385198 1:109268043-109268065 GACGTGCACTTCACTGAGGTGGG + Exonic
915791177 1:158673056-158673078 AGGCTGCAGTGAACTGAGGTTGG + Intronic
916418232 1:164612146-164612168 GTGGTGTATTGCACTGAAGTTGG + Intronic
917379632 1:174391187-174391209 ATGTTGAACTGAATTGAGGTAGG + Intronic
922478211 1:225921476-225921498 GTGCATCACTGAACTGAGGTGGG - Intronic
922620835 1:226987070-226987092 GTTTTGCACTGAACAGAGATTGG - Exonic
1062779295 10:186580-186602 GTGGTGAGCTGAGCTGAGATCGG + Intronic
1064625106 10:17253509-17253531 GTGGTGAATTGAACAGAGATAGG + Intergenic
1066423563 10:35284018-35284040 GGGCTGCAGTGAACTGAGATCGG + Intronic
1069838696 10:71325845-71325867 GTGGTGCACTGGACAGGGCTTGG + Intronic
1070018309 10:72557305-72557327 GTGATGAACTGAACTGACCTTGG - Intronic
1070577405 10:77689648-77689670 CTGATGAACTGAACTGAGCTGGG + Intergenic
1071496047 10:86168392-86168414 CTCGTGCACTGCACTGAGATGGG + Intronic
1072918152 10:99553092-99553114 GTGGGGCCCTTCACTGAGGTGGG - Intergenic
1075361313 10:121837907-121837929 GTGATGAAATGAACTGACGTGGG - Intronic
1076890513 10:133280976-133280998 GTGCTGGACTGAGCTGAGGAAGG + Intronic
1076890570 10:133281170-133281192 GTGCTGGACTGAGCTGAGGAAGG + Intronic
1083635561 11:64118965-64118987 GTGGTGCATGGAACTGAAGAGGG - Exonic
1086361956 11:86069003-86069025 GGGGTGGGCTGAACTGAGGCGGG - Intronic
1087412370 11:97808296-97808318 GAGGTCCTCTGAACTGAGGCTGG - Intergenic
1087912195 11:103767244-103767266 GTGTTGAACTCAACTGAGTTGGG - Intergenic
1088497529 11:110446599-110446621 GTGGTGCTCATTACTGAGGTAGG - Intronic
1088686225 11:112286623-112286645 GCTGTGAGCTGAACTGAGGTAGG - Intergenic
1089667119 11:120027472-120027494 GTGGGGCACTGGGCTGGGGTAGG - Intergenic
1091806285 12:3358540-3358562 GTCATGCACTGAACTGACTTAGG + Intergenic
1096236634 12:49932816-49932838 GTCATGCACAGAACTGAGGCGGG - Intergenic
1098847946 12:75561272-75561294 CTGTTTTACTGAACTGAGGTGGG + Intergenic
1100434475 12:94559350-94559372 ATGGTGCCCTGAACCAAGGTAGG + Intergenic
1105388193 13:19951636-19951658 GTGTTGCAGTGAGCTGAGATGGG + Intergenic
1105603592 13:21908971-21908993 GTGGTGCTCTGATCTGCGGCCGG + Intergenic
1106067500 13:26369500-26369522 GTGGTGCACTGAACTGAGGTTGG + Intronic
1106959529 13:34982361-34982383 GGGTTGCAGTGAGCTGAGGTAGG - Intronic
1107730642 13:43344921-43344943 GTGGTGCCCTGAAGTTAGATGGG - Intronic
1108584899 13:51862706-51862728 TAGGTGAACTGAAGTGAGGTTGG + Intronic
1111638683 13:90939050-90939072 AAGATGCACTGAACTGAGGTTGG - Intergenic
1114049658 14:18912910-18912932 GTGGTGCATCGACCTGAGGAAGG + Intergenic
1114112903 14:19489021-19489043 GTGGTGCATCGACCTGAGGAAGG - Intergenic
1115383865 14:32772612-32772634 GTGGTGCGCTGAAATGTGCTTGG - Intronic
1119351033 14:73965836-73965858 TTGGTCCACTGTACTGATGTGGG + Exonic
1121287676 14:92748812-92748834 GTTGCGCACTGAAGTGAGGTGGG + Intergenic
1124549898 15:30670239-30670261 CTGGGGCAAGGAACTGAGGTTGG + Intronic
1125943847 15:43697701-43697723 GTGGTAAACTGAACTGAGAGAGG - Intronic
1129052783 15:72796805-72796827 GGGGTGCACAGAACTAAGGCCGG + Intergenic
1129949966 15:79577049-79577071 GTGGTGCACTGCACTGCCTTGGG - Intergenic
1130955704 15:88626059-88626081 GTGGTGCACTGCAGGGAGGGAGG + Intronic
1131764534 15:95661053-95661075 GAAGTGTACTGAACTGAAGTAGG + Intergenic
1132028873 15:98424528-98424550 GTGGTGCAATAAGCTGATGTAGG - Intergenic
1132526022 16:415138-415160 CTTGTGCAATGAACTGTGGTAGG + Intergenic
1134326814 16:13215059-13215081 GTGGTGACCTGCACTGAGGTGGG + Intronic
1137438646 16:48479608-48479630 GAGGTGCATTGAAGTGAGGCTGG - Intergenic
1137548873 16:49423219-49423241 GTGGTGGTCTGCACTGAGCTGGG - Intergenic
1138455653 16:57119261-57119283 CTGGTCCACAGGACTGAGGTGGG + Exonic
1139641642 16:68296064-68296086 TTGCTGCACTGAAGTGAGGAGGG + Intronic
1140192043 16:72826115-72826137 ATAGTGATCTGAACTGAGGTTGG - Intronic
1148319030 17:46733559-46733581 GGGAAGCACTGAACTGAGGAAGG - Intronic
1152162040 17:78674924-78674946 GGGGTGCACTGGAGTGAGGGGGG - Exonic
1152580336 17:81162961-81162983 GTGGTGCACTGAGCCAAGGGTGG - Intronic
1154492848 18:14934437-14934459 GAGGAGCAGTGGACTGAGGTGGG - Intergenic
1156108771 18:33697996-33698018 GTGGTGCCATTAACTGAGATAGG + Intronic
1157722975 18:49939621-49939643 GTGGTGGAGGGAACAGAGGTTGG - Intronic
1158535034 18:58300686-58300708 ATACTGCACTGAACTGAGCTGGG - Intronic
1165943036 19:39424815-39424837 ATGGTGGTCTGAACTGGGGTGGG - Exonic
1168187262 19:54708255-54708277 GAGGGGCACTGGGCTGAGGTGGG + Intergenic
925570067 2:5300571-5300593 GGGGTGGAGTGAAGTGAGGTCGG + Intergenic
926703797 2:15822229-15822251 ATGGTGAATTGAACTTAGGTAGG + Intergenic
928358467 2:30643110-30643132 GCGGTGCAGTGAGGTGAGGTGGG - Exonic
931383834 2:61778511-61778533 GTGGTGGACTGAACAAAGGCAGG - Intergenic
935176480 2:100653633-100653655 GTGTTGAACTGAGCTGATGTAGG - Intergenic
936895925 2:117427388-117427410 GTGGTGCACTGACCTGCTGTGGG + Intergenic
937984123 2:127630955-127630977 GGGGTGCAATGAGGTGAGGTGGG - Intronic
938288574 2:130137647-130137669 GTGGTGCACCGACCTGAGGAAGG - Intergenic
938427014 2:131201244-131201266 GCGGTGCACTGACCTGAGGAAGG + Intronic
938467958 2:131535287-131535309 GTGGTGCACCGACCTGAGGAAGG + Intergenic
944822024 2:203440960-203440982 GCGGGGCACTGAACTGTGGAAGG + Exonic
947787888 2:232840922-232840944 GTGGTTCACTGAAATTAGGAGGG + Intronic
948792465 2:240386072-240386094 GTGCTGGGCTGGACTGAGGTGGG + Intergenic
1169530478 20:6480114-6480136 GTTCTCCACAGAACTGAGGTTGG + Intergenic
1171348976 20:24488391-24488413 GTGGAGCACTGAAGAGAAGTGGG - Intronic
1173585056 20:44176013-44176035 GTGTTGCCATGAACTGAGATGGG - Intronic
1176049220 20:63107847-63107869 GTGGGGCAGAGAACTGAGGAGGG + Intergenic
1176723371 21:10411470-10411492 GTGGGGCAATCAACAGAGGTCGG + Intergenic
1176937716 21:14885785-14885807 GAGGTGACCTGAACTGAGGTGGG - Intergenic
1179616053 21:42584076-42584098 GTGGTGCCCTTCACTGAGTTTGG + Intergenic
1180304528 22:11064238-11064260 GTGGGGCAATCAACAGAGGTCGG + Intergenic
1180468137 22:15635285-15635307 GTGGTGCATCGACCTGAGGAAGG + Intergenic
1180605726 22:17057651-17057673 GTGGTGGTCTGAACTAAGGCAGG - Intergenic
1181752825 22:25001544-25001566 GTGGTGGTCTGGACTGGGGTGGG + Intronic
1182664308 22:31945739-31945761 GTTGTACACTGAACATAGGTTGG - Intronic
1183148263 22:36015834-36015856 GTGGACCACTGAACTGAAGAAGG + Intronic
1184038649 22:41930580-41930602 GTGTTGCAGTGAGCTGAGTTGGG - Intergenic
1184493553 22:44824374-44824396 GTGGTGCACTGGACTGAGCCTGG - Intronic
950443917 3:13025290-13025312 GTGAGTCACTGGACTGAGGTTGG - Intronic
950775263 3:15344229-15344251 GTGGTGCACAAAACTGAAGATGG + Intergenic
951466045 3:23001313-23001335 GTGGATGACTGAACTGGGGTTGG + Intergenic
953310414 3:41872456-41872478 CTGGGGCAAGGAACTGAGGTTGG - Intronic
954099159 3:48355996-48356018 GTGGTACAATGAACAGGGGTGGG + Intergenic
960608092 3:119528859-119528881 GAGGTGCAGTGAGCTGAGATCGG + Intronic
964092425 3:152892576-152892598 GGGATCCACTGAACTGAGGCTGG + Intergenic
966562832 3:181342601-181342623 GTGGGGCAAGGTACTGAGGTGGG - Intergenic
967187030 3:186952880-186952902 GTTGTCCACTGAAATGAGGATGG - Intronic
969533906 4:7744361-7744383 CTGGTGCACTGAAGTGAGAATGG - Intergenic
970088757 4:12378946-12378968 TTGGTGCGCTGGGCTGAGGTAGG - Intergenic
970607681 4:17695697-17695719 GTGCCGCCATGAACTGAGGTGGG + Intronic
973243452 4:47984071-47984093 GTGGTGCTCTGAAGTCAGATAGG - Intronic
981750747 4:148090788-148090810 GTGGAACACGGAACAGAGGTGGG - Intronic
982797044 4:159658944-159658966 GTGGGTCAGTGAACTGAGGGAGG + Intergenic
990367148 5:55082703-55082725 GGGCTGCAGTGAAATGAGGTGGG - Intergenic
993856444 5:93082093-93082115 AGGGTGCACTGAACTTAGATGGG - Intergenic
996580539 5:125027924-125027946 GTGGTGGGCTGAAGAGAGGTGGG + Intergenic
996729710 5:126705282-126705304 TTGGTGAACTGAACTGAGGAAGG - Intergenic
998764867 5:145474883-145474905 GGGGTACACTGGACTGAGATGGG + Intronic
1002395373 5:178948579-178948601 CAGATGCACTGAACTGTGGTTGG - Intronic
1004189033 6:13448084-13448106 GTGGTGCCCTGAACAGAGGCAGG + Intronic
1007097607 6:39223538-39223560 GTGGTACAGAGAAGTGAGGTAGG - Intronic
1007278499 6:40693014-40693036 GTGGTGAACTGAACTGAGATGGG - Intergenic
1008759855 6:54840681-54840703 GAGGTCCACTGAGCAGAGGTGGG + Intergenic
1009640503 6:66329222-66329244 AGGGTGCAGTGAACTGAGATTGG + Intergenic
1010131830 6:72503327-72503349 GTGATGCACTTCACTGAGGGAGG - Intergenic
1010972292 6:82275799-82275821 GAGCTTCACTGAACTGAGTTGGG + Intergenic
1012602218 6:101112685-101112707 GTGGTGCTGTGTACTGAGATTGG + Intergenic
1013580654 6:111531011-111531033 GTGGGGCACTGAACAGAAGAGGG - Intergenic
1014120276 6:117716943-117716965 TTGGTGTTCTTAACTGAGGTAGG + Intergenic
1017252414 6:152295419-152295441 GTGGAGGACTGAAGTGGGGTGGG - Intronic
1024146411 7:46521982-46522004 GTGGTGACCTGAACAGAGGGTGG + Intergenic
1028220408 7:88190079-88190101 GTGCAGAACTGAACTGAGGTTGG + Intronic
1030127675 7:106169750-106169772 GTGGTGCCCTCAGCTGAGGTAGG + Intergenic
1030935796 7:115584151-115584173 GTGGTGAGATGAACTGATGTGGG + Intergenic
1031894656 7:127335312-127335334 GTGGGGGAATGAAGTGAGGTTGG + Intergenic
1032288753 7:130566939-130566961 GTGGTGCAGTGAACATAGGAGGG - Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1035261862 7:157667040-157667062 GTGGGACACTGATCTCAGGTGGG + Intronic
1035261892 7:157667280-157667302 GTGGGACACTGATCTCAGGTGGG + Intronic
1035261902 7:157667340-157667362 GTGGGACACTGATCTCAGGTGGG + Intronic
1035639840 8:1176579-1176601 GTCGTGCACTGGATTGAGATGGG - Intergenic
1035922702 8:3694667-3694689 GTGCTCCACTGAACTGCTGTGGG + Intronic
1037971148 8:23172829-23172851 ATGGGGCACTCATCTGAGGTGGG + Intergenic
1040599397 8:48869507-48869529 GTTCTCCACTGAACTGTGGTGGG + Intergenic
1043404025 8:79912376-79912398 GTGGTGTACAGATCTGAGGGTGG + Intergenic
1045344204 8:101280106-101280128 GTGGTGATCTGGACTGCGGTGGG + Intergenic
1053140668 9:35680667-35680689 GTGGTGGAGTGCACTGAGGCAGG + Intronic
1053206197 9:36188602-36188624 CTGGTGGACTGAACAAAGGTGGG - Intergenic
1053456459 9:38236703-38236725 GTGGTGCCCTGCACTGATATGGG + Intergenic
1053905907 9:42844582-42844604 TTGGTGCAGTGGAATGAGGTTGG - Intergenic
1055890191 9:81115933-81115955 TTGGTTCTATGAACTGAGGTGGG + Intergenic
1058937430 9:109781777-109781799 GTGGTGCTCTGAACTCAGAAAGG + Intronic
1061920167 9:133778348-133778370 TTGCTGGCCTGAACTGAGGTAGG + Intronic
1062161244 9:135081359-135081381 GTGGTGCATTCCACAGAGGTCGG - Intronic
1193671290 X:84389599-84389621 GTGGAGCAATGCACTGAGGCTGG + Intronic
1194217685 X:91150774-91150796 GTTTTGCACTGAATTGAGGATGG + Intergenic
1195413524 X:104595310-104595332 GAGGTGCTATGAACTGAGATAGG + Intronic
1200956593 Y:8954442-8954464 GAGGTGCAGTGAGCTGAGATTGG + Intergenic