ID: 1106068247

View in Genome Browser
Species Human (GRCh38)
Location 13:26380045-26380067
Sequence CAGCAGGAGCAGTGGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 476}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106068247 Original CRISPR CAGCAGGAGCAGTGGGATGC AGG Intronic
900164551 1:1239536-1239558 CAGCAGGAGCCAGGGGAGGCAGG - Intergenic
900191037 1:1352349-1352371 GAGCGGGAGTAGTGGGATGCGGG - Intergenic
900912635 1:5612437-5612459 CAGCAGGAACAGTGTGATTAGGG + Intergenic
901140250 1:7024534-7024556 CTGCACTAGCAGTGTGATGCTGG + Intronic
901275321 1:7986709-7986731 CCGCAGGAGCATTGAGAGGCGGG + Intergenic
901742304 1:11350295-11350317 CAGGAGGAGGGCTGGGATGCAGG - Intergenic
901756337 1:11443773-11443795 CACCAGGAGGGGTGGGATGATGG - Intergenic
901855475 1:12041806-12041828 CTGCAGGAGGAGTGGAATGGAGG - Intergenic
902064674 1:13674553-13674575 CAGGAGGGGCTGTGGGATGTTGG - Intergenic
902210430 1:14900827-14900849 CACCAGGAGGAGAGGGATGCTGG + Intronic
902308749 1:15564200-15564222 CAGCAGCAGCACTGTGTTGCAGG + Intronic
902644435 1:17788643-17788665 CAGCAAGAGGAGTGGGGTGGGGG + Intronic
902949271 1:19869058-19869080 CAGCAGTCACAGTGAGATGCAGG + Intergenic
903329949 1:22592240-22592262 CAGGAGGTGCTGTGGGATGGGGG - Intronic
903639329 1:24847990-24848012 CAGCAGGAGGTGGGGGATGCAGG - Intergenic
903848506 1:26292288-26292310 CAGCAGGATCACTGGCATCCAGG + Intronic
904374774 1:30073502-30073524 CAGCAGGTGCGGGGGGGTGCAGG + Intergenic
904470853 1:30735369-30735391 GAGCAGGAGCAGCTGGATGCTGG - Intronic
904568428 1:31442592-31442614 GAGGAGGAGCAGTGGGAAGTGGG - Intergenic
905414330 1:37794205-37794227 CACCAGGAACAGAGCGATGCAGG - Exonic
906262523 1:44405367-44405389 CAGCAGCAGCAGTAGGCGGCTGG - Exonic
906282817 1:44565815-44565837 CAGCAGGAGGACTGGGTTGCAGG - Intronic
907646807 1:56252510-56252532 GTGCAGGGGCAGGGGGATGCTGG + Intergenic
908418075 1:63932757-63932779 CAACAGGATCAGCTGGATGCAGG - Intronic
908494044 1:64676982-64677004 CAGCAGGTGCAGTCAGAGGCTGG + Exonic
908832043 1:68189119-68189141 AGGCAGGAGCAGGGAGATGCTGG - Intronic
908987735 1:70045235-70045257 CTGCAGGACCAGTGGAGTGCTGG + Intronic
909975622 1:82043092-82043114 GAGCAGGAGCAGGGAAATGCTGG - Intergenic
912474162 1:109925091-109925113 CAGCAGGAGCAGGGGAATAAGGG - Intronic
912553246 1:110497916-110497938 CAACAGGAGCAGAGGGACACTGG + Intergenic
913283797 1:117209657-117209679 CAGGAGAAGCAGTGGGTGGCAGG - Intronic
913452539 1:119001717-119001739 CCCCAGGAGCAGGGGGATCCAGG + Intergenic
914193258 1:145428999-145429021 GTGGAGGAGCAGTGGGCTGCTGG + Intergenic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
915119411 1:153619363-153619385 CAGCAGCTGCAGTGGTGTGCTGG - Intronic
915548727 1:156619260-156619282 CAGCTGGGGATGTGGGATGCAGG - Intergenic
915641448 1:157230253-157230275 CAGCAGGAGGAAGGGGATCCAGG + Intergenic
915777091 1:158501719-158501741 AAGCTGGAGCAGCAGGATGCAGG + Intergenic
916844518 1:168635699-168635721 CAGCACCAGCAGTGGGAAGCAGG + Intergenic
917977152 1:180247415-180247437 CAGCAGAAGCAGTGAAATTCTGG - Intronic
918207506 1:182322747-182322769 CAGAAGGTGTAGTGGGATGAGGG + Intergenic
918423077 1:184383925-184383947 CAGCAGGGGCAGTGGGACTGGGG - Intergenic
920305413 1:205015311-205015333 CAGGATGAGCAGTGGGAGTCTGG - Intronic
920562574 1:206949231-206949253 CAGTAGGATCAGTGGGCTCCAGG - Intergenic
922076856 1:222253666-222253688 CAGCAGAAGCAGTTGGACGTTGG + Intergenic
922424568 1:225481032-225481054 CAGCAGGGGCTGTGGGAGGCAGG - Intergenic
922540438 1:226414861-226414883 CAGCAGGGACTGTGGGAGGCAGG - Intergenic
922816535 1:228453178-228453200 TGTCAGGGGCAGTGGGATGCTGG - Intergenic
923042970 1:230332974-230332996 CAGCATGGACAGTGGGAGGCCGG + Exonic
923475198 1:234325302-234325324 CAGCTGGGGCAGCAGGATGCTGG + Intergenic
923676965 1:236088548-236088570 CACCAGGAGCACTGGGATTCCGG - Intergenic
923907504 1:238401778-238401800 CAGCCGGAGCAGGGGGAAGAGGG + Intergenic
924037620 1:239953277-239953299 GAGCAGGAGCTGTAGGATCCAGG + Intergenic
1063826646 10:9906179-9906201 GAGCAAGAGCAGTGGGCTGGAGG + Intergenic
1063967672 10:11359488-11359510 CAGCAGGCAGAGTGGGAAGCGGG - Intergenic
1064359968 10:14655691-14655713 CAGGAGGAGAGGTGGGAAGCCGG + Intronic
1064642165 10:17426126-17426148 AAGCAGGGGCTGTGGGAGGCTGG - Intronic
1065963866 10:30755048-30755070 CAGGAGGAGCACAGGGATGGAGG - Intergenic
1066410617 10:35165219-35165241 CAGCAGGAGAAGGGGGAGCCAGG + Intronic
1066419017 10:35247109-35247131 CAGCAGGGGCAGAGGCATGGAGG + Intronic
1066502524 10:36007928-36007950 CTGCAGGAGCAGTGGGCAGTGGG + Intergenic
1067704369 10:48596148-48596170 CAGCAAGGGCAGTGGGAAGCCGG + Intronic
1068261186 10:54584299-54584321 CAGAAGGATCACTTGGATGCAGG + Intronic
1068472746 10:57485752-57485774 CCACAGGAGCAGTGGTGTGCTGG + Intergenic
1069752591 10:70753827-70753849 CAGCCGGAGCTGTGGGAAGCTGG + Exonic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1070360126 10:75680254-75680276 CAGGAGTAACAGTAGGATGCTGG + Intronic
1070568302 10:77620386-77620408 AAGCAGGAGCTGTGGGAGGGAGG + Intronic
1070815201 10:79318486-79318508 CAGCAGGGACAGTGGGGAGCTGG - Intergenic
1071078448 10:81782275-81782297 CAGAAGGGGCTGTGGGAAGCAGG - Intergenic
1072098240 10:92203998-92204020 CATCAGAAGCAGTGGGAGACAGG - Intronic
1072784646 10:98271310-98271332 CGTCAGGAACAGTGAGATGCAGG - Intergenic
1073315726 10:102579411-102579433 CAGCAGGGGAGGTGGGAGGCTGG - Intronic
1074412461 10:113240137-113240159 CTGCAGGAGGAGTGGGAGGGAGG - Intergenic
1075220019 10:120576595-120576617 CAGCAGGAGCTTTGGGCTGGAGG + Intronic
1076723516 10:132403047-132403069 CTGCAGCAGCCGTGGGAAGCGGG - Intronic
1077128334 11:955383-955405 CAGCAGGTACAGGAGGATGCTGG - Intronic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077368595 11:2171287-2171309 CAGCTGGGGCAGAGGGAGGCAGG + Intronic
1077504656 11:2924408-2924430 CAGGAGGGGCCGTGGGATGGGGG + Intronic
1077506825 11:2933447-2933469 CAGCAGCTGGAGTAGGATGCGGG + Intergenic
1079100404 11:17538180-17538202 CAGCAGGGGCAGGGGGTAGCAGG - Intronic
1079298033 11:19252116-19252138 CAGTAGGGGCAGTGGGAGGTCGG - Intergenic
1079333176 11:19549974-19549996 CAGCAGAAGCCGGGGGAGGCTGG - Intronic
1079648248 11:22894238-22894260 CATCTGGAGGAGTGAGATGCAGG - Intergenic
1079945178 11:26732917-26732939 CAGCTGGAGTGGTGGGATGCAGG - Intergenic
1080273291 11:30473717-30473739 CAGAAGGAGCAGAAAGATGCAGG - Intronic
1081860951 11:46333106-46333128 CGACAGGAGCAGCGAGATGCTGG - Intronic
1083406860 11:62463593-62463615 CAGCACGCACAGTGGGATGTAGG - Intronic
1083806369 11:65076753-65076775 CAGCAGGTGCTGTGGGACCCTGG - Intronic
1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG + Intergenic
1083946659 11:65927342-65927364 CAGGAGTAGGACTGGGATGCAGG + Intergenic
1084150420 11:67285593-67285615 CAGCAGGAGCCGAGGCAAGCGGG - Exonic
1084554482 11:69867823-69867845 CAGCTGGAGCAGTGGGGCCCGGG - Intergenic
1084657877 11:70529438-70529460 CACAAGGTGCCGTGGGATGCAGG + Intronic
1084768017 11:71325002-71325024 CAGCAGGAGCGATGGGAGGGTGG + Intergenic
1085282611 11:75340912-75340934 CAGCAGCAGCAGTGTGGTGCTGG - Intronic
1085386348 11:76160384-76160406 CAGCAGGGGCTGGGGGATGAGGG + Intergenic
1086769014 11:90737510-90737532 CACCATGAGCAGTGGGATTAGGG + Intergenic
1088673700 11:112169163-112169185 CAGCAGTAGGAGTGGGAAACAGG + Intronic
1089209834 11:116792352-116792374 CAGCTGGGGCAGAGGGATGGGGG - Intronic
1089573703 11:119426354-119426376 TACCAGGAGCTGTGGGAGGCAGG + Intergenic
1089744387 11:120606857-120606879 CTGCTGGAGCAGTGGCATGGAGG + Intronic
1089757076 11:120695116-120695138 CAGCAGGAGGAGAGGGCTGGGGG - Intronic
1089865701 11:121629315-121629337 CAGGAGGGACAGTGGGAAGCTGG + Intronic
1090256141 11:125286018-125286040 CACCAGGACCAGTAGCATGCTGG - Intronic
1090428675 11:126628188-126628210 CAGACAGTGCAGTGGGATGCAGG - Intronic
1091684475 12:2551788-2551810 CAGCAGGGGCAGGCGGGTGCAGG + Intronic
1092117433 12:6019263-6019285 CATCAGGAGCAGGGTGATGCGGG + Exonic
1092459355 12:8672755-8672777 AAGCAGGAGCACGGGGAGGCGGG - Intergenic
1092884843 12:12915941-12915963 CAGCCGCAGCAGTGGGAGGAGGG - Exonic
1093105784 12:15085383-15085405 CAAGAGGATCAGTGGGATGGGGG - Intergenic
1093368686 12:18337614-18337636 GAGCTGGAGCAGAGGGAGGCGGG + Intronic
1095155607 12:38850175-38850197 CAGTAGGAACAGTGGGAGGGTGG - Intronic
1095849609 12:46787959-46787981 CATCATGGGCAGTGGGATCCTGG - Exonic
1095986200 12:48001437-48001459 TAGCTGGAGCAGTGGAATGCAGG + Intronic
1096230344 12:49893309-49893331 CAGCAGGAGCAGAGTGTGGCAGG - Intronic
1096460280 12:51818464-51818486 CCTCAGAAGCAGTGGGCTGCCGG - Intergenic
1097013919 12:55971987-55972009 CAGCAGGAGGCTTGGGATCCTGG - Exonic
1097046678 12:56191851-56191873 CAGCCTGAGCAGTGGTATGAAGG - Intergenic
1098281574 12:68867774-68867796 CAGCATGAGCAGTGGCAGCCTGG - Intronic
1098923977 12:76328762-76328784 CAGCATGAGCATTAGCATGCTGG - Intergenic
1101304369 12:103513049-103513071 AAGGAGGAGCAGTGGAATGCTGG - Intergenic
1101662140 12:106775003-106775025 CAGTGGGGGTAGTGGGATGCAGG - Intronic
1102346363 12:112163614-112163636 CAGCAGCTGCAGGGGGATGATGG + Exonic
1102481874 12:113229455-113229477 CAGCAGGGACAGGGGGACGCTGG - Intronic
1102517382 12:113458875-113458897 GAGCAGGAGCTCTGGGATCCAGG - Intergenic
1102744093 12:115234338-115234360 CAGCAAGAGCAAAGGAATGCAGG + Intergenic
1103553453 12:121751829-121751851 CAGCAGCAGCAGTTGGTTGAGGG + Intronic
1104142907 12:126005572-126005594 CATCAGGAGCTGTAGGAAGCAGG - Intergenic
1104521035 12:129475313-129475335 CAGTGAGAGCAGTGGGATACTGG + Intronic
1104711390 12:130989383-130989405 CACCAGGTGCAATGGGATTCTGG - Intronic
1104715469 12:131013317-131013339 CAGCAACAGCAATGGGATGCTGG - Intronic
1104906105 12:132214280-132214302 CAGCAGGAGCCCAGGGATGAAGG + Intronic
1105409952 13:20162960-20162982 CAGCTGGGGCAGTGGGAAACGGG + Intergenic
1105422248 13:20263625-20263647 GAGCAGGAGCAGTGGGGCTCAGG - Intergenic
1105894519 13:24706967-24706989 GAGCAGGCCCAGTGGGTTGCAGG - Intronic
1106068247 13:26380045-26380067 CAGCAGGAGCAGTGGGATGCAGG + Intronic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1109203760 13:59459286-59459308 CACCAGGAGCAGTAGGCTCCAGG - Intergenic
1112080021 13:95959302-95959324 CAACAGGAGCAATTGGAGGCAGG - Intronic
1112423078 13:99271411-99271433 CAGCTGGAGCAGAGTGATGGGGG + Intronic
1113018658 13:105857230-105857252 CAGCTGGTGCATTGGAATGCAGG - Intergenic
1113550362 13:111188241-111188263 CAGCTGAAGCTGTGGGATTCTGG - Intronic
1113650656 13:112032041-112032063 CAACAGCAGCAGTAGGTTGCTGG - Intergenic
1118107245 14:62673861-62673883 CAGTAGGGGCAGTGGGAGTCAGG - Intergenic
1118132393 14:62981688-62981710 CATCACCAACAGTGGGATGCCGG - Intronic
1118153058 14:63210469-63210491 GGGTAGGAGCAGTGGGATGAAGG + Intronic
1118395983 14:65337067-65337089 AACCAGGAGCTCTGGGATGCGGG + Intergenic
1118610106 14:67533250-67533272 CAGCAGGGGTCGTGGGCTGCGGG - Intronic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1119544756 14:75463606-75463628 GAGTAGGAGCAGTGAGATGGAGG + Intronic
1122008054 14:98722123-98722145 AGGCAGGTGCAGTGGGAAGCTGG - Intergenic
1122126670 14:99582109-99582131 CAGCGGGGGCGGGGGGATGCTGG + Intronic
1122208980 14:100162742-100162764 CAGCAGCAGGGGTGGGGTGCTGG + Intergenic
1122234944 14:100326134-100326156 CTGCAGGAGAAGTGGGCTTCAGG - Intronic
1122908948 14:104816855-104816877 TAGAAGCAGCAGTGGGATGAGGG + Intergenic
1123016145 14:105376667-105376689 CTGCAGGAGCAATAGGAGGCGGG - Intronic
1123067952 14:105627717-105627739 CAGCAGGGCCGGTGGGAGGCAGG - Intergenic
1123091633 14:105744718-105744740 CAGCAGGGCCGGTGGGAGGCAGG - Intergenic
1123179084 14:106451051-106451073 AAGCAGGAGTAGAGGGTTGCTGG - Intergenic
1123509275 15:20979829-20979851 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1123566499 15:21553576-21553598 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1123602760 15:21990862-21990884 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1124147755 15:27144286-27144308 CAGCATGATCTGTGGGCTGCTGG - Intronic
1124192343 15:27591275-27591297 CACCATGTGCAGTGGGGTGCTGG - Intergenic
1124193225 15:27598268-27598290 CACCAGGGGCTGTGGGAGGCAGG + Intergenic
1124638723 15:31381854-31381876 CAGCAGGTGAACTGGGGTGCAGG - Intronic
1125726526 15:41871123-41871145 GAGCAGGAGCTGTGGGAAGATGG - Intronic
1125782293 15:42280502-42280524 CAGCAGAAGCAGTTGGCTCCAGG + Intronic
1129651941 15:77497231-77497253 CAGCAGATGCTGTGGGAGGCTGG - Intergenic
1129712019 15:77825302-77825324 CAGCAGGAGCTGTGGGTGTCGGG + Intergenic
1129751299 15:78066455-78066477 CAGCAGAAGGGCTGGGATGCTGG + Intronic
1129832611 15:78680655-78680677 CAGCAGGTGCAAGGGGAGGCTGG - Intronic
1130053601 15:80504101-80504123 CATTTGGAGCAGTGGGACGCAGG + Intronic
1130360345 15:83179160-83179182 CACCAGGGGCAGTGGGAGGCAGG - Intronic
1130977141 15:88785340-88785362 CAGCAGGGGCTGTGGGAGGCAGG + Intergenic
1132083227 15:98885039-98885061 TAGCAGGTGCATAGGGATGCTGG - Intronic
1132156927 15:99502343-99502365 CCGCAGGAGCAGTGGCAGCCAGG - Intergenic
1132162495 15:99556108-99556130 CAGCAGGGGCCGTGGGAATCAGG + Intergenic
1202974863 15_KI270727v1_random:280664-280686 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1132770380 16:1558908-1558930 CTGCAGGAGCAGTGAGCTGATGG - Intronic
1133056762 16:3149310-3149332 CTGCAGGGCCAGTGGGAAGCTGG + Intronic
1134859875 16:17551650-17551672 CAGCCTGAGCACTGTGATGCTGG + Intergenic
1135125501 16:19806166-19806188 CTGCAGGAGCAGGAGGGTGCTGG + Intronic
1135133718 16:19872624-19872646 CATCAGGAGCAGTGTGATCAGGG + Exonic
1135839433 16:25861203-25861225 CAGCAGAAGCAGTGAGGTCCTGG + Intronic
1135988505 16:27202443-27202465 CACCAGGCTCACTGGGATGCTGG - Intergenic
1136078860 16:27838563-27838585 CAGCAGGGGCAGAGGGACACAGG + Intronic
1137322214 16:47396711-47396733 TAGCAGGATCAGTGGACTGCAGG + Intronic
1137447121 16:48538668-48538690 CAGCAGGACCAGTAAGAGGCCGG - Intergenic
1139901990 16:70335411-70335433 CAGCAGGAGGAATGGGAATCTGG + Intronic
1140452446 16:75081586-75081608 CAGCAGCAGCAGTGGGTTTTGGG + Intronic
1141557923 16:84848210-84848232 AGGCAGGAGCAGAGGGCTGCTGG - Intronic
1141779669 16:86151199-86151221 CAGCAGGAGGAGGTGGAGGCTGG - Intergenic
1142048208 16:87939841-87939863 CAGCAGGAGCAGCCGGTTCCAGG - Intergenic
1142183193 16:88681572-88681594 CAGGAGGGGCAGGGAGATGCAGG + Exonic
1142214533 16:88824176-88824198 CAGGAGGGGCTGGGGGATGCTGG + Intronic
1142359513 16:89619613-89619635 CAGAGGGAGCAGGGGGCTGCAGG - Intronic
1142481922 17:224307-224329 CAGCAGGTGGCGTGGGATGCAGG - Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142967610 17:3591031-3591053 CTCCAGGAGCAGGGGGATGGTGG + Exonic
1142996063 17:3761304-3761326 CGGCAGATGCAGTGGGACGCAGG - Intronic
1143119131 17:4596470-4596492 CAGAAGGAGGAGTGGGAGGAAGG + Intronic
1143252311 17:5532763-5532785 CAGGATGGGCAGTGGGGTGCGGG + Intronic
1143252521 17:5533804-5533826 CATCAGGGGCAGAGGGATGGAGG + Intronic
1144929674 17:18849047-18849069 CAGCAGGATCACTGGAATCCAGG + Intronic
1145103878 17:20098737-20098759 CAGCAGGAGGAGGAGGATGGAGG - Intronic
1145834224 17:27941794-27941816 CTGCAGGACCAGGGGGATTCAGG - Intergenic
1145960552 17:28884383-28884405 CAGCCGGAGCAGTGAGGTACTGG - Intronic
1146432391 17:32810020-32810042 AAGCAAAAGCAGTGGCATGCAGG + Intronic
1146692607 17:34887093-34887115 CAGCAGGAGCGATGGGATCTAGG - Intergenic
1147587169 17:41659204-41659226 CAGCAGGGGCATTGTAATGCTGG + Intergenic
1147848948 17:43426337-43426359 AAGCAGAAGCAGTGGTGTGCTGG + Intergenic
1148182951 17:45620216-45620238 CAGAAGGGGAAGAGGGATGCAGG - Intergenic
1148265906 17:46225475-46225497 CAGAAGGGGGAGAGGGATGCTGG + Intergenic
1148444251 17:47727921-47727943 CTGAAGGAGCTCTGGGATGCTGG + Intergenic
1148701007 17:49586944-49586966 CAGCAGGGGAAGTGAGATGAGGG - Intergenic
1148758077 17:49985059-49985081 CAGGAGAAGCAATTGGATGCTGG + Intergenic
1150230417 17:63546633-63546655 CATCAGGAGCAGAGGGCTGGAGG - Exonic
1150801477 17:68286458-68286480 CAGCAGGAGCCCTGGAAGGCAGG - Intronic
1150887260 17:69101616-69101638 CAGCAGCAGCAAAGGAATGCTGG + Intronic
1150959198 17:69895659-69895681 CAGCAGGAGCTGAGAGATGGAGG + Intergenic
1151317451 17:73332004-73332026 CAGTAGGAGCAGACGTATGCTGG - Intergenic
1151370048 17:73642145-73642167 CAGCAGGAGGGGTGGGATCTTGG + Intronic
1151439165 17:74117032-74117054 CAGGAAGAGGAGTGGGAGGCAGG + Intergenic
1151630708 17:75309160-75309182 CCTCAGGAGCAGTGTGATGTAGG - Intergenic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1151961959 17:77410232-77410254 CAGTAGCAGCAGTGGGATGGGGG - Intronic
1152667456 17:81579566-81579588 TGGCAGGAGCGATGGGATGCAGG - Intronic
1152698452 17:81807531-81807553 CAGCTGGAGCAGAGGGTTTCCGG - Intronic
1152946878 17:83202767-83202789 CTCCCGGAGCAGTGGGGTGCAGG + Intergenic
1153220635 18:2857825-2857847 CAGCAGGAGCAGCAGCCTGCTGG + Intronic
1153386287 18:4500685-4500707 CAGCTGGGACACTGGGATGCTGG + Intergenic
1154059622 18:11047317-11047339 CAGGAATAGCAGTGGGATGGGGG + Intronic
1154345453 18:13540034-13540056 CAGAAGGAGCTTTGGCATGCGGG - Intronic
1156411638 18:36834258-36834280 CAGAAGCAGCATTTGGATGCCGG + Intronic
1156424834 18:36998416-36998438 CAGCAGGAGCAGTGGTGTACTGG - Intronic
1157568643 18:48697657-48697679 CAGAAGGAGCACTGGGCTGGGGG - Intronic
1160007327 18:75076897-75076919 CTGCAGGCACTGTGGGATGCGGG + Intergenic
1160239775 18:77114853-77114875 CAGGGCGAGCAGTGGGCTGCAGG + Intronic
1160663866 19:313778-313800 CAGGAGGAGCACAGGGATGGCGG - Intronic
1160667972 19:342160-342182 CAGACGGAGGAGTGGGGTGCTGG - Intronic
1160865099 19:1252850-1252872 CAGCAGCAGCAGTGGCGTGGGGG + Intronic
1161582334 19:5087636-5087658 CAGCAGGAGAGGGGAGATGCTGG - Intronic
1162925647 19:13929627-13929649 CAGCTGGAGCAGGGGGGTGTGGG + Exonic
1163368771 19:16890356-16890378 CAGCAGCAGCAGCAGGTTGCTGG - Exonic
1163390962 19:17029499-17029521 AAGCAGGGGCTGTGGGAAGCAGG - Intergenic
1163827215 19:19530380-19530402 CAGCAGCAGCTGTGGGGTGGGGG - Intronic
1164540769 19:29120044-29120066 CAGCAGGACCAGAGGCATGGAGG + Intergenic
1164570704 19:29372385-29372407 CAGCAGCTACAGGGGGATGCAGG - Intergenic
1165249474 19:34517716-34517738 CAGCAGGAGCATGGTGGTGCAGG - Intergenic
1165685179 19:37813567-37813589 CAGCAGGGGCTGTGAGAGGCAGG - Intronic
1165826909 19:38710745-38710767 CAGCAGGAGCTGCTAGATGCAGG + Intronic
1165904892 19:39187696-39187718 CAGCAGGTGCAGTGGGAGCTAGG + Intergenic
1166109500 19:40613641-40613663 CAGCAGGATCAGGGGGCAGCTGG + Intronic
1166192335 19:41183310-41183332 CAGGATGAGCAGTGGGATGAGGG + Intergenic
1166353758 19:42215132-42215154 CAGCAGGGTCAGTGGGAGACAGG - Exonic
1166497684 19:43316066-43316088 CCGGAGGAGGAGTGGGAGGCGGG + Intergenic
1167376605 19:49115338-49115360 CACCAGGAGCAATGGGGTGCGGG - Intronic
1167610556 19:50506025-50506047 CAGCAGCGGCAGTGGGGAGCAGG + Exonic
1168177318 19:54634683-54634705 GAGGAGGAGCAGTAGGATGACGG - Exonic
1168195649 19:54771933-54771955 CACCAGGAGCTCTGGGATTCAGG - Intronic
924977838 2:194067-194089 CAGCAGGAGCAGTGTCTTCCCGG + Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925914528 2:8595430-8595452 GAGCAGGAAGAGTGGGAAGCGGG - Intergenic
926118126 2:10225993-10226015 CAGCAGGGGCATTGGGAGGTAGG - Intergenic
926148526 2:10411655-10411677 CAGGCTGAGCACTGGGATGCCGG - Intronic
927013703 2:18933519-18933541 CCTCAGGAGCAATGGGATCCAGG - Intergenic
928067120 2:28175724-28175746 CAGCAGTGGCAGTGGTAGGCTGG - Intronic
929392570 2:41487941-41487963 CAGCAGGACAAATGGGATGTGGG + Intergenic
930864475 2:56108960-56108982 TGGAAGGGGCAGTGGGATGCTGG + Intergenic
931163074 2:59715807-59715829 AAGCATGAGTAGTGGGTTGCAGG + Intergenic
931450660 2:62365149-62365171 CTTCAGGACCAGTGGGCTGCCGG + Intergenic
931599649 2:63990556-63990578 CAGAAGGAGCAGAGGTATCCTGG - Intronic
932651274 2:73560523-73560545 CAGCAGTGGCAGTGGGATTGCGG - Intronic
933945312 2:87281154-87281176 CAGCAGGAGCAGCGGGGTCTCGG + Intergenic
934616508 2:95774646-95774668 CAGCAGGAGGAGTGGTTTGTGGG + Intergenic
934644385 2:96049914-96049936 CAGCAGGAGGAGTGGTTTGTGGG - Intergenic
934837801 2:97606004-97606026 CAGCAGGAGGAGTGGTTTGTGGG - Intergenic
935211593 2:100943618-100943640 CAGCAGGGGCTATGGGAAGCAGG + Intronic
935383854 2:102480915-102480937 AACCAGGAGCTGTGGGAGGCAGG + Intronic
936334895 2:111580437-111580459 CAGCAGGAGCAGCGGGGTCTCGG - Intergenic
937027358 2:118710753-118710775 CAGCAGCAGCAGGGGGTGGCAGG - Intergenic
937341712 2:121095579-121095601 CAGCAGGGACAGTGGGATGTGGG + Intergenic
937387359 2:121447916-121447938 CAGCTGCAGCAGTGTGATGGTGG - Intronic
938068097 2:128292636-128292658 CAGCAAGGGCTGTGGGAAGCCGG + Intronic
938163625 2:129008190-129008212 CAGCAGGAGCAGGAGCATGGTGG - Intergenic
938743951 2:134259600-134259622 CAGCAGGCAAAGTGGGATGGGGG - Intronic
938982952 2:136543977-136543999 CAGCAGTAACAGTGGCAGGCAGG + Intergenic
939656106 2:144827475-144827497 TAGGAGGAGCAGTGGGATGAGGG + Intergenic
940931540 2:159437822-159437844 CAGCAGGATCACTTGGATCCGGG + Intronic
941646931 2:168050611-168050633 CAGAAGGAGCCGAGGGATGCAGG + Intronic
942367862 2:175247611-175247633 TAGCAGGAGCATTGTCATGCTGG - Intergenic
945400625 2:209378015-209378037 CAGCAGCAGAAGTGGTAGGCAGG + Intergenic
946154159 2:217796284-217796306 CAGGAGGGGCAGAGGGATGGCGG - Intergenic
946431980 2:219631014-219631036 CAGCAGTAGCAGCAGGATGGGGG + Intronic
946495731 2:220193395-220193417 CACCAGGAGCAGGGAGAGGCCGG + Intergenic
947522822 2:230861735-230861757 CAGGAGGAGCAGTGGGCAGAAGG + Intergenic
947722584 2:232378813-232378835 CAGCAGCAGCAGCAGCATGCAGG - Exonic
948387276 2:237588860-237588882 CACCATGACCACTGGGATGCCGG + Intronic
948402005 2:237691753-237691775 CCGCAGGGGCCGTGGGAAGCGGG - Intronic
948464374 2:238145195-238145217 CTGAAGGAGCTGTGTGATGCAGG - Intronic
949055412 2:241925546-241925568 CAGCAGGGGCTGTGGGCTGTGGG - Intergenic
1169318495 20:4612090-4612112 GAGCAGGAGGAGAGTGATGCTGG + Intergenic
1169877952 20:10318161-10318183 CGGCAGGAGTAGAGGGATACTGG - Intergenic
1170621674 20:18001621-18001643 CAGCAGTAGCAGAAGGATTCCGG + Intronic
1172775011 20:37402254-37402276 AAGCAGGAGCAGTGCTCTGCGGG - Intronic
1173211452 20:41035982-41036004 AAGCAGCAGAAGTGGGATGAAGG + Intronic
1173521436 20:43703133-43703155 CAGGAGGAGAAGGAGGATGCTGG + Intronic
1173899290 20:46575526-46575548 CAGCAGGAACAGTGGGAGGCAGG - Intronic
1174457521 20:50660137-50660159 GAGCAGGTGCTGTGGGATTCTGG + Intronic
1175226134 20:57444996-57445018 CAGCAGGAGGTGTGGGAAGCAGG + Intergenic
1175258912 20:57662904-57662926 CTGCAGGGCCGGTGGGATGCAGG + Intronic
1175584315 20:60125958-60125980 CAGCGGGAGCCATGGGATGGGGG + Intergenic
1175786128 20:61712710-61712732 CAGCAGGAGCCGTGGCGAGCTGG + Intronic
1176282009 20:64318650-64318672 CAGCAGGTGGAGTGAGAAGCGGG - Intergenic
1177834064 21:26170591-26170613 CAGCAGGAGCAGTGCCAAACCGG + Exonic
1178627933 21:34233728-34233750 CACTAGGAGCAGGGGGATGTGGG + Intergenic
1178639955 21:34337712-34337734 CAGCAGGAGACGTGGCAGGCAGG - Intergenic
1179192657 21:39136683-39136705 CACCAGAGGCAGTGGCATGCTGG - Intergenic
1179288689 21:39999613-39999635 CTTCAGGAGCAGCTGGATGCAGG - Intergenic
1180783605 22:18535082-18535104 CTTGAGGAGCAGTGGGGTGCTGG - Intergenic
1181127172 22:20709133-20709155 CTTGAGGAGCAGTGGGGTGCTGG - Intronic
1181240507 22:21474434-21474456 CTTGAGGAGCAGTGGGGTGCTGG - Intergenic
1181433519 22:22896960-22896982 CTGCAGGAGCAGGAGGATGTGGG + Intergenic
1181762783 22:25069487-25069509 CAGCATGGGGAGTGGGGTGCTGG - Intronic
1181933879 22:26426246-26426268 CAGCGAGAGCAGGAGGATGCAGG + Intergenic
1181977049 22:26737592-26737614 CTGCAGGAAAAGTGGGATGGAGG - Intergenic
1182347819 22:29679173-29679195 CTGCATCAGCTGTGGGATGCTGG - Intronic
1182701025 22:32238539-32238561 GAACTGGAGCAGTGGGTTGCTGG - Intronic
1183091662 22:35526397-35526419 CAGGAGGGGGAGTTGGATGCAGG - Intergenic
1183208141 22:36433377-36433399 AGGAAGGAGCCGTGGGATGCAGG - Intergenic
1183572181 22:38661884-38661906 CAGGAGGAGCAGTGAGAGGTCGG + Intronic
1183742484 22:39676596-39676618 CCACAGGAGCTGTGGGATGGGGG + Intronic
1184079252 22:42206936-42206958 CACCATGAGCAATGGGAAGCTGG + Intronic
1184591016 22:45483364-45483386 TAGCAGCAGCAGTGGGAAGGTGG - Intergenic
1185038723 22:48493201-48493223 CAGCACGAGCAGGTGGATGGTGG + Intronic
1185251731 22:49805552-49805574 CGGCAGGTGCACTGGGACGCTGG + Intronic
949376869 3:3400571-3400593 CAGCAGTGGCAGTGGGGTGGTGG + Intergenic
950222530 3:11207078-11207100 CAGCAGGTGCAGTGGCATGGAGG + Intronic
950660100 3:14461870-14461892 CAGCAGCAGCAGGGGGAGCCAGG - Intronic
950722187 3:14891310-14891332 CAGCAGGTGCAGAGGGCGGCTGG - Intronic
952356021 3:32584836-32584858 CAGCTGGAGCAGTGAGAGGAGGG - Intergenic
952358001 3:32602461-32602483 CACCAGGAGGCGTGGGATGCTGG + Intergenic
952853010 3:37744442-37744464 CTGCAGGAGGAGTGGGCTCCTGG - Intronic
952942490 3:38454762-38454784 CAGCAGCAGCAGCAGCATGCGGG + Intronic
953480986 3:43251927-43251949 CAGCAGGAGCAGAGAGAGACTGG - Intergenic
954414993 3:50388961-50388983 CGGCAGGCGCCCTGGGATGCTGG - Intronic
954692843 3:52404920-52404942 CAGCAGGAGCTTAGGGAGGCAGG - Intronic
954706836 3:52485481-52485503 CACAAGGAGCAGTCAGATGCTGG + Intronic
954994954 3:54872585-54872607 CAGCGGAAGCACTGTGATGCTGG - Intronic
955349524 3:58183521-58183543 CAACAGGAGAAATGGGATGTGGG + Intergenic
956882131 3:73521154-73521176 CCTCAGGAGCACTGGGTTGCCGG + Intronic
958914322 3:100031594-100031616 CAGGAGGAGCCAAGGGATGCGGG - Intronic
960312499 3:116133538-116133560 CAGGAGGATCACTTGGATGCAGG - Intronic
961057995 3:123805038-123805060 CAGCAGGAGCTGTGGACAGCTGG - Intronic
961520853 3:127466653-127466675 CTGCAGGGGCAGAGGGGTGCAGG + Intergenic
962263403 3:133928797-133928819 CAGGAGAGGCAGTCGGATGCAGG - Exonic
962379496 3:134886136-134886158 CAGCAGAAGCAGGAGGATGTGGG + Intronic
964296497 3:155239817-155239839 TGGCAGCAGCAGTGGCATGCTGG + Intergenic
964902030 3:161671210-161671232 CAGCAGGAGCAGTTGTAGGTAGG + Intergenic
964942829 3:162181797-162181819 CAGCATGTGCAGTGGGCTGCAGG - Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
966863552 3:184243814-184243836 CAGCAGGAGCAGGGTGAGGTGGG + Exonic
967128200 3:186445683-186445705 CAGCTGGAGCAGTGTGATCTCGG + Intergenic
968685973 4:1959001-1959023 CAGGAGGAGCAGTGCTAGGCAGG - Intronic
968737121 4:2303403-2303425 CACCAGGAGCCGTGGGAGCCGGG - Intronic
969128711 4:4974731-4974753 GAGCTGGAGCACTGGGTTGCAGG - Intergenic
969320820 4:6411396-6411418 CAGCAGGAGCAGCAGGAAGGAGG + Intronic
969363537 4:6680768-6680790 CAGCAGGACAGATGGGATGCAGG + Intergenic
969560771 4:7946397-7946419 AAGCAGGAGCAGAAGGATGAGGG + Intergenic
969574743 4:8030315-8030337 CAGCAGGCAGAGTGGGAGGCAGG + Intronic
970594391 4:17586633-17586655 CTGCAGGATCAGAGGGATGAGGG + Intronic
971104783 4:23512418-23512440 CAGCAGGGGCATTGGGATTTTGG + Intergenic
972217817 4:36916709-36916731 GAGAAGGAGCAGTAGGAGGCAGG - Intergenic
972298736 4:37765349-37765371 CAGTAGGATATGTGGGATGCAGG + Intergenic
972472581 4:39421424-39421446 CAGGTGGTGAAGTGGGATGCAGG + Intronic
975682700 4:76892601-76892623 CAGCAGACCCATTGGGATGCTGG - Intergenic
976676176 4:87705856-87705878 CAGCAGGTGCTGTGAGAAGCTGG - Intergenic
977278938 4:95014966-95014988 CAGCCGGAGCAGTGGCTTGCAGG + Intronic
978416868 4:108486113-108486135 CAGAAGGGGCTGTGGGAGGCAGG - Intergenic
979281725 4:118876274-118876296 AAGCAGGAAGAGTGGGAGGCAGG - Intronic
980820563 4:138010628-138010650 GAGCAGGAGCATTGTCATGCTGG + Intergenic
981513292 4:145580919-145580941 CAGCAGCAACCGTGGGATGTGGG - Intergenic
981627609 4:146776882-146776904 CAGCAGTGGGAGTGGGGTGCTGG + Intronic
983991682 4:174127666-174127688 CAGCAGGAGGTGTGGGTTACAGG - Intergenic
984947338 4:184980045-184980067 CTGCAGGAGCAGCAGGCTGCAGG - Intergenic
985196225 4:187432522-187432544 CAGCAGGAGCACTTGGCTACTGG + Intergenic
985276852 4:188245698-188245720 GAGAAAGAGCAGTGGGAGGCAGG + Intergenic
985979337 5:3449285-3449307 CAGCAGTGGCAGGGGCATGCTGG - Intergenic
986280094 5:6315700-6315722 CAGCAGGAGCAGGAGGAAGGTGG - Intergenic
987254161 5:16132107-16132129 CAGATGGTGCAGGGGGATGCAGG + Intronic
988029040 5:25739077-25739099 CAGCAGTGGCAGTGGCAGGCAGG - Intergenic
988272118 5:29031048-29031070 AAGCAGGAACTGTGGGAGGCAGG + Intergenic
990177154 5:53120441-53120463 CAGCTGGAGGAATGGGATGGAGG - Intergenic
990681050 5:58244891-58244913 TAGCAGCAACAGTGGGAGGCAGG + Intergenic
991001688 5:61789569-61789591 CTGCAGGAGCAGTTGAATTCCGG + Intergenic
993168820 5:84389434-84389456 CAGCATGAGCAGAGGGTTGGAGG - Intergenic
994097708 5:95861989-95862011 CAGCAGGAGCAATGGGCCACTGG - Intergenic
995852449 5:116560108-116560130 GAGGAGGAGCAGTGGGGTGAAGG - Intronic
996000489 5:118356079-118356101 AAGCAGGGGCTGTGGGAAGCAGG + Intergenic
997183499 5:131857956-131857978 CAGCAGCAGCAGTGGTGGGCTGG - Intronic
997732454 5:136191550-136191572 GAGCACGGGCAGTGGGAGGCCGG - Intergenic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
998250830 5:140551108-140551130 CTGCAGGAACAGTGGGCTGGAGG - Exonic
999229648 5:150054158-150054180 CAGCAGCAGCAGTGAGCTGGAGG - Exonic
999248534 5:150167922-150167944 AAGCGGGAGCAGTGGGAAGGGGG + Intronic
1001424509 5:171614672-171614694 CAGAGGCAGCAGTGGGAGGCTGG + Intergenic
1001529179 5:172450643-172450665 CAGCAGGAGCCTGGAGATGCTGG - Intronic
1001567174 5:172707204-172707226 CGGCAGGAGCAGGTGGCTGCAGG + Intergenic
1002597268 5:180332246-180332268 CGGGGGGAGCAGGGGGATGCGGG + Intronic
1003001675 6:2341422-2341444 CAGCAATGGCAGTGGGATGTAGG - Intergenic
1003974101 6:11326656-11326678 CAGGAGGGGCAGAGGGAAGCTGG - Intronic
1005856446 6:29866662-29866684 CTGCTGGAGCTGTGAGATGCAGG - Intergenic
1006433155 6:34010583-34010605 CAGCAGGAGGAGTTGGAGGTGGG - Intergenic
1007083290 6:39124223-39124245 CAGCAGCAGCAGTGCAAAGCAGG - Intergenic
1007099968 6:39239433-39239455 GAGCAGTAGCAGTGGGAAGCAGG + Intergenic
1007654691 6:43445121-43445143 CAGTGGGAACACTGGGATGCTGG - Exonic
1007747646 6:44052866-44052888 CAGCAGGTGCAGTGTGGAGCTGG + Intergenic
1015725223 6:136292705-136292727 CAACAGTAGTAGTGGGAAGCAGG + Intergenic
1016692234 6:146951108-146951130 CTGCAGGAGAAGGGGGATGCGGG - Intergenic
1018304844 6:162444138-162444160 CAGCAGGTGCAGTGAGAAGACGG - Intronic
1018379345 6:163243567-163243589 CAGCAGGAGCCGCGGGATGGTGG + Intronic
1018709551 6:166488267-166488289 CAGCAGGAGCAGGGTGTTTCCGG - Intronic
1018709556 6:166488299-166488321 CAGCAGGAGCAGGGTGTTTCCGG - Intronic
1018794274 6:167173897-167173919 CAGCGGCAGCAGTGGGAAGCCGG + Exonic
1018822045 6:167381170-167381192 CAGCGGCAGCAGTGGGAAGCCGG - Exonic
1019003938 6:168780512-168780534 GAGCAGGAGCTGTGGGCTGGCGG + Intergenic
1019489133 7:1303023-1303045 TGGCAGGAGCTGTGTGATGCTGG + Intergenic
1019729545 7:2622670-2622692 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019729556 7:2622695-2622717 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1020126741 7:5537012-5537034 ATGCAGGAGCAGTGTGATCCAGG - Intronic
1020132938 7:5569853-5569875 CAGCAGGAGCTCTGGGGTGGGGG - Intergenic
1020405481 7:7828731-7828753 GAGGAGGAGCACTGGGAAGCTGG - Intronic
1022395244 7:29982450-29982472 CAGCAGGATCAGTTGGGTCCAGG + Intronic
1022528098 7:31051332-31051354 CAGGAGCAGCTGTGGGATGGGGG + Intergenic
1022554158 7:31275256-31275278 CAGAAGGAAGAGTGGAATGCTGG + Intergenic
1023178224 7:37454337-37454359 CAGCTGGAGCAGAGGGGTACTGG - Intergenic
1023641936 7:42268122-42268144 CAGAAGAAGCACTGGGATGGTGG - Intergenic
1023663304 7:42493442-42493464 CAGCAGGAGCAGCCGGATTTTGG + Intergenic
1026536654 7:71244123-71244145 CAGTAGCAGCAGGCGGATGCTGG - Intronic
1026655460 7:72252659-72252681 TGGAAGGAGCAGTGGGATTCTGG - Intronic
1026899314 7:74028219-74028241 CAGCAGGAGCAGGAGGACTCCGG - Exonic
1027743400 7:82041081-82041103 CAGCAGGAGCATCTGAATGCAGG + Intronic
1030303130 7:107993864-107993886 CAGCAGGAACAGCAGGCTGCTGG + Intronic
1031798793 7:126214811-126214833 CAGCAGGAGCAAGAGGATGGAGG - Intergenic
1031975287 7:128089783-128089805 CAGCAGGAACAGCAGGATGGTGG - Intronic
1032084597 7:128877312-128877334 CTGCAGGGGGAGTGGGAGGCGGG + Intronic
1032312759 7:130803575-130803597 CAGCAGGAGGAGGAGGATGCTGG + Intergenic
1033131782 7:138751252-138751274 CAGCAGGGCCGGTGGGAGGCAGG - Intronic
1033412584 7:141132593-141132615 CAGCAGTGGCAGTGGCAGGCTGG - Intronic
1033967428 7:146993274-146993296 CTGCATGTGCAGTGGGCTGCTGG + Intronic
1034265866 7:149780399-149780421 TAGCAGGGGCAGTGGGCAGCAGG - Intergenic
1034348659 7:150402766-150402788 CAGGAGGAGCTGGAGGATGCGGG + Intronic
1035374647 7:158399878-158399900 CAGCAAGGGGAGTGGGAAGCGGG + Intronic
1035701006 8:1639269-1639291 CAGAAGGAGCAGTGGAAAGGTGG + Intronic
1036478660 8:9118180-9118202 CAGCAGGAGAAGTGGAAAGAGGG - Intergenic
1036582259 8:10086271-10086293 CAGGTTGAGCAGTTGGATGCTGG + Intronic
1036692039 8:10950192-10950214 CAGCAGGAGGTGAGGGCTGCTGG - Intronic
1037676126 8:21052142-21052164 CAGCAGGAGCAGTTCCATGGTGG - Intergenic
1038779477 8:30557762-30557784 AAGGAAGAGCAGTGGGAGGCGGG + Intronic
1039517163 8:38143815-38143837 CGGGAGGAGCAGAGGGCTGCAGG + Exonic
1039989190 8:42473588-42473610 AAGCAGGAACAGTGGCATGGGGG - Intronic
1040817216 8:51520751-51520773 CAGCAGGTGCTGAGGTATGCAGG - Intronic
1041359043 8:57030893-57030915 CAGCACCAGTAGTGGGAGGCAGG - Intergenic
1042874376 8:73427276-73427298 CGGCAGCAGCAGTGGGAGGAGGG + Intronic
1042932023 8:74023203-74023225 CACCAGGAGCAGAGGGTAGCAGG - Intronic
1043131810 8:76472188-76472210 CAGCAGCAGCAGTAGCATGCAGG + Intergenic
1043273009 8:78357268-78357290 CAGCAGGTGCTGTGGGAGGTGGG + Intergenic
1044711932 8:95066928-95066950 AACCAGGAGAAGTGGCATGCTGG + Intronic
1045694205 8:104789318-104789340 CAGCTGGAGCAGTAGGCTCCCGG + Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1047042142 8:121007839-121007861 CAGCTGATGCATTGGGATGCAGG + Intergenic
1047205914 8:122802928-122802950 GAGTGGGGGCAGTGGGATGCAGG - Intronic
1047338562 8:123958370-123958392 CAGCAGGAGGCGTGGGAGGGAGG + Intronic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048199911 8:132363768-132363790 AAGCAGGAGCTGTGGGATGCAGG - Intronic
1048876126 8:138838059-138838081 CAGCAGAAGCAGTGGCGTGGAGG + Intronic
1049495186 8:142926900-142926922 CAGAAGGAGGAGACGGATGCAGG - Intergenic
1049572618 8:143376351-143376373 CAGGGGCAGCAGTGGGATCCGGG - Intronic
1051995203 9:23207650-23207672 GAGGAGGAGCAAAGGGATGCGGG + Intergenic
1053009425 9:34624813-34624835 CAGCTGGAGCGGTGGGAGGCAGG + Intronic
1053495428 9:38545315-38545337 CATCAGGCGCAGTGGGCTCCAGG - Intronic
1054766219 9:69044693-69044715 CAGCTGGAGTAGGGAGATGCAGG - Intronic
1055453560 9:76452990-76453012 CAGCAGGGGCTGTGTGAGGCAGG - Intronic
1056786368 9:89595182-89595204 CAGCAGGAGCAGAGGCGAGCTGG + Intergenic
1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG + Intronic
1058656787 9:107229631-107229653 TGGCAGGAACAGTGAGATGCTGG - Intergenic
1059854327 9:118378785-118378807 CAACAGGAGCAGGGTCATGCAGG - Intergenic
1059885214 9:118737692-118737714 GAGCAGGAGCAGGGGTTTGCAGG - Intergenic
1060066352 9:120504503-120504525 AGGCAGAGGCAGTGGGATGCGGG - Intronic
1060215624 9:121736710-121736732 CAGCCAGAGCAGTGGAAGGCAGG - Intronic
1060531585 9:124350099-124350121 CAGCAGCAGCAGCAGGAAGCTGG - Intronic
1061377976 9:130237230-130237252 CAGCAGGAGCTTGGGGAGGCTGG - Exonic
1061616986 9:131786839-131786861 CAGCAGGTGCCTTGGGATGGTGG + Intergenic
1062196441 9:135276707-135276729 GAGCAGGAGGAGGGGGATCCGGG - Intergenic
1062199990 9:135297505-135297527 CCGCAGGACCCGTGAGATGCTGG + Intergenic
1062554116 9:137106360-137106382 CAGCAGGAGTGGGGGGCTGCGGG - Intronic
1062637469 9:137499051-137499073 GAGGAGGAGCCCTGGGATGCTGG + Intronic
1185691072 X:2155647-2155669 CCCCAGGAGCAGTGAGAGGCAGG - Intergenic
1186948004 X:14590950-14590972 CAGCAGGAGCTGTGGTGTGGAGG + Intronic
1188722916 X:33544577-33544599 CAGCAGTGGCAGTGGTAGGCTGG - Intergenic
1189375455 X:40463027-40463049 CAGCAGGAGCTGGAGCATGCAGG + Intergenic
1189926467 X:45960089-45960111 CAGCAGCAGGGGTGGGGTGCTGG - Intergenic
1190662087 X:52664018-52664040 CATCAGGTGCAGGGGGATTCTGG + Intronic
1191816823 X:65254196-65254218 CAGCAGTGGCAGTGGCATGGTGG - Intergenic
1191865244 X:65698568-65698590 CAGCAGAAGCAGTGGGGGGCAGG - Intronic
1193900279 X:87167877-87167899 GAGCTGGAGCAGCTGGATGCAGG + Intergenic
1195466350 X:105183339-105183361 CAGCAGCAGCAGTTGTATGCAGG + Intronic
1196124282 X:112082691-112082713 GAACAGGAGCAGAGGGAAGCCGG - Exonic
1197726569 X:129780768-129780790 CCGGAAGTGCAGTGGGATGCAGG + Intronic
1198512479 X:137366474-137366496 CAGCAGGAGCAGGCGGCTGCTGG - Intergenic
1198550869 X:137743616-137743638 CAGCAGGGGCAGGGGTATTCTGG + Intergenic
1198609027 X:138376483-138376505 GAGAAGGACCAGTGGGAAGCTGG - Intergenic
1198675237 X:139124075-139124097 CAGCAGGGTCTGTGGGAGGCAGG - Intronic
1199270025 X:145872577-145872599 CAGCAGTAGCAGGGGGAGCCTGG + Intergenic
1199420321 X:147637052-147637074 CGGGAGCAGCTGTGGGATGCAGG - Intergenic
1199575825 X:149312782-149312804 CAGCAGAAGCAGATGTATGCAGG - Intergenic
1200129452 X:153832961-153832983 CTGCAGGAGGACTGGGCTGCGGG - Intergenic
1200167548 X:154047674-154047696 GAGCAAGAGCAGTGGGAGCCAGG + Intronic
1201236924 Y:11920907-11920929 CAGCAGGAGCCAGAGGATGCGGG + Intergenic
1201944398 Y:19496277-19496299 CAGCAGAAGCATTTGAATGCTGG + Intergenic
1202130374 Y:21603685-21603707 CACAATGAGCAGTGGCATGCAGG + Intergenic
1202194051 Y:22277753-22277775 GAGCAGGAGCAGTGGCATCTCGG + Intergenic