ID: 1106074854

View in Genome Browser
Species Human (GRCh38)
Location 13:26449120-26449142
Sequence CTGTGGACCCATCTGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1485
Summary {0: 1, 1: 1, 2: 10, 3: 109, 4: 1364}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106074847_1106074854 -3 Left 1106074847 13:26449100-26449122 CCCTGGATCTTGAATATCATCTG 0: 1
1: 0
2: 0
3: 11
4: 170
Right 1106074854 13:26449120-26449142 CTGTGGACCCATCTGGGGCTGGG 0: 1
1: 1
2: 10
3: 109
4: 1364
1106074846_1106074854 6 Left 1106074846 13:26449091-26449113 CCAGGCAGGCCCTGGATCTTGAA 0: 1
1: 0
2: 1
3: 18
4: 291
Right 1106074854 13:26449120-26449142 CTGTGGACCCATCTGGGGCTGGG 0: 1
1: 1
2: 10
3: 109
4: 1364
1106074845_1106074854 13 Left 1106074845 13:26449084-26449106 CCTGACTCCAGGCAGGCCCTGGA 0: 1
1: 0
2: 3
3: 51
4: 527
Right 1106074854 13:26449120-26449142 CTGTGGACCCATCTGGGGCTGGG 0: 1
1: 1
2: 10
3: 109
4: 1364
1106074848_1106074854 -4 Left 1106074848 13:26449101-26449123 CCTGGATCTTGAATATCATCTGT 0: 1
1: 0
2: 1
3: 8
4: 167
Right 1106074854 13:26449120-26449142 CTGTGGACCCATCTGGGGCTGGG 0: 1
1: 1
2: 10
3: 109
4: 1364
1106074842_1106074854 22 Left 1106074842 13:26449075-26449097 CCTAAGTTTCCTGACTCCAGGCA 0: 1
1: 1
2: 14
3: 73
4: 483
Right 1106074854 13:26449120-26449142 CTGTGGACCCATCTGGGGCTGGG 0: 1
1: 1
2: 10
3: 109
4: 1364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106074854 Original CRISPR CTGTGGACCCATCTGGGGCT GGG Intergenic
900467166 1:2831420-2831442 CTGTGGAGCCTTCAAGGGCTGGG + Intergenic
900660189 1:3778247-3778269 CTGTGGATGCGTCTGGGGCCTGG + Intergenic
901037194 1:6343424-6343446 CTGTGACTGCATCTGGGGCTGGG + Intronic
901068313 1:6505115-6505137 CTGTGGAACTGTCTGGGGCCGGG - Intronic
901070001 1:6512349-6512371 CAGGGGGCACATCTGGGGCTGGG - Intronic
904378317 1:30095446-30095468 CTGTTGATCCATGTAGGGCTTGG - Intergenic
904986458 1:34553489-34553511 CTGTGAATCCATCTGGTCCTGGG - Intergenic
906051182 1:42874534-42874556 CTGTGAATCCATCTGGTTCTGGG + Intergenic
906200753 1:43958691-43958713 CTGGGGACCAAACTGGGGCTGGG + Intronic
906282340 1:44562971-44562993 CTGTGGACCTGAATGGGGCTGGG + Intronic
906558207 1:46732050-46732072 CTGTGAATCCATCTGGTCCTGGG - Intergenic
906579258 1:46922278-46922300 CTGTGAATCCATCTGGTCCTGGG + Intergenic
906604451 1:47156578-47156600 CTGTGAATCCATCTGGTCCTGGG - Intergenic
906739642 1:48169949-48169971 CTGTGAATCCATCTGGTCCTGGG + Intergenic
906781326 1:48575581-48575603 CTGTGGACATGTCTGGGCCTTGG - Intronic
906871122 1:49482241-49482263 CTGTGAATCCATCTGGTCCTGGG + Intronic
906878019 1:49558983-49559005 CTCTGGACCCTCCTGGGGCCTGG + Intronic
906954666 1:50362952-50362974 CTGTGAAACCATCTGGTCCTGGG - Intergenic
907088719 1:51704247-51704269 CTGTGAATCCATCTGGTCCTGGG + Intronic
907532329 1:55113412-55113434 CTGTGAATCCATCTGGTCCTGGG - Intronic
907565986 1:55434209-55434231 CTGTGAATCCATCTGGACCTGGG - Intergenic
907913525 1:58847919-58847941 CTGTGGACCCAAAAGGGTCTGGG - Intergenic
908175497 1:61551951-61551973 CTGTCAACCCACCTGGGGCCAGG - Intergenic
908520551 1:64937082-64937104 CTGTAGACCAAACTGGGGGTGGG - Intronic
908520578 1:64937270-64937292 CTGTGGAGCTCTCTGGGGGTTGG - Intronic
908537944 1:65095940-65095962 CTGTGAATCCATCTGGTCCTGGG + Intergenic
908723720 1:67153059-67153081 CTGTGAATCCATCTGGTCCTGGG + Intronic
908939863 1:69419006-69419028 CTGTGAATCCATCTGGTCCTGGG - Intergenic
908951573 1:69568236-69568258 CTGTGGAGCCTTCTGGGGGCGGG + Intergenic
909025094 1:70472358-70472380 CTGTGAACCCATCTGGTCCTGGG - Intergenic
909049235 1:70748477-70748499 CTGTGAACCCATCTGGTTCCTGG + Intergenic
909080802 1:71109733-71109755 CTGTGAATCCATCTGGTCCTGGG - Intergenic
909090431 1:71218698-71218720 CTGTGAATCCATCTGGTCCTGGG - Intergenic
909181340 1:72427630-72427652 CTGTGAATCCATCTGGTCCTGGG + Intergenic
909211830 1:72834008-72834030 CTGTGAATCCATCTGGTCCTGGG - Intergenic
909485417 1:76167601-76167623 CTGTGAATCCATCTGGCCCTGGG + Intronic
909492863 1:76245044-76245066 CTGTGGATCCATCTGGTCCTGGG + Intronic
909572961 1:77138502-77138524 CTGTGGTCTCATCTGAGGCTTGG - Intronic
909689831 1:78394854-78394876 CTGTGAATCCATCTGGTCCTGGG + Intronic
909841685 1:80335522-80335544 CTGTGAACCCGTCTGGTCCTGGG - Intergenic
909860392 1:80597549-80597571 CTGTGAATCCATCTGGTCCTGGG - Intergenic
910177534 1:84446595-84446617 CTGTGAATCCATCTGGTCCTGGG - Intergenic
910416361 1:87003046-87003068 CTGTGGAGCCATCAGGGCGTGGG - Intronic
910440469 1:87246684-87246706 CTGTGTATCCTTCTGAGGCTTGG + Intergenic
910580265 1:88816929-88816951 CTGTGAATCCATCTGGTCCTGGG - Intronic
910717712 1:90250518-90250540 CTGTGAATCCATCTGGTCCTGGG - Intergenic
910733200 1:90421305-90421327 CTTTGGACCCACCTGGGGCCTGG + Intergenic
910748378 1:90599381-90599403 CTGTGAATCCATCTGGTCCTGGG - Intergenic
910827496 1:91424988-91425010 CTGTAAATCCATCTGGTGCTGGG + Intergenic
911252559 1:95594115-95594137 CTGTGAATCCATCTGGTCCTGGG + Intergenic
911284304 1:95971566-95971588 CTGTGAATCCATCTGGTCCTGGG + Intergenic
911310419 1:96285926-96285948 CTGTGAATCCATCTGGTACTGGG + Intergenic
911536490 1:99106331-99106353 CACTGAACCCACCTGGGGCTTGG + Intergenic
911537215 1:99114772-99114794 CTGTGAATCCATCTGGTTCTGGG + Intergenic
911669670 1:100593529-100593551 CTCTGGACACACCTGGGGCCTGG - Intergenic
911876159 1:103165669-103165691 CTGTGAATCCATCTGGTCCTGGG + Intergenic
911938259 1:104008797-104008819 CTATGGATCCATCTGGTCCTGGG + Intergenic
912093752 1:106114205-106114227 CTGTGAATCCTTCTGGTGCTGGG - Intergenic
912242730 1:107927824-107927846 CTCTGGACCCACCTGGGGCCTGG + Intronic
912278566 1:108288161-108288183 CTGTGAATCCATCTGGTCCTGGG - Intergenic
912289660 1:108406196-108406218 CTGTGAATCCATCTGGTCCTGGG + Intronic
912490581 1:110060635-110060657 CTCCAGAACCATCTGGGGCTTGG + Exonic
912857346 1:113181718-113181740 CTGTGAATCCATCTGGTGCAGGG - Intergenic
913035920 1:114965954-114965976 CTGTGAACCCATCTGGTCCTGGG + Intronic
913398950 1:118406647-118406669 CTGTGAATCCATCTGGTCCTGGG - Intergenic
913416788 1:118618191-118618213 CTCTGGACCCACCTGGGGCCTGG - Intergenic
913506545 1:119521690-119521712 CTGTGAATCCATCTGGTCCTGGG + Intergenic
913706988 1:121434904-121434926 CTCTGGACCCATCTGGGATCTGG + Intergenic
913712970 1:121505062-121505084 CTGTGAATTCATCTGGTGCTGGG - Intergenic
914399991 1:147309955-147309977 CTGTGAATCCATCTGGACCTGGG - Intergenic
914414341 1:147465345-147465367 CTGTGAATCCATCTGGTTCTGGG + Intergenic
914720628 1:150285851-150285873 CTGTAGTCCCAGCTGAGGCTGGG + Intronic
915078522 1:153333455-153333477 CTGTGAATCCATCTGGTCCTGGG - Intronic
915476161 1:156153993-156154015 CCCTGAACCCAGCTGGGGCTGGG + Intronic
916257952 1:162809577-162809599 CTGTGAATCCATCTGGTCCTGGG + Intronic
916769069 1:167890657-167890679 CTGTGGACCTGCCTGGGGCCTGG - Intronic
916774553 1:167946983-167947005 CTGTGAAGCCATCTGGTACTGGG + Intronic
916827801 1:168459641-168459663 CTGTGAATCCATCTGGTCCTGGG + Intergenic
916868452 1:168886810-168886832 CTGTGAAATCATCTGGGCCTGGG - Intergenic
916878411 1:168995156-168995178 CTGTGAATCCATCTGGTCCTGGG + Intergenic
916944561 1:169713002-169713024 CTGTGAATCCATCTGGTCCTGGG - Intronic
916985636 1:170188437-170188459 CTGTGAATCCATCTGGTCCTGGG + Intergenic
917003290 1:170385041-170385063 CTCTGGACCCACCTGAGGCCTGG - Intergenic
917007368 1:170429960-170429982 CTGTGAATCCATCTGGTCCTGGG - Intergenic
917162783 1:172076926-172076948 CTGTGAATCCATCTGGTCCTGGG + Intronic
917226342 1:172788077-172788099 CTCTGGACCTACCTGGGGCCTGG - Intergenic
917266945 1:173230975-173230997 CTGTGAATCCATCTGGTGCTGGG - Intergenic
917275383 1:173325896-173325918 CTGTGAATCCATCTGGTCCTGGG - Intergenic
917356105 1:174128078-174128100 CTGTGAATCCATCTGGTCCTGGG + Intergenic
917572650 1:176284867-176284889 CTGTGAATCCATCTGGTTCTGGG + Intergenic
917768264 1:178247177-178247199 CTGTGGATCCATCTGGTCCTGGG + Intronic
917915562 1:179697840-179697862 CTGTGAATCCATCTGGTCCTGGG - Intergenic
918138543 1:181700244-181700266 CTGTGGACTCAACAGGGGTTTGG - Intronic
918165637 1:181944504-181944526 CTGTGAATCCATCTGGTCCTGGG - Intergenic
918655216 1:187017369-187017391 CTGTGAATCCATCTGGTCCTGGG - Intergenic
918736341 1:188068081-188068103 CTGTGAATCCATCTGGTCCTGGG + Intergenic
918982619 1:191583020-191583042 CTGTGAATCCATCTGGTCCTAGG + Intergenic
919067835 1:192715081-192715103 CTCTGGACCCACCTGAAGCTTGG + Intergenic
919146465 1:193642029-193642051 CTGTGAATCCATCTGGTCCTGGG + Intergenic
919223488 1:194662418-194662440 CTGTGAATCCATCTGGTCCTGGG - Intergenic
919252499 1:195075164-195075186 CTGTGGCCCCAGCTGGCTCTAGG + Intergenic
919287662 1:195585246-195585268 CTATGGACCCACCTGGGGCCAGG + Intergenic
919325956 1:196107804-196107826 CTGTGAATCCATCTGGTCCTGGG - Intergenic
919381307 1:196864898-196864920 CTGTGAATCCATCTGGACCTGGG - Intronic
919395748 1:197045540-197045562 CTGTGAATCCATCTGGTCCTGGG - Intronic
919445420 1:197698941-197698963 CTGTGAATCCATCTGGTCCTGGG - Intronic
920744989 1:208617697-208617719 CTCTGGACCCACCTGGGGCCTGG + Intergenic
920889677 1:209971996-209972018 CTGTGAATCCATCTGGTGCAGGG + Intronic
920935234 1:210426949-210426971 CTGTGAATCCATCTGGTCCTGGG + Intronic
921242408 1:213199024-213199046 CTGTGAATCCATCTGGTCCTGGG - Intronic
921631586 1:217439895-217439917 CTGTGAATCCATCTGGTCCTGGG - Intronic
922094205 1:222428233-222428255 CTGTGAATCCATCTGGCTCTGGG - Intergenic
922384603 1:225069819-225069841 CTGTGAATCCATCTGGTCCTGGG + Intronic
922693933 1:227717252-227717274 CTGTGAATCCATCTGGTCCTGGG - Intergenic
922998003 1:229982266-229982288 CTGTGGATGGGTCTGGGGCTGGG - Intergenic
923179834 1:231505891-231505913 CTGTGAATCCATCTGGTCCTGGG + Intergenic
924490743 1:244535357-244535379 CTCTGGACCCACATGGGGCCTGG - Intronic
924648972 1:245905610-245905632 TTCTGGACCCACCTGGGGCCTGG + Intronic
924779696 1:247135559-247135581 CTGTGAATCCATCTGGTCCTGGG - Intronic
924822785 1:247510113-247510135 CTGTGAATCCATCTGGTCCTGGG + Intronic
1063010625 10:2019137-2019159 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1063535265 10:6876832-6876854 CTGCGCACACACCTGGGGCTGGG + Intergenic
1063832810 10:9975465-9975487 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1064394923 10:14974164-14974186 ATGTGGGTCCATCTGGGGGTTGG + Intronic
1064521650 10:16209321-16209343 CTCTGAACCCACCTGGGGCCTGG - Intergenic
1064563507 10:16616397-16616419 CTGTGAATCCATCTGGTCCTGGG - Intronic
1064758194 10:18591263-18591285 CTGTGAATCCATCTGGTCCTGGG - Intronic
1064789167 10:18936149-18936171 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1065074569 10:22064231-22064253 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1065119048 10:22510734-22510756 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1065120296 10:22523163-22523185 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1066029960 10:31410615-31410637 CTGTGAATCCATCTGGTCCTGGG + Intronic
1066424766 10:35296835-35296857 CTGTGAATCCATCTGGTCCTGGG - Intronic
1067059886 10:43072873-43072895 CTGTGGTCCTCTCTGGGCCTCGG - Intergenic
1067207309 10:44230129-44230151 CTGTGAGCCCATCTGGTCCTGGG + Intergenic
1067249546 10:44575352-44575374 CTGGGGACCCTCCTGGGTCTGGG + Intergenic
1067368142 10:45655893-45655915 CTGTGAATCCATCTGGCCCTGGG - Intronic
1067675736 10:48374768-48374790 CTGTGAATCCATCTGGTCCTGGG - Intronic
1067737127 10:48865672-48865694 CAGTGAAGCCATCTGGGCCTGGG + Intronic
1068105819 10:52614322-52614344 ATGTGAACTCACCTGGGGCTTGG + Intergenic
1068126508 10:52847872-52847894 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1068325519 10:55480947-55480969 CTGTGAATCCATCTGGTCCTGGG + Intronic
1068575476 10:58679566-58679588 CTGTGAATCCATCTGGTCCTGGG - Intronic
1068718622 10:60216876-60216898 CTGTAAATCCATCTGGGGCCTGG + Intronic
1068938297 10:62657399-62657421 CTGTGGAGCCACCCGGGGCCAGG + Intronic
1069139612 10:64807058-64807080 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1069141932 10:64838115-64838137 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1069355992 10:67585444-67585466 CTGTGAATCCATCTGGTCCTGGG + Intronic
1069523341 10:69144176-69144198 CAGTGAATCCATGTGGGGCTGGG - Intronic
1069905747 10:71731104-71731126 CTGTGGCCGCCTCTGGGGCTTGG - Intronic
1070039551 10:72762244-72762266 CTGTGAATCCATCTGGCCCTGGG - Intronic
1070059310 10:72967176-72967198 CTCTGGACCCATCTGGGGCCTGG - Intergenic
1070709556 10:78669913-78669935 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1070915109 10:80148495-80148517 CTTTGGGCCCAGCTGGGGCCTGG + Intergenic
1071063072 10:81597088-81597110 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1071340300 10:84640373-84640395 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1071354542 10:84780710-84780732 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1071366303 10:84903908-84903930 CAGGTGACCCACCTGGGGCTGGG + Intergenic
1071923974 10:90384254-90384276 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1071927284 10:90424703-90424725 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1072406857 10:95162923-95162945 CTGTTAATCCATCTGGTGCTGGG + Intergenic
1072877758 10:99191172-99191194 CTCTGGACCTACCTGGGGCTGGG + Intronic
1073705364 10:105977373-105977395 CTGTGAATCCATCTGGTTCTGGG + Intergenic
1073823637 10:107293901-107293923 CTGTGTAGCCATCTGGTCCTTGG + Intergenic
1073884672 10:108024560-108024582 CTGTGAATCCATCTGGTTCTGGG - Intergenic
1073908542 10:108312745-108312767 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1074013897 10:109512984-109513006 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1074673523 10:115822811-115822833 CTGTGAACCCATCTGGTCCTGGG - Intronic
1074984840 10:118648899-118648921 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1075090635 10:119442318-119442340 CTTTGGACACAGGTGGGGCTGGG - Intronic
1075175053 10:120152197-120152219 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1075266601 10:121004562-121004584 CTGTGAATCCATCTGGCCCTCGG + Intergenic
1075454995 10:122579307-122579329 CTGTGTACCCAACTGGGGAGTGG + Intronic
1075620732 10:123926326-123926348 CTGAGGACTCCTCTGTGGCTTGG + Intronic
1075704933 10:124494842-124494864 CTGTGGAGCAGGCTGGGGCTGGG + Intronic
1075974059 10:126679840-126679862 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1076095479 10:127732141-127732163 CTGTGTTCTCATCTGGAGCTTGG + Intergenic
1077149448 11:1063355-1063377 CAGTGAAACCATCTGGGCCTGGG - Intergenic
1077298039 11:1835135-1835157 CTGTGGTGCCAGCTGGGGCCGGG - Exonic
1077342189 11:2031094-2031116 CTGCGGACCCTTCTGGAGCTAGG + Intergenic
1077427505 11:2490321-2490343 CTCTGGACCCACCTTGGACTTGG + Intronic
1077488952 11:2851653-2851675 CTGAGCACCCAGCTGGGGCCAGG - Intergenic
1077561727 11:3267031-3267053 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1077567621 11:3312851-3312873 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1078816397 11:14826662-14826684 CTGTGAATCCATCTGGTCCTGGG - Intronic
1078842175 11:15088303-15088325 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1079934931 11:26605537-26605559 CTGTGAATCCATCTGGTCCTGGG + Intronic
1080079680 11:28201492-28201514 CTGTGAACCCATCTGGTCCTGGG + Intronic
1080212087 11:29797992-29798014 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1080221287 11:29908093-29908115 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1080297937 11:30751697-30751719 CTGTGGTCACATATGGAGCTAGG - Intergenic
1080428307 11:32175889-32175911 CTCTGGGCCTCTCTGGGGCTGGG - Intergenic
1080513367 11:32997628-32997650 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1080670753 11:34374413-34374435 CTGTGAAGCCATCTGGTCCTAGG + Intergenic
1080959087 11:37136810-37136832 CTGTGAACCCATCTGGTCCAGGG - Intergenic
1081358192 11:42140456-42140478 CTGTGGACCCTTCTTGGGAGTGG + Intergenic
1081363607 11:42208899-42208921 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1081619414 11:44610265-44610287 CTGTGGTCCTAGCTGGGACTTGG + Intronic
1081775592 11:45674225-45674247 CTGGGGTCCCAGCTGGGGCAGGG - Intergenic
1082251957 11:49992373-49992395 CTCTGGACCCATCCAGGGCCTGG + Intergenic
1082620022 11:55408831-55408853 CTGTGAATCCATCTGGACCTGGG + Intergenic
1083283143 11:61639849-61639871 CTCTGGAGCCATGTGGGCCTGGG - Intergenic
1083534007 11:63452396-63452418 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1083560843 11:63671717-63671739 CTGCGCACTCATCTGGGGCGGGG + Intronic
1084953511 11:72679412-72679434 CCCTGGACTCAGCTGGGGCTGGG - Intergenic
1086266611 11:85006338-85006360 CTGTGAATCCATCTGGTCCTGGG + Intronic
1086496854 11:87412834-87412856 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1086514169 11:87592518-87592540 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1086765228 11:90688307-90688329 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1086806774 11:91253570-91253592 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1086833078 11:91589569-91589591 CTGTGAATCCATCTGGTCCTCGG + Intergenic
1087133320 11:94689006-94689028 CTGTGAAACCATCTGGTTCTGGG - Intergenic
1087251671 11:95907394-95907416 CTGTGAATCCATCTGGTCCTGGG - Intronic
1087309020 11:96518750-96518772 CTGTGAATCCATCTGGAGCTGGG + Intergenic
1087482102 11:98715065-98715087 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1087513856 11:99131780-99131802 CTGTAAATCCATCTGGGCCTGGG - Intronic
1087808735 11:102586257-102586279 CAGTGAACCCTTCTGGGCCTGGG + Intronic
1087881591 11:103422221-103422243 CTGTGAATCCATCTGGTCCTGGG - Intronic
1087930973 11:103977222-103977244 CTGTGAATCCATCTGGTCCTGGG - Intronic
1088180787 11:107107339-107107361 CTGTGAATCCATCTGGCCCTGGG - Intergenic
1088307482 11:108425527-108425549 CTGTGAATCCATCTGGTCCTGGG - Intronic
1088510635 11:110570142-110570164 CAGTGAAACCATCTGGGCCTGGG + Intergenic
1088570003 11:111213625-111213647 TTCTGGACCCACCTGGGGCCTGG + Intergenic
1088881985 11:113979745-113979767 GTGTGGATACATCTGAGGCTTGG + Intronic
1089139110 11:116272271-116272293 CTGAGGACCCAGCTGGGCCTGGG + Intergenic
1089267480 11:117275770-117275792 CTGTGAATCCATCTGGACCTGGG - Intronic
1089365351 11:117917999-117918021 CAGTGGGCCCATCTGTGGGTGGG - Intronic
1089578785 11:119468559-119468581 CTCTGGACCCCCCTGGGGCCAGG - Intergenic
1090116807 11:123981742-123981764 CTGTGAAACCATCTGGTCCTGGG + Intergenic
1090313025 11:125759477-125759499 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1090573931 11:128079743-128079765 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1090676826 11:129006827-129006849 CTCTGGACCCACCTAGGGCCTGG - Intronic
1090928145 11:131270355-131270377 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1091071941 11:132573839-132573861 CTGTGAAGCCATCTGGACCTGGG + Intronic
1091246921 11:134104886-134104908 CTGTGAATCCATCTGGCCCTGGG - Intronic
1091365307 11:135014995-135015017 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1202825175 11_KI270721v1_random:86283-86305 CTGCGGACCCTTCTGGAGCTAGG + Intergenic
1091438202 12:490909-490931 CTGCAGACCCATCTGGGCCTGGG - Intronic
1091604993 12:1943317-1943339 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1092316678 12:7423859-7423881 CTGTGAATCCATCTGGTCCTGGG - Intronic
1092512682 12:9173858-9173880 CTGTGCATCCATCTGGTCCTGGG - Intronic
1092569431 12:9706962-9706984 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1092581335 12:9846121-9846143 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1092703570 12:11259851-11259873 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1092861725 12:12724837-12724859 CTGCGGGCCCAGCTGGGGGTGGG + Intergenic
1093123958 12:15306554-15306576 CTCTGGACCCACCTGGGGCCTGG - Intronic
1093206067 12:16251701-16251723 CAGTGGATCCATCTGGTCCTGGG - Intronic
1093242338 12:16692799-16692821 CTGTGAAGCCATCTGGCCCTGGG - Intergenic
1093278147 12:17154400-17154422 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1093413334 12:18892833-18892855 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1093522824 12:20070290-20070312 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1093595551 12:20954629-20954651 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1093666848 12:21824602-21824624 CTGTGAATCCATCTGGTCCTGGG + Intronic
1093687753 12:22076420-22076442 CTGTGCAACCACCTGGGGTTAGG - Intronic
1093687851 12:22077004-22077026 CTGTGGAGCCATTTGGAACTGGG - Intronic
1093714830 12:22369448-22369470 CTGTGAATCCATCTGGTCCTGGG - Intronic
1094055004 12:26259995-26260017 CTGTGAATCCATCTGGTCCTGGG - Intronic
1094114971 12:26901337-26901359 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1094130908 12:27074109-27074131 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1094327997 12:29260736-29260758 CTGTGGACCTACCTGGGTCCAGG + Intronic
1095060727 12:37685133-37685155 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1095320054 12:40816261-40816283 CTGTGAATCCATCTGGTCCTGGG + Intronic
1095323391 12:40858055-40858077 CTGTGTTCCCTTCTGGAGCTTGG + Intronic
1095487439 12:42699717-42699739 CTGTGCTCTCATCTGGAGCTTGG + Intergenic
1095488854 12:42711814-42711836 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1097289150 12:57899251-57899273 CTGTGAAGCCTTCTTGGGCTGGG - Intergenic
1097453578 12:59766942-59766964 CTGTGAATCCATCTGGTCCTGGG + Intronic
1097529007 12:60775166-60775188 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1097569950 12:61320235-61320257 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1097583291 12:61484471-61484493 CTGTGAACCCATCTGGTCCTGGG - Intergenic
1097619836 12:61926224-61926246 CTGTGAATCCATCTGGTCCTGGG - Intronic
1097634893 12:62110589-62110611 CTGTGAATCCATCTGGTCCTGGG + Intronic
1097890884 12:64776638-64776660 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1098142843 12:67468824-67468846 CTCTGGACCCACCCAGGGCTTGG - Intergenic
1098499908 12:71179543-71179565 CTGTGAATCCATCTGGCCCTGGG - Intronic
1098632749 12:72744029-72744051 CTGTGAATCCATCTGGTTCTGGG - Intergenic
1099022804 12:77426955-77426977 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1099253410 12:80286484-80286506 CTGTGAATCCATCTGGTCCTGGG + Intronic
1099485940 12:83229439-83229461 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1099502360 12:83429626-83429648 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1099527415 12:83732622-83732644 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1099797493 12:87417766-87417788 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1099900589 12:88706440-88706462 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1100135523 12:91548583-91548605 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1100284529 12:93152647-93152669 CTGTGGAGACATGTGGGGCCAGG - Intergenic
1100357068 12:93841485-93841507 CTGTAAAGCCATCTGGGCCTAGG + Intronic
1100410948 12:94319020-94319042 CTGTGAATCCATCTGGCCCTGGG + Intronic
1100740358 12:97584910-97584932 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1100798327 12:98205509-98205531 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1100920758 12:99483610-99483632 CTGTGAATCCATCTGGTCCTGGG + Intronic
1101026087 12:100608480-100608502 CTCTGGACCCAACAGGGCCTGGG - Intronic
1101142104 12:101806807-101806829 CAGTGAAGCCATCTGGGTCTGGG - Intronic
1101218223 12:102606911-102606933 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1101263464 12:103059357-103059379 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1101299849 12:103467845-103467867 CTGTGTATCCATTTGGGGGTGGG + Intronic
1101487629 12:105181571-105181593 CTGTGAATCCATCTGGTCCTGGG + Intronic
1101820803 12:108183000-108183022 CTGTGGACCCATCTGAATCCAGG - Intronic
1102048823 12:109847610-109847632 CTGTGGCCCCATATCTGGCTGGG + Intergenic
1102754810 12:115329729-115329751 CAGTGAAGCCATCTGGTGCTAGG + Intergenic
1104047156 12:125171559-125171581 CTGTGTCCTCATCTGGAGCTTGG + Intergenic
1104507476 12:129346049-129346071 CTGTGAATCCATCTGGTCCTGGG + Intronic
1104515011 12:129417159-129417181 CTGTGAATCCATCTGGTCCTGGG + Intronic
1105315212 13:19253128-19253150 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1105430093 13:20328837-20328859 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1105569903 13:21592393-21592415 CTGTGAATCCATCTGGTCCTGGG - Intronic
1105776241 13:23663620-23663642 CTGTGAATCCATCTGGTCCTTGG + Intronic
1105800760 13:23901314-23901336 CTGTGGAGTCATCTGAGGCCAGG - Intronic
1105848271 13:24311783-24311805 CTGTGGAGTCATCTGAGGCCAGG + Intronic
1106074854 13:26449120-26449142 CTGTGGACCCATCTGGGGCTGGG + Intergenic
1106336186 13:28785161-28785183 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1106651217 13:31692190-31692212 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1107071027 13:36269306-36269328 CTGTGAATCCATCTGGTCCTGGG - Intronic
1107226072 13:38048918-38048940 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1107289496 13:38836555-38836577 CTGTGAATCCATCTGGCCCTGGG + Intronic
1107519813 13:41168501-41168523 CAGTGAAACCATCTGGGCCTGGG + Intergenic
1107745450 13:43502253-43502275 CTGTGGAACCATCTGATACTGGG - Intronic
1107774338 13:43822538-43822560 CTTTGGACCCAACTGGGGCCTGG - Intergenic
1107776958 13:43854506-43854528 CTGTGAACCCATCTGGTACTGGG - Intronic
1108097524 13:46919372-46919394 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1108143472 13:47451228-47451250 CTGTGAATCCATCTGGCCCTGGG + Intergenic
1108158634 13:47614868-47614890 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1108304946 13:49121879-49121901 CTGTGAATCCATCTGGTCCTGGG - Intronic
1108425664 13:50296935-50296957 CTGTGAATCCATCTGGTCCTGGG + Intronic
1108477194 13:50832095-50832117 CTGTGAATCCATCTGGTCCTGGG + Intronic
1108545064 13:51484854-51484876 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1108849994 13:54716668-54716690 CTGTGAATCCATCTGGTCCTTGG + Intergenic
1108877777 13:55069286-55069308 CTGTGAAACTATCTGGAGCTTGG + Intergenic
1108925187 13:55733824-55733846 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1108957977 13:56185044-56185066 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1109161795 13:58984445-58984467 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1109329007 13:60904460-60904482 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1109366834 13:61366822-61366844 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1109531547 13:63655045-63655067 CTGTGTATCCATCTGGTCCTGGG + Intergenic
1109541024 13:63779040-63779062 ATGTGAATCCATCTGGTGCTGGG + Intergenic
1109567141 13:64132022-64132044 TGCTGGACCCATCTGGGGATGGG + Intergenic
1109598776 13:64594963-64594985 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1109611716 13:64773992-64774014 CTGTGAATCCATCTGGTTCTGGG - Intergenic
1109661374 13:65464927-65464949 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1109719282 13:66256375-66256397 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1109814545 13:67563524-67563546 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1110036088 13:70686507-70686529 CTGTGAATCCATCTGGTTCTGGG + Intergenic
1110390048 13:74962965-74962987 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1110806306 13:79757935-79757957 CTTTGGCACCATCTGGGGATAGG + Intergenic
1110826636 13:79978750-79978772 CTGTGAATCCATCTGGCCCTGGG - Intergenic
1110887961 13:80661873-80661895 CTGTGAACCCATCTGGCCCTGGG + Intergenic
1111234990 13:85398245-85398267 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1111328826 13:86735329-86735351 CAGTGAATCCATCTGGGCCTGGG - Intergenic
1111449556 13:88396931-88396953 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1111478418 13:88785771-88785793 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1111628284 13:90816730-90816752 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1111791058 13:92855889-92855911 CTGTGAATCCATCTGGTGCAAGG - Intronic
1111971763 13:94924056-94924078 ATGTGGAGCCATCTGAGACTGGG - Intergenic
1112076443 13:95918754-95918776 CTGTGAATCCATCTGGTCCTAGG - Intronic
1112152254 13:96776721-96776743 CTGTGAATCCATCTGGTCCTGGG - Intronic
1112497413 13:99915959-99915981 CTGAGGACCCACCTGTGTCTAGG - Intergenic
1112601850 13:100863983-100864005 CTGTGAAGCCATCTGGGCCTGGG + Intergenic
1112619843 13:101043553-101043575 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1112898589 13:104332491-104332513 CTGTGAACCCATCTGGTCCTGGG + Intergenic
1113229188 13:108194502-108194524 CTGTGGAGCCAGCAGGGGCCGGG + Intergenic
1113459643 13:110472969-110472991 CTGGGGATCCATCTGGGCCAGGG - Exonic
1113540558 13:111104732-111104754 CTGTGCATCCATCTGGTCCTGGG - Intergenic
1114043995 14:18705644-18705666 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1114048281 14:18896095-18896117 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1114114236 14:19505551-19505573 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1114115933 14:19623303-19623325 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1114221247 14:20699411-20699433 CTGCTGACCCTGCTGGGGCTGGG + Exonic
1114615841 14:24067955-24067977 CTGTGGACCCAGCAGGCCCTGGG + Intronic
1114741889 14:25105748-25105770 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1114845210 14:26312426-26312448 CTGTGAATCCATCTGGTTCTGGG - Intergenic
1114991157 14:28291876-28291898 CTGTGAATCCATCTGGTGCTAGG + Intergenic
1115043303 14:28957646-28957668 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1115282313 14:31677901-31677923 CTCTGGACCCACCTGGGGTCTGG - Intronic
1115339403 14:32276225-32276247 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1115357501 14:32464124-32464146 CTGTGTATCCATCTGGTCCTGGG - Intronic
1115538388 14:34395034-34395056 CTGTGAATCCATCTGGTCCTGGG - Intronic
1115690641 14:35840480-35840502 CTGTGAATCCATCTGGTCCTGGG + Intronic
1115885432 14:37966535-37966557 CTGTGAATCCATCTGGTCCTGGG + Intronic
1115918420 14:38343235-38343257 CTCTGGACCCTCCTGGGGCCTGG + Intergenic
1115924523 14:38416007-38416029 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1115956025 14:38780374-38780396 CTGTGAAGCCATCTGGTCCTGGG - Intergenic
1115974076 14:38977800-38977822 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1116166249 14:41337636-41337658 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1116318200 14:43425392-43425414 CTGTGAATCCATCTGGTTCTGGG - Intergenic
1116358028 14:43956334-43956356 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1116362900 14:44024606-44024628 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1116492715 14:45525338-45525360 CTGTGAAGCCATCTGGCCCTGGG + Intergenic
1117038352 14:51748979-51749001 ATGTGGGTCCAACTGGGGCTGGG - Intergenic
1117466175 14:55996660-55996682 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1117491525 14:56252737-56252759 CTGTGAATCCATCTGGTCCTGGG - Intronic
1117504412 14:56388270-56388292 CTCTGGACCCTCCTAGGGCTGGG - Intergenic
1117576924 14:57108317-57108339 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1117641364 14:57802840-57802862 CTGTGAATCCATCTGGTCCTGGG - Intronic
1117749546 14:58906253-58906275 CTGTGAATCCATCTGGTCCTAGG - Intergenic
1118558562 14:67053493-67053515 CTGTGAATCCATCTGGTCCTGGG - Intronic
1118765195 14:68904842-68904864 CTGAGGATCGAGCTGGGGCTGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119642748 14:76327229-76327251 CTGGGGACCCACGTGGGGGTGGG + Intronic
1120249621 14:82046992-82047014 CTGTTGACTCATCTGTGCCTTGG - Intergenic
1120448706 14:84637583-84637605 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1121028607 14:90637411-90637433 CTGTAAAACCATGTGGGGCTGGG - Intronic
1121064989 14:90954358-90954380 TAGTGAAGCCATCTGGGGCTGGG + Intronic
1121153031 14:91654648-91654670 CTCTGGACCTAGCTGGGGCTGGG + Intronic
1121516304 14:94553283-94553305 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1122077843 14:99246988-99247010 CTGCGGAGCCCTCTGGGGCCTGG - Intronic
1122248624 14:100422559-100422581 CTGTGAAAGCTTCTGGGGCTGGG + Intronic
1122290191 14:100676645-100676667 CTGAGCACCCATATGGGACTTGG - Intergenic
1122783545 14:104153735-104153757 GTGTGGAAGCATCAGGGGCTGGG + Intronic
1123820125 15:24021037-24021059 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1124046220 15:26152626-26152648 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1124340988 15:28889001-28889023 CTGTGTGCCCAGCGGGGGCTGGG + Intronic
1124966131 15:34434693-34434715 CTGTGTGCCCATCGGGGGCTGGG - Intronic
1125764142 15:42121844-42121866 CTGTGGACCCCTCCAGGGCCAGG - Intergenic
1126278136 15:46909144-46909166 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1126642572 15:50842546-50842568 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1126709377 15:51440728-51440750 TTCTGGACCCACCTAGGGCTTGG - Intergenic
1126854758 15:52827514-52827536 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1126871392 15:52992174-52992196 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1126897730 15:53277548-53277570 CTGTGAATCCATCTGGTTCTGGG - Intergenic
1127021934 15:54757881-54757903 CTGTGAACCCAACTGGTCCTGGG - Intergenic
1127030344 15:54854584-54854606 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1127042680 15:54994312-54994334 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1127155670 15:56122633-56122655 CTCTGGACCCATCTGGGGTCTGG - Intronic
1127189786 15:56517183-56517205 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1127374049 15:58366434-58366456 CTGTGAACACATCTGGTCCTGGG - Intronic
1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG + Intronic
1127517263 15:59708502-59708524 CTGGGGTCCCATATGGGGCTTGG + Intergenic
1127945196 15:63744445-63744467 CTCTAGACCCACCTGAGGCTTGG - Intronic
1128008568 15:64269292-64269314 CTGTGAATCCATCTGGTCCTGGG + Intronic
1128058511 15:64718510-64718532 CTGGGGACCCATCCTGGGCACGG + Intergenic
1128262300 15:66240984-66241006 CTGTATACCCATCTTTGGCTGGG - Intronic
1128852185 15:70970595-70970617 CTGTGAATCCATCTGGTCCTGGG + Intronic
1128857175 15:71028556-71028578 CTGTGAATCCATCTGGATCTGGG + Intronic
1129174902 15:73832804-73832826 CTGTGGACACTTCTGAGGATTGG - Intergenic
1129507626 15:76095725-76095747 CTGTGAATCCATCTGGTCCTGGG + Intronic
1129553863 15:76484522-76484544 CTGTGCATCCATCTGGTCCTGGG - Intronic
1129698662 15:77755051-77755073 TTGTGCATCCATCTGTGGCTTGG - Intronic
1131415781 15:92256134-92256156 CTGTGAATCCATCTGGTTCTGGG + Intergenic
1131625380 15:94113274-94113296 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1132070875 15:98775652-98775674 CTGTGGCCCCTGCTGGTGCTGGG + Intronic
1132277041 15:100576554-100576576 CTGTGAATCCATCTGGTCCTGGG - Intronic
1133280026 16:4659963-4659985 TTGTGGCCCCATTTGGGGCGGGG + Intronic
1134039483 16:11057440-11057462 CTGTGGCTCAAGCTGGGGCTTGG - Intronic
1134244060 16:12526779-12526801 CTGTGGACCCCGCAGGGGGTGGG - Intronic
1134442395 16:14307085-14307107 CTGAGGCCACATCTGGGCCTCGG - Intergenic
1135132513 16:19864529-19864551 GTGTGGAGGCTTCTGGGGCTTGG + Intronic
1135800071 16:25485755-25485777 CTGTGAATCCATCTGGTCCTCGG + Intergenic
1136659541 16:31744734-31744756 CTGTGAATCCATCTGGTCCTGGG + Intronic
1136664567 16:31798073-31798095 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1136677845 16:31929514-31929536 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1137038923 16:35591854-35591876 CTGTGGGCCGAGCTGGGACTTGG + Intergenic
1137690936 16:50427061-50427083 CTGTGATCTCATCTGAGGCTCGG + Intergenic
1138151871 16:54665186-54665208 CTGTGAATCCATCTGGTGCTGGG - Intergenic
1138407217 16:56805919-56805941 CTGTGATTTCATCTGGGGCTTGG + Intronic
1138498772 16:57425541-57425563 ATGTGGACCGAGATGGGGCTGGG - Intergenic
1139015375 16:62683832-62683854 CTGTGGAGCCAGCAGGGGCTGGG + Intergenic
1139301898 16:65952304-65952326 CATGGGACCCGTCTGGGGCTTGG - Intergenic
1140271196 16:73467862-73467884 CTGTCTACCTTTCTGGGGCTGGG + Intergenic
1140695837 16:77532933-77532955 CTGTAGACTCTTCTGGGGATGGG - Intergenic
1141827932 16:86494067-86494089 CTGTGGAACTATCTGGAGCTTGG - Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142261419 16:89044183-89044205 CTGATGCCCGATCTGGGGCTGGG + Intergenic
1142349309 16:89572659-89572681 CAGTGGACCGGTCCGGGGCTCGG - Intergenic
1142388964 16:89785727-89785749 CTGTGGTCTCAAGTGGGGCTAGG - Intronic
1142472655 17:172004-172026 CTGTGGACCCCTCTGCAGCCTGG - Intronic
1142483120 17:230549-230571 CAGTGGACTCCTCTGGGGCCAGG + Intronic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1145883319 17:28367094-28367116 CTGTGAACCGGTTTGGGGCTGGG - Intronic
1146093301 17:29904032-29904054 CTGTGAATCCATCTGGTCCTGGG - Intronic
1146740240 17:35277718-35277740 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1146749993 17:35369507-35369529 CTGTGAACCCACCTAGGGCCTGG + Intronic
1147006907 17:37410628-37410650 CAGTTGAGCCACCTGGGGCTAGG + Intronic
1147364752 17:39952674-39952696 CTGTGGGGCCATCTTGGGCCCGG - Intergenic
1147637714 17:41974181-41974203 CTGTGGCCCCATCCCTGGCTTGG - Exonic
1149108580 17:52998113-52998135 TTCTGTACCCATCTGGAGCTTGG + Intergenic
1149180579 17:53931796-53931818 CTCTGGACTCACCTGGGGCCTGG - Intergenic
1149234968 17:54578715-54578737 TTCTAGACCCATCTGGGGCATGG + Intergenic
1149247743 17:54731154-54731176 CTGTGAACTCATCTGGTCCTGGG - Intergenic
1149372208 17:56005985-56006007 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1150131590 17:62672131-62672153 CTGTGTCACCATCTGGGGCCCGG + Exonic
1150438973 17:65176562-65176584 CTGTGGTTTCATCTTGGGCTTGG - Intronic
1150533477 17:66011069-66011091 CTGTGGATCCCTCTGGTCCTGGG + Intronic
1150546156 17:66159230-66159252 CTGTGAATCCATCTGGACCTGGG - Intronic
1151225985 17:72648747-72648769 CTGGGGTCCCAGCTGGGACTGGG + Intronic
1151946390 17:77322128-77322150 CTGGTCACCCATCTGGGCCTCGG - Intronic
1152332006 17:79678892-79678914 CTGTGGAGCCATATGGGGAGGGG - Intergenic
1152592401 17:81220146-81220168 CAGTGGACCCAGCTGAGGCTGGG - Intronic
1152635799 17:81430052-81430074 CGGTGGGCCTCTCTGGGGCTTGG + Intronic
1152986698 18:327900-327922 CTGTGAAGCCATCTGGTCCTGGG + Intronic
1153099680 18:1452155-1452177 TTCTGGACCCACCTGGGGCTTGG + Intergenic
1153269037 18:3300735-3300757 CTGTGAATCCATCTGGCCCTGGG - Intergenic
1153363386 18:4224743-4224765 CTCTGGACCCACCTGGGGCCAGG + Intronic
1153391949 18:4572567-4572589 CTGTGAATCCATCTGGTCCTTGG + Intergenic
1153398238 18:4650036-4650058 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1153441879 18:5129264-5129286 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1153462151 18:5347731-5347753 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1153504041 18:5777467-5777489 CAGTGAAGCCACCTGGGGCTTGG + Intergenic
1153702042 18:7704283-7704305 CTGTGAATCCATCTGGTCCTGGG + Intronic
1153965637 18:10179063-10179085 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1154372967 18:13781946-13781968 CAGTGAAACCATCTGGGCCTGGG - Intergenic
1154489842 18:14912725-14912747 CTGTGAGCCCATCTGGCCCTGGG + Intergenic
1155282215 18:24251154-24251176 CTCTGGACCTATTTGGGGCCTGG + Intronic
1155769289 18:29676432-29676454 CTGTGAATCCATCTGGCCCTGGG - Intergenic
1155773906 18:29734959-29734981 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1155815170 18:30298384-30298406 CTGTGAATCCTTCTGGTGCTGGG - Intergenic
1155857006 18:30846876-30846898 CTGTGAATCCATCTGGTCCTTGG + Intergenic
1155935473 18:31748458-31748480 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1156095720 18:33529480-33529502 CTTTGAACCCATCTGGTCCTGGG + Intergenic
1156562017 18:38135979-38136001 CTGTGAACCCATCTGGTCCTTGG - Intergenic
1157066987 18:44363608-44363630 CTGTGAACCCATCTGGTCGTGGG + Intergenic
1157970893 18:52267498-52267520 CTGTGAAGCCATCTGGTCCTAGG + Intergenic
1158297350 18:56013173-56013195 CTGTGAATCCATCTGGTCCTAGG + Intergenic
1158538103 18:58326539-58326561 ATTTGGACCCACCTTGGGCTTGG + Intronic
1159145921 18:64453790-64453812 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1159331162 18:66995634-66995656 CTGTGAATCCATCTGGACCTGGG - Intergenic
1159648138 18:70943680-70943702 CTCTGGACCCACCTGGGACCAGG + Intergenic
1159896420 18:74001249-74001271 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1159902089 18:74056752-74056774 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1160250166 18:77196407-77196429 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1160548590 18:79679158-79679180 CGGTGGGCCCGTCTGGGGCAAGG - Intergenic
1160811699 19:1015607-1015629 CTGAGGACCCAGCTGGGCCAAGG + Intronic
1161310833 19:3593113-3593135 CTGGGGTCCCACCCGGGGCTTGG - Exonic
1161378126 19:3950471-3950493 CTGTGGGCCCAGCTAGGGCCTGG + Intergenic
1161798896 19:6404394-6404416 CTGGGGTCCCAGATGGGGCTAGG - Intergenic
1162402413 19:10454141-10454163 CTGTCCACCCTTCTGGGGTTGGG + Intronic
1162717846 19:12645110-12645132 CTGTGGTCCCACTTGGGGCATGG - Intronic
1163110909 19:15160698-15160720 CTGGGGCCCCAGCTGGGTCTGGG + Exonic
1163406502 19:17126264-17126286 CTGTGGACCCATTTTGTCCTGGG + Intronic
1163576770 19:18115489-18115511 CTGGGGACCCAAGTGGGGATGGG - Intronic
1163858259 19:19723694-19723716 CTGTGAATCCATCTGGTCCTGGG + Intronic
1163990188 19:20991728-20991750 CTGTGAATCCATCTGGGCCTGGG - Intergenic
1164417000 19:28054906-28054928 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1164422667 19:28109867-28109889 CTGTGAATCCATCTGGCCCTGGG - Intergenic
1164577639 19:29415109-29415131 CTGTGCTCCTCTCTGGGGCTAGG + Intergenic
1164705152 19:30314197-30314219 CCGGGGACCCCTCTGGGGCAGGG + Intronic
1164972916 19:32547797-32547819 CTGAAGGCCCATCTGGGGCTGGG - Intergenic
1165965496 19:39575371-39575393 CTGTGAATCCATCTGGCCCTGGG + Intergenic
1165983540 19:39747209-39747231 TTCTGGACCCACCTGGGGCCTGG + Intergenic
1166176172 19:41072536-41072558 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1166263519 19:41660625-41660647 CTGTGAATCCATCTGGTGCTGGG - Intronic
1166426185 19:42680388-42680410 CTGTGAATCCATCTGGTCCTGGG + Intronic
1166602890 19:44113605-44113627 CAGTGGAGCCTTCTTGGGCTTGG + Intronic
1166616342 19:44251280-44251302 CTGTGAATCCATCTGGTCCTGGG - Intronic
1166690636 19:44819890-44819912 CTGTGGATTAGTCTGGGGCTGGG - Intronic
1166818288 19:45560391-45560413 CTCTGTGCCTATCTGGGGCTGGG - Intronic
1166904464 19:46097126-46097148 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1167311930 19:48741865-48741887 CTCTGGACCCACCATGGGCTTGG + Exonic
1168152066 19:54454641-54454663 CTGTTGGCCCTTCTTGGGCTTGG - Exonic
1168188460 19:54718484-54718506 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1168288827 19:55347308-55347330 CTGGGGTCCCAGCAGGGGCTGGG - Exonic
1168312948 19:55470488-55470510 CTGTGGTCTCATCTGAGGTTGGG + Intergenic
1168709667 19:58491783-58491805 CTTAGGGCCCATCTGGTGCTGGG - Intronic
1168710373 19:58496630-58496652 TTGTGGACTCACCTGGGGCCAGG - Intronic
925413930 2:3656373-3656395 CTGTGGACCCATCTGTGGGGCGG - Intergenic
925712432 2:6754396-6754418 CTGGGGCCACATCTGGGACTGGG + Intergenic
926122292 2:10250280-10250302 CAGTGAAGCCATCTGGGCCTGGG + Intergenic
926366287 2:12136057-12136079 CTGTGAATCCATCTGGTCCTGGG + Intergenic
926409381 2:12586978-12587000 CTGTGAACTCATCTGAGGCTTGG + Intergenic
926650919 2:15344542-15344564 CTGTGAATCCATCTGGTCCTGGG - Intronic
927239467 2:20908085-20908107 CTGTGAATCCATCTGGTCCTGGG + Intergenic
927359328 2:22214317-22214339 CAGTGGAGCCATCTGGTCCTGGG - Intergenic
927702186 2:25275720-25275742 CTGAGGACCCAGCAGGGCCTAGG + Intronic
928293620 2:30061675-30061697 CTCTGGACCCACCTGGGCCCTGG + Intergenic
928472291 2:31586300-31586322 CTCTGGACCCACCTGGGGCTTGG + Intergenic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
928788243 2:34916945-34916967 CTGTGAATCCATCTGGTCCTGGG - Intergenic
929064418 2:37959263-37959285 CTGTGAATCCATCTGGACCTGGG + Intronic
929280151 2:40069261-40069283 CTGTGAATCCATCTGGTTCTGGG + Intergenic
929333204 2:40709735-40709757 CTGTGAATCCATCTGGTACTGGG + Intergenic
929338237 2:40779313-40779335 CTGTGAAGCCATCTGGTTCTGGG - Intergenic
930229785 2:48831622-48831644 CTGTGAATCCATCTGGTTCTGGG - Intergenic
930359649 2:50361629-50361651 CTGTGAATCCATCTGGTCCTGGG - Intronic
930839529 2:55830078-55830100 CTGTGAATCCATCTGGCCCTGGG - Intergenic
930916279 2:56692705-56692727 CTGTGAAACCATCTGGTCCTGGG + Intergenic
930951694 2:57150413-57150435 CTGTAAACCCAACTGGGACTGGG - Intergenic
931138523 2:59431532-59431554 CTGTGAATCCATCTGGTCCTGGG - Intergenic
931480718 2:62636797-62636819 CTGTGAATCCATCTGGTCCTTGG - Intergenic
931492866 2:62768547-62768569 CTGTGAACTCATCTGGTCCTGGG - Intronic
931556316 2:63509961-63509983 CTGTGAATCCATCTGGTCCTTGG - Intronic
931566960 2:63624710-63624732 CTGTGAATCCATCTGGTTCTGGG - Intronic
931736618 2:65199943-65199965 CTCCGGACCCACCTGGGGTTGGG + Intergenic
931886391 2:66622628-66622650 CTGTGAATCCATCTGGTCCTGGG + Intergenic
931887893 2:66637582-66637604 CTGTGAATCCATCTGGTCCTGGG - Intergenic
932379963 2:71273454-71273476 CTGTGAATCCATCTGGTCCTGGG - Intergenic
932467844 2:71934956-71934978 CTGTGGGCCCAGCCTGGGCTTGG + Intergenic
932646387 2:73507389-73507411 CTGTGAATCCATCTGGTCCTGGG + Intronic
932726336 2:74182893-74182915 CTGTAGTCCCAGCTGAGGCTGGG + Intergenic
932853047 2:75205670-75205692 CTGTGAATCCATCTGGTCCTAGG + Intergenic
933132473 2:78689827-78689849 CTGTGAATCCATCTGGTCCTGGG - Intergenic
933237396 2:79880428-79880450 CTGTGAATCCATCTGGTCCTGGG + Intronic
933487962 2:82947199-82947221 CTGTGAATCCATCTGGTCCTGGG + Intergenic
933602165 2:84344312-84344334 CTGTGAATCCATCTGGTCCTGGG + Intergenic
935231291 2:101099390-101099412 CTGTGAATCCATCTGGTCCTGGG - Intronic
935467395 2:103415358-103415380 CTGTGAATCCATCTGGTCCTGGG - Intergenic
935613590 2:105052725-105052747 CAGTGAAGCCATCTGGGCCTGGG + Intronic
935711135 2:105899706-105899728 CTGTGAATCCATCTGGTCCTGGG + Intergenic
936274825 2:111086095-111086117 CTGTGAATCCATCTGGTCCTGGG - Intronic
936769225 2:115891705-115891727 CTGTGAATCCATCTGGTCCTGGG + Intergenic
937079630 2:119131333-119131355 CTGTGGTCATCTCTGGGGCTAGG + Intergenic
937148173 2:119665530-119665552 CTGTGAATCCATCTGGTCCTGGG - Intergenic
937326580 2:120993095-120993117 ATGAGGCCCCATCTGGGGGTAGG + Intergenic
937728152 2:125191741-125191763 CTGTGAATCCATCTGGTCCTGGG + Intergenic
937767343 2:125677047-125677069 CTGTGAATCCATCTGGTCCTGGG + Intergenic
938037766 2:128050193-128050215 CTGTGAATCCATCTGGTCCTGGG + Intergenic
938425645 2:131184611-131184633 CTGTGAATCCATCTGGTCCTGGG - Intronic
938567795 2:132535672-132535694 CTGTGAATCCATCTGGTCCTGGG + Intronic
938864715 2:135406352-135406374 CTGTGAATCCATCTGGTCCTGGG - Intronic
938954257 2:136283495-136283517 CTGTGGACAAAGCAGGGGCTGGG - Intergenic
939110034 2:137995546-137995568 CTGTGAATCCATCTGGTCCTGGG - Intronic
939179836 2:138791465-138791487 CTGTGAATCCCTCTGGTGCTGGG + Intergenic
939188636 2:138889479-138889501 CTGTGAATCCATCTGGTCCTGGG - Intergenic
939223437 2:139334707-139334729 CTGTGAATCCATCAGGTGCTGGG - Intergenic
939248160 2:139651688-139651710 CTGTGAATCCATCTGGTCCTGGG - Intergenic
939288275 2:140160781-140160803 CTGTGAATCCATCTGGTTCTGGG + Intergenic
939305538 2:140405727-140405749 CTGTGAATCCATCTGGTTCTGGG - Intronic
939653140 2:144788777-144788799 CTGTGAATCCATCTGGTCCTGGG - Intergenic
939800498 2:146700974-146700996 TTGTGGACCCACCTGAGGCCTGG + Intergenic
939860339 2:147412527-147412549 CTGTGAATCCATCTGGTCCTGGG + Intergenic
939872526 2:147541180-147541202 CTGTGATCTCATCTGAGGCTTGG - Intergenic
939912702 2:148003142-148003164 CTGTGAATCCATCTGGTCCTGGG - Intronic
939948033 2:148434000-148434022 CTGTGAATCCATCTGGTCCTGGG + Intronic
940365337 2:152842647-152842669 CTGTGAAGCCATCTGGTCCTGGG + Intergenic
940438714 2:153687253-153687275 CTGTGAATCCATCTGGCCCTGGG + Intergenic
940465541 2:154022314-154022336 CTGTGAATCCATCTGGTCCTGGG + Intronic
940602924 2:155883734-155883756 CTGTGAAGCCATCTGGCCCTGGG - Intergenic
940934252 2:159473180-159473202 CTGTGAATCCATCTGGTCCTGGG + Intronic
941148921 2:161889393-161889415 CTATGAATCCATCTGGTGCTGGG + Intronic
941227741 2:162869090-162869112 CTCTGGACCCATCTGGGGCCTGG + Intergenic
941608792 2:167634732-167634754 CTGTGAATCCATCTGGACCTGGG - Intergenic
941797693 2:169618464-169618486 CTGTGAATCCATCTGGTCCTGGG + Intronic
942405880 2:175654453-175654475 CTGTGAATCCATCTGGTCCTGGG - Intergenic
942504195 2:176624418-176624440 CTGTGAATCCATCTGGTCCTGGG + Intergenic
942638509 2:178035406-178035428 CTGTGAAGCCATCTGGTCCTGGG - Intronic
942733010 2:179080022-179080044 CTGTGAATCCATCTGGTCCTGGG - Intergenic
942840585 2:180355955-180355977 CTGTGAATCCATCTGGGCCTTGG + Intergenic
942862864 2:180636589-180636611 CTCTGGACCCATCTGGGGCCTGG + Intergenic
942984714 2:182125509-182125531 CTGTGAATCCATCTGGTCCTGGG + Intronic
943188806 2:184649848-184649870 CTGTGAATCCATCTGGTCCTGGG - Intronic
943227279 2:185193998-185194020 CTGTGAATCCATCTGGTCCTGGG - Intergenic
943240541 2:185378061-185378083 CTGTGAATCCATCTGGCCCTGGG - Intergenic
943425156 2:187722486-187722508 CTGTGAATCCATCTGGTCCTAGG + Intergenic
943500656 2:188684949-188684971 CTGTGGCTCCATCTGGTCCTGGG + Intergenic
943545358 2:189269848-189269870 CTGTGAATCCATCTGGTCCTGGG + Intergenic
943548954 2:189314961-189314983 CTGTGAATCCATCTGGTCCTGGG - Intergenic
943837160 2:192528026-192528048 CTGTGAATCCATCTGGTCCTGGG - Intergenic
943859094 2:192836556-192836578 CTGTGAATCCATCTGGTCCTGGG + Intergenic
943873716 2:193035119-193035141 CTGTGAATCCATCTGGTCCTGGG + Intergenic
944385416 2:199158334-199158356 CTGTGAATCCATCTGGTCCTGGG - Intergenic
944485841 2:200204428-200204450 CTGTGAACCCATCTGGTTCTGGG - Intergenic
944518548 2:200539114-200539136 CTGTGAAACCATCTGGACCTGGG + Intronic
944608258 2:201373157-201373179 CTGTGAATCCATCTGGTCCTGGG - Intergenic
944956078 2:204810915-204810937 CTGTGAATCCATCTGGTCCTGGG + Intronic
945193039 2:207209834-207209856 CTGTGGAGCCATCTGGTCCGGGG - Intergenic
945329415 2:208522163-208522185 CTGTGAATCCATCTGGTCCTGGG + Intronic
945366577 2:208962177-208962199 CTGTGAATCCATCTGGCTCTGGG - Intergenic
945400188 2:209372536-209372558 CTGTGAATCCATCTGGTCCTGGG - Intergenic
945434255 2:209800169-209800191 CTGTGAATCCATCTGGTCCTGGG + Intronic
945461634 2:210116298-210116320 CTCTAGACCCACCCGGGGCTGGG + Intronic
945608730 2:211971436-211971458 CTGTGAATCCATCTGGTCCTGGG - Intronic
945845608 2:214940575-214940597 CTGTGAATCCATCTGGTCCTGGG + Intronic
945847436 2:214963445-214963467 CTGTGAATCCATCTGGTCCTGGG - Intronic
946083235 2:217145258-217145280 CAGTAAAACCATCTGGGGCTAGG + Intergenic
946359799 2:219212471-219212493 AGGTGGGCCCATCTGGGGCAGGG - Exonic
946557693 2:220876837-220876859 CTGTGGACCCATGTAGGTCAAGG - Intergenic
947123657 2:226843885-226843907 CTGTGAATCCATCTGGTCCTGGG + Intronic
947225527 2:227836295-227836317 CTGTGAATCCATCTGGTCCTGGG + Intergenic
947241927 2:228004172-228004194 CTGTGAATCCATCTGGTCCTGGG + Intronic
947322225 2:228933075-228933097 CTGTGGATCCATCTGGTCCTTGG + Intronic
947364996 2:229384791-229384813 CTGTGAATCCATCTGGTCCTGGG - Intronic
947449282 2:230191663-230191685 CTGTGAATCCATCTGGTCCTGGG - Intronic
947492443 2:230607165-230607187 CTGTGAATCCATCTGGTCCTGGG - Intergenic
947681079 2:232034079-232034101 CTGTGAATCCATCTGGTCCTGGG + Intronic
947707242 2:232286154-232286176 CTGTTGACCCAGCAGGGCCTTGG + Intronic
947890510 2:233614667-233614689 CTGTGAATCCATCTGGTCCTGGG + Intergenic
947892142 2:233633421-233633443 CTGTGAACTCATCTGGTCCTGGG + Intronic
948284601 2:236773924-236773946 CTGGGGAACCAGCTGTGGCTGGG + Intergenic
948343442 2:237274752-237274774 CTGTGAATCCATCTGGTCCTGGG - Intergenic
948680738 2:239632937-239632959 CTGTGGAGCCATTTTGGCCTGGG + Intergenic
948774746 2:240278262-240278284 CTCTGGACCAATCTGGGGCTGGG + Intergenic
948970876 2:241425667-241425689 CTGTGAATCCATCTGGTCCTGGG - Intronic
1168732312 20:95692-95714 CTGTGAATCCATCTGGTCCTGGG + Intronic
1168772922 20:427683-427705 TTGAGGCTCCATCTGGGGCTGGG - Intronic
1168921736 20:1543242-1543264 CTGTGAATCCATCTGGTCCTTGG + Intronic
1168933181 20:1641220-1641242 CTGTGAATCCATCTGGTCCTGGG + Intronic
1169421015 20:5460038-5460060 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1170167557 20:13377684-13377706 CTGTGAATCCATCTGGTCCTAGG + Intergenic
1170720145 20:18870035-18870057 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1171230836 20:23483321-23483343 CTGGGGACTCATCTGAGGCTTGG + Intergenic
1171397548 20:24847036-24847058 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1171409214 20:24934824-24934846 CTCTGGTGCCATCTGGGGCTTGG - Intergenic
1171898428 20:30832945-30832967 CTGTGAATCCATCTGGTCCTAGG + Intergenic
1171913418 20:30988843-30988865 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1172180640 20:33001341-33001363 CTGCTGACCTTTCTGGGGCTGGG + Intronic
1172694536 20:36813003-36813025 CAGTGCCCCCAGCTGGGGCTGGG - Intronic
1173318604 20:41967680-41967702 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1173777046 20:45717867-45717889 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1174973877 20:55308733-55308755 CTGTGAATCCATCTGGCCCTGGG - Intergenic
1175019184 20:55826292-55826314 CTGTGGTCCCATCTAAGGCTGGG + Intergenic
1177042360 21:16129815-16129837 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1177137128 21:17317358-17317380 CTGTGAATCCATCTGGTTCTGGG - Intergenic
1177241540 21:18464790-18464812 CTGTGAATCCATCTGGTCCTGGG - Intronic
1177456394 21:21344674-21344696 CTCTGGACCCACCTGGGGCAAGG + Intronic
1177507623 21:22039018-22039040 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1177764087 21:25437003-25437025 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1178017243 21:28362378-28362400 CAGTGAAGCCATCTGGTGCTGGG + Intergenic
1178024751 21:28453550-28453572 CTGTTGACCCATCTCGGGGCAGG - Intergenic
1178209083 21:30507313-30507335 CTGTGAATCCATCTGGTTCTGGG + Intergenic
1178372890 21:32041836-32041858 CTGTGAATCCATCTGGTCCTGGG - Intronic
1180147506 21:45929481-45929503 CTGTGGATCCCACAGGGGCTAGG + Intronic
1180159941 21:45994492-45994514 CTGGGGGCCCATCCGGGGCAAGG + Intronic
1180466817 22:15618762-15618784 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1180596554 22:16978562-16978584 CTGTGAATCCATCTGGTCCTGGG - Intronic
1180674996 22:17580913-17580935 CTCTGGACACCTGTGGGGCTGGG + Intronic
1180825284 22:18857110-18857132 ATGGGGACCCCTCTGGGGATGGG + Intronic
1181143861 22:20829266-20829288 CTGTGAATCCATCTGGTCCTAGG + Intronic
1181585062 22:23848682-23848704 CAGTGCACCCATCTGAGGTTAGG + Intergenic
1182040307 22:27233349-27233371 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1182870626 22:33643942-33643964 CTGTGAATCCATCTGGTCCTGGG - Intronic
1182938621 22:34252083-34252105 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1183021160 22:35027561-35027583 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1183086863 22:35491910-35491932 CAGGGGACACATCTGGGGCAGGG - Intergenic
1183341909 22:37286259-37286281 ATCTGGGTCCATCTGGGGCTCGG - Intronic
1183687396 22:39368987-39369009 CAGAGGACCAATCTGAGGCTCGG + Intronic
1184458930 22:44626249-44626271 CTGTGGGCCCTCCTAGGGCTGGG - Intergenic
1184963004 22:47945183-47945205 CTGGGGTCTCATCTGAGGCTCGG - Intergenic
1185066543 22:48635167-48635189 CTCTGGCCCCAGCTGGTGCTAGG - Intronic
1185174756 22:49318944-49318966 CAGTGAAACCATCTGGGTCTAGG + Intergenic
1203215200 22_KI270731v1_random:2376-2398 ATGGGGACCCCTCTGGGGATGGG - Intergenic
1203275433 22_KI270734v1_random:83013-83035 ATGGGGACCCCTCTGGGGATGGG + Intergenic
949114587 3:304352-304374 CTGTGAATCCATCTGGTCCTGGG + Intronic
949149984 3:754929-754951 CAGTGAAACCATCTGGTGCTGGG + Intergenic
949173615 3:1032499-1032521 CTGTGAATCCATCTGGTCCTGGG + Intergenic
949298062 3:2549810-2549832 CTGTGAATCCATCTGGTCCTGGG + Intronic
949593862 3:5523384-5523406 CTGTGAATCCATCTGGTCCTGGG + Intergenic
950587750 3:13907923-13907945 CTGTGAAGCCATCTGGCCCTGGG - Intergenic
951070538 3:18323445-18323467 CTGTGAATCCATCTGGTCCTGGG - Intronic
951239006 3:20268431-20268453 CTGTGAATCCATCTGGTCCTGGG + Intergenic
951254160 3:20429730-20429752 CTGTGAATCCATCTGGTTCTGGG + Intergenic
951311224 3:21128405-21128427 CTGTGAATCCTTCTGGTGCTGGG - Intergenic
951414812 3:22411196-22411218 CTGTGAATCCATCTGGTCCTGGG + Intergenic
951423193 3:22511304-22511326 CTCTGGACCTACCTGGGGCCTGG + Intergenic
951462255 3:22963849-22963871 CTGTGGAGCCATATGGGAGTGGG - Intergenic
951687282 3:25359091-25359113 CTGTGAATCCATCTGGTTCTGGG + Intronic
951782025 3:26374324-26374346 CTGTGAATCCATCTGGTTCTAGG - Intergenic
951819290 3:26790736-26790758 CTCTGGATCCACCTGGGGCCTGG - Intergenic
951827520 3:26884880-26884902 CTGTGAATCCATCTGGTCCTGGG - Intergenic
951997891 3:28751752-28751774 CTGTGAATCCATCTGGCCCTGGG - Intergenic
952066375 3:29576581-29576603 CTCTGGACCCACCTGGGGCCTGG - Intronic
952361469 3:32634348-32634370 CAGTGAATCCATCTAGGGCTAGG + Intergenic
953053237 3:39365354-39365376 CTGTGAATCCATCTGGTCCTGGG - Intergenic
953079758 3:39605260-39605282 CTGTGAATCCATCTGGTCCTGGG + Intergenic
953110126 3:39927575-39927597 CTGTGAATCCATCTGGTGCAGGG - Intronic
953787494 3:45922032-45922054 CTGTGGACTCTCCTGAGGCTTGG + Intronic
954517675 3:51193525-51193547 CTGTGTATCCATCTGGTCCTGGG + Intronic
954528931 3:51301014-51301036 CTGTGAATCCATCTGGTCCTGGG + Intronic
954796334 3:53163004-53163026 CTGTGGAGTGAGCTGGGGCTTGG + Intronic
955274288 3:57532933-57532955 CTCTGGACCCACCTGGGGCTTGG - Intronic
955303583 3:57807881-57807903 CTGTGAATCCATCTGGTCCTAGG + Intronic
955464601 3:59223442-59223464 CTGTGAATCCATCTGGTCCTGGG + Intergenic
955635329 3:61022374-61022396 CTGTGGATCCATCTGGTCCTGGG - Intronic
955637557 3:61046521-61046543 CTGTGAATCCATCTGGGTCCTGG - Intronic
955642368 3:61099525-61099547 CTGTGAATCCATCTGGTCCTGGG + Intronic
956072082 3:65463737-65463759 CTGTGAATCCATCTGGTTCTGGG + Intronic
956156485 3:66303819-66303841 CTGTGATCTCATCTGAGGCTAGG + Intronic
956300030 3:67762029-67762051 CTGTGAATCCATCTGGTCCTGGG + Intergenic
956313283 3:67905763-67905785 CTGTGAATCCATCTGGTCCTGGG + Intergenic
956668751 3:71666474-71666496 CTGTGAATCCATCTGGTCCTGGG - Intergenic
956681521 3:71785562-71785584 CTGTGGACACATAGGGGGCGGGG + Intergenic
957268563 3:78000169-78000191 CTGTGAATCCATCTGGTCCTGGG + Intergenic
957307401 3:78475631-78475653 CTGTGAAACCATCTGGCCCTGGG - Intergenic
957696175 3:83640390-83640412 CTGTGAATCCATCTGGTCCTGGG - Intergenic
958458843 3:94368296-94368318 CTGTGAACCCATCTGGTCCTGGG + Intergenic
958607226 3:96374629-96374651 CTGTGAATCCATCTGGTCCTGGG + Intergenic
958703136 3:97618792-97618814 CTGTGAATCCATCTGGTCCTGGG - Intronic
958775733 3:98480600-98480622 CTGTGAATCCATCTGGTCCTGGG + Intergenic
958812057 3:98871885-98871907 CTGTGAATCCATCTGGTCCTGGG + Intronic
958818691 3:98947759-98947781 CTGTGAATCCATCTGGTCCTGGG + Intergenic
959092750 3:101921673-101921695 CTGTGAATCCATCTGGTCCTGGG + Intergenic
959253264 3:103975253-103975275 CTGTGAATCCATCTGGTCCTGGG - Intergenic
959433612 3:106285438-106285460 CTGTGAATCCATCTGGTCCTGGG - Intergenic
959453024 3:106526272-106526294 CTGTGAATCCATCTGGTCCTGGG - Intergenic
959727947 3:109565659-109565681 CTGTGAAACCATTTGGGCCTGGG + Intergenic
959868463 3:111299660-111299682 CTCTGGACCCAGCTGGGGCTAGG - Intronic
959875990 3:111382752-111382774 CTGTGAATCCATCTGGACCTGGG - Intronic
960207250 3:114917978-114918000 CTCTGGAACCATCTGGGGCCGGG - Intronic
960233783 3:115258182-115258204 CTGTGGATCCGTCTGGTCCTGGG - Intergenic
960401996 3:117211439-117211461 CAGTGAAGCCATCTGGTGCTGGG - Intergenic
960620097 3:119629019-119629041 CTGTGGGACCATCTTGGGTTGGG + Intronic
960688417 3:120317297-120317319 CTGTGAATCCATCTGGTCCTGGG - Intergenic
960711341 3:120532016-120532038 CAGTGGAACCATCTGGGCTTGGG + Intergenic
960768973 3:121170722-121170744 CTGTGAATCCGTCTGGTGCTGGG - Intronic
960806721 3:121590733-121590755 CAGTGAAGCCATCTGGGACTGGG - Intergenic
960868178 3:122223578-122223600 CTGTGAATCCATCTGGCTCTGGG - Intronic
960881227 3:122347274-122347296 CAGTGAAGCCATCTGGGCCTGGG + Intergenic
960890919 3:122447050-122447072 CTGTGAATCCATCTGGTCCTGGG - Intronic
960929901 3:122836606-122836628 CTGTGAATCCATCTGGTCCTAGG + Intronic
961213417 3:125142284-125142306 CTCTTAGCCCATCTGGGGCTGGG - Intronic
962125180 3:132609661-132609683 CTGTGAAACCATCTGGTCCTGGG - Intronic
962193662 3:133337099-133337121 CTCTGGACCCACCTGGGGCCTGG + Intronic
962441742 3:135425975-135425997 CTTTGAAGCCATCTGGGCCTGGG - Intergenic
962554435 3:136532483-136532505 CTGTGAATCCTTCTGGGCCTGGG + Intronic
962862556 3:139418462-139418484 CTCTAGACCCATCTGGGGCCTGG - Intergenic
962994168 3:140608762-140608784 CTGTGGACCCATCTGGTCCAGGG - Intergenic
963027774 3:140936872-140936894 CTGTGAATCCATCTGGTCCTGGG - Intergenic
963339536 3:144018237-144018259 CTTTGGTCCCATCTCTGGCTGGG + Intronic
963448116 3:145440547-145440569 TTCTGGACCCACCTGGGGCCTGG + Intergenic
963892421 3:150650562-150650584 CTTTGGACCCCTCTGGGATTTGG + Intergenic
964049107 3:152369621-152369643 CTGTGAATCCATCTGGTCCTGGG + Intronic
964171280 3:153772523-153772545 CTGTGAATCCATCTGGTCCTGGG - Intergenic
964209232 3:154209850-154209872 CTCTCGACCCACCTGGGGCCTGG - Intronic
964232807 3:154490303-154490325 CTGTGAATCCATCTGGTTCTAGG - Intergenic
964296225 3:155236657-155236679 CTGTGAATCCATCTGGTCCTAGG + Intergenic
964349891 3:155791875-155791897 CTCTGGACCTATCTGAGACTGGG + Intronic
964390943 3:156197418-156197440 CTGTGAATCCATCTGGTCCTGGG + Intronic
964561558 3:158002300-158002322 CTGTGAATCCATCTGGTCCTGGG + Intergenic
964566980 3:158067631-158067653 CTGTGAATCCATCTGGTCCTGGG - Intergenic
964582829 3:158259676-158259698 CTCTGGACCTGCCTGGGGCTGGG - Intronic
964831579 3:160889531-160889553 CTGTGAATCCATCTGGTCCTGGG - Intronic
964985804 3:162736516-162736538 CTGTGTTCTCATCTGGAGCTTGG - Intergenic
965886100 3:173448673-173448695 CTGTGAATCCATCTGGTCCTGGG + Intronic
966136896 3:176709070-176709092 CTGTGAATCCATCTGGTCCTGGG - Intergenic
966145150 3:176803158-176803180 CTGTGAATCCATCTGGTCCTGGG - Intergenic
966312970 3:178615372-178615394 CTCTGGACCCACTTGGGGCCTGG - Intronic
966317820 3:178668290-178668312 TTGTGGACCCTTCTGTGCCTTGG - Intronic
966320179 3:178693855-178693877 CTGTGAATCCATCTGGTCCTGGG + Intronic
966348637 3:179005395-179005417 CTCTGGACCCACCTGGGGCCTGG + Intergenic
966539319 3:181071956-181071978 CTGTGAATCCATCTGGTCCTGGG + Intergenic
966573504 3:181473992-181474014 CTGTGAATCCATCTGGTCCTGGG + Intergenic
966753523 3:183345950-183345972 CTGTGTATCCATCTGGTCCTGGG - Intronic
967419257 3:189255634-189255656 CTGTGAAGCCATCTGGTCCTGGG + Intronic
967608033 3:191471276-191471298 CTGTGTACCCATAAGGGGATTGG + Intergenic
967636677 3:191809359-191809381 CTCTGGACCCACCTGAGGCAGGG + Intergenic
967652962 3:192008993-192009015 CTGTGGACTCTTCTGAGGCTGGG - Intergenic
968083101 3:195860412-195860434 CTGTGGACCCATCTGGGGCACGG + Intergenic
968217879 3:196909292-196909314 CTGTGAATCCATCTGGTCCTGGG - Intronic
968253811 3:197247341-197247363 CTGTGCACCCACTTGGGGCGGGG + Intronic
968556185 4:1247613-1247635 CTGTGTACCCGTCTGCAGCTTGG - Intronic
969020079 4:4134005-4134027 ATGTGGGCCCAACTGGGGGTGGG + Intergenic
969464100 4:7344531-7344553 ATGTGCCCCCATCAGGGGCTGGG + Intronic
969495023 4:7521554-7521576 CTGTGGAGCCATCGGGTCCTGGG + Intronic
969690371 4:8700887-8700909 TTGTGGACCTAACTGGGGGTGGG + Intergenic
970204575 4:13643218-13643240 GAGTGGACCCACCTGGGGCCAGG - Intergenic
970413495 4:15833999-15834021 CTGTGTTCCCATCTGGGATTTGG + Intronic
970490242 4:16564756-16564778 CTGTGAAACCATCTGGGCCTGGG - Intronic
970952421 4:21772535-21772557 CTGTGAATCCATCTGGTCCTGGG + Intronic
971417551 4:26446841-26446863 CTGTGAATCCATCTGGTCCTGGG - Intergenic
971883559 4:32412873-32412895 CTGTGAATCCATCTGGTCCTGGG - Intergenic
971970238 4:33610090-33610112 CTGTGAATCCATCTGGTCCTGGG - Intergenic
972219631 4:36939144-36939166 CTGTGAATCCATCTGGTCCTGGG - Intergenic
972742654 4:41903218-41903240 CTGTGAATCCATCTGGTCCTGGG + Intergenic
972909610 4:43797979-43798001 ATCTGGACCCACCTGGGGCCTGG + Intergenic
972972670 4:44596598-44596620 CTGTGAATCCATCTGGTCCTGGG - Intergenic
973227517 4:47802658-47802680 CTCTGGACCCACCTGAGGCCTGG + Intronic
973347373 4:49071364-49071386 CTGTGAATCCATCTGGTCCTGGG - Intergenic
973562977 4:52155001-52155023 CTGTGAATCCATCTGGTCCTGGG - Intergenic
973929435 4:55775709-55775731 CTGTGAAGCCATCTGGTCCTGGG - Intergenic
974346649 4:60691180-60691202 CTGTGAATCCATCTGGTCCTGGG - Intergenic
974452987 4:62090908-62090930 CTGTGAATCCATCTGGTCCTAGG + Intergenic
974490245 4:62555615-62555637 CTGTGAATCCATCTGGTCCTGGG + Intergenic
974851446 4:67409305-67409327 CTGTGAATCCATCTGGCCCTGGG + Intergenic
974909943 4:68105132-68105154 CTGTGAAGCCATCTGGTCCTGGG + Intronic
975095255 4:70450050-70450072 TTCTGGACCCATCTGGGGAATGG - Intronic
975149078 4:71001597-71001619 CTGTGAATCCATCTGGTCCTGGG + Intronic
975194543 4:71508639-71508661 CTGTGAATCCATCTGGTCCTGGG - Intronic
975227834 4:71895005-71895027 CTGTGAATCCATCTGGTCCTGGG - Intergenic
975246188 4:72123295-72123317 CTGTGAATCCATCTGGTTCTGGG - Intronic
975297888 4:72754913-72754935 CTGTGAATCCATCTGGTCCTGGG - Intergenic
975453729 4:74564550-74564572 CTGTGAATCCATCTGGTCCTGGG - Intergenic
975503976 4:75117783-75117805 CTCTTGACCCATCTGGGGCCTGG + Intergenic
975592701 4:76016672-76016694 CTCTGGGCCCATCTGGTGCCTGG - Intronic
975933059 4:79550327-79550349 CTGTGAACCCATCTGATCCTGGG - Intergenic
976254123 4:83083087-83083109 CTCTGGACTCACCTGGGGCCTGG - Intergenic
976451068 4:85191618-85191640 CTGTGAATCCATCTGGTCCTGGG + Intergenic
976455290 4:85239721-85239743 CTGTGAATCCATCTGGTCCTGGG - Intergenic
976665415 4:87585327-87585349 CTGTGAATCCATCTGGTCCTGGG - Intergenic
976669830 4:87639797-87639819 CTGTGAATCCATCTGGTCCTGGG - Intergenic
976724394 4:88201520-88201542 CAGTGAATCTATCTGGGGCTAGG - Intronic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
976807096 4:89060377-89060399 CTGTGAATCCATCTGGTCCTGGG + Intronic
976908307 4:90267389-90267411 CTCTGGACCCACCTGGGGCCTGG + Intronic
976948179 4:90796102-90796124 CTGTGAATCCATCTGGTCCTGGG + Intronic
977228508 4:94423660-94423682 CTGTGCACCCATCTGGTCCAGGG - Intergenic
977502393 4:97857269-97857291 CTGTGAATCCATCTGGTGTTGGG + Intronic
977509762 4:97948015-97948037 CTGTGAACCCATCTGATCCTGGG + Intronic
977515226 4:98013557-98013579 CTGTGAATCCATCTGGTCCTGGG + Intronic
977616858 4:99096546-99096568 CTGTGAATCCATCTGGTCCTGGG + Intergenic
977729643 4:100335606-100335628 CTGTGAATCCATCTGGTCCTGGG - Intergenic
977771071 4:100861131-100861153 CTGTGAATCCATCTGGTCCTGGG + Intronic
977863669 4:101997531-101997553 CTGTGAATCCATCTGGTACTAGG + Intronic
977968826 4:103189171-103189193 CTGTGAATCCATCTGGTCCTGGG - Intronic
978045676 4:104123979-104124001 CTGTGAATCCATCTGGTTCTGGG - Intergenic
978163446 4:105577527-105577549 CTGTGAATCCATCTGGTCCTGGG + Intronic
978206488 4:106086462-106086484 CTGTGAATCCATCTGGTCCTGGG - Intronic
978544394 4:109855150-109855172 CTGTGAATCCATCTGGTCCTGGG + Intronic
978629213 4:110723804-110723826 CTGTGAATCCATCTGGTCCTGGG + Intergenic
978654441 4:111049423-111049445 CTTTGGACCCACCTGGGGCCAGG + Intergenic
978661865 4:111137011-111137033 TTCTGGACACAGCTGGGGCTTGG - Intergenic
978724262 4:111951784-111951806 CTGTGAATCCATCTGGTCCTGGG + Intergenic
979195112 4:117911967-117911989 CTGTGAATCCATCTGGTCCTGGG + Intergenic
979208626 4:118073333-118073355 CTGTGAATCCATCTGGTCCTGGG + Intronic
979219059 4:118200149-118200171 CTCTGGACCCTCCTGGAGCTTGG - Intronic
979373586 4:119918021-119918043 CTGTGAATCCATCTGGTCCTGGG - Intergenic
979417760 4:120464138-120464160 CTGTGAATCCATCTGGTTCTGGG - Intergenic
979421711 4:120512642-120512664 CTGTGAATCCATCTGGTCCTGGG - Intergenic
979461301 4:120987323-120987345 CTGTGAATCCATCTGGTCCTGGG + Intergenic
979570483 4:122217822-122217844 CTGTGAATCCATCTGGTCCTGGG + Intronic
979697990 4:123635881-123635903 CTGTGAATCCATCTGGTCCTGGG + Intergenic
979735366 4:124076129-124076151 CTGTGAATCCATCTGGTCCTGGG - Intergenic
979968797 4:127109237-127109259 CTGTGAATCCATCTGGTCCTGGG - Intergenic
980021806 4:127719593-127719615 CTGTAGATCCATCTGGTCCTGGG + Exonic
980087464 4:128406200-128406222 CTGTGTATCCATCTGGTCCTGGG + Intergenic
980158293 4:129132602-129132624 CTGGGGATCAACCTGGGGCTTGG - Intergenic
980184973 4:129449590-129449612 CTGTGAATCCATCTGGTCCTGGG - Intergenic
980238132 4:130135071-130135093 CTGTGAATCCATCTGGTCCTGGG - Intergenic
980573780 4:134659293-134659315 CTGTGAATCCATCTGGTCCTGGG - Intergenic
980672118 4:136023526-136023548 CTGTGAATCCATCTGGTCCTGGG - Intergenic
980685039 4:136216731-136216753 CTGTGAATCCATCTGGTCCTGGG + Intergenic
980887798 4:138782231-138782253 CTGTGAATCCATCTGGTCCTGGG + Intergenic
981131891 4:141166330-141166352 CTGTGAATCCATCTGGTCCTGGG - Intronic
981139273 4:141249508-141249530 ATGTGAATCCATCTGGGCCTTGG + Intergenic
981160379 4:141490831-141490853 CTGTGAATCCATCTGGTCCTGGG + Intergenic
981241170 4:142477807-142477829 CTGTGAATCCATCTGGTCCTGGG - Intronic
981296990 4:143143893-143143915 CTGTGAATCCATCTGGTCCTGGG - Intergenic
981553409 4:145965025-145965047 CTGTGAATCCATCTGGTCCTGGG + Intergenic
981627339 4:146773854-146773876 CTGTGAATCCATCTGGTCCTGGG + Intronic
981671872 4:147296000-147296022 CTGTGAATCCATCTGGTCCTGGG - Intergenic
981794609 4:148582106-148582128 CTGTGAATCCATCTGGTCCTGGG + Intergenic
982338077 4:154261979-154262001 CTGTGGACCCACCTCAGACTCGG - Intronic
982670115 4:158310665-158310687 CTGTGAATCCATCTGGTGCAGGG + Intergenic
982731846 4:158964349-158964371 CTGTGAAGTCATCTGAGGCTGGG - Intronic
982810189 4:159815998-159816020 CTGTGAATCCATCTGGTGCTGGG - Intergenic
982815124 4:159875017-159875039 CTGTGAATCCATCTGGTCCTGGG + Intergenic
982825320 4:159996866-159996888 CTGTGAATCCATCTGGTCCTGGG - Intergenic
982848565 4:160281106-160281128 CTGTGAATCCATCTGGTCCTTGG - Intergenic
983005507 4:162479570-162479592 CTGTGAATCCATCTGGTCCTGGG + Intergenic
983047157 4:163001324-163001346 CTGTGAATCCATCTGGCCCTGGG + Intergenic
983179094 4:164626776-164626798 CTGTGAATTCATCTGGGCCTGGG - Intergenic
983456350 4:167969173-167969195 CTCTGTACCCACCTGGGGCCTGG + Intergenic
983804584 4:171978583-171978605 CTGTGAACCCATCTGTGGCAGGG - Intronic
984268578 4:177523676-177523698 CTGTGAATCCATCTGGTCCTGGG - Intergenic
984301049 4:177918142-177918164 CTGTGAATCCATCTGGTCCTGGG - Intronic
984354509 4:178640507-178640529 CTGTGAATCCATCTGGTCCTCGG - Intergenic
984482627 4:180325343-180325365 CTGTGAATCCATCTGGTCCTGGG - Intergenic
984525827 4:180858458-180858480 CTGTGAATCCATCTGGTCCTGGG + Intergenic
984618978 4:181930547-181930569 CTGTGAATCCATCTGGTCCTGGG - Intergenic
984763648 4:183383597-183383619 CTGTGGAGCCACCAGGAGCTAGG + Intergenic
985084932 4:186303423-186303445 CAGTGAACCCCTCTGGGCCTGGG + Intergenic
985115313 4:186584441-186584463 CTGTGGTTTCATCTGAGGCTGGG - Intergenic
985214730 4:187638973-187638995 CTGTGAATCCATCTGGTCCTGGG + Intergenic
985810061 5:2076101-2076123 CTGTCCATCCATCTGGGGCCTGG - Intergenic
986227655 5:5831297-5831319 CTGTGAATCCATCTGGCCCTGGG - Intergenic
986876915 5:12122457-12122479 CTGTGGATCTATTTGGGGCCAGG + Intergenic
986878113 5:12135704-12135726 CTGTGAATCCATCTGGTCCTGGG - Intergenic
986996832 5:13616798-13616820 CTGTGAATCCATCTGGTCCTGGG - Intergenic
987189288 5:15457603-15457625 CAGTGGAGCCATCTGGTTCTGGG + Intergenic
987269872 5:16295823-16295845 CTGTGAATCCATCTGGTCCTGGG + Intergenic
987399505 5:17460612-17460634 CTGTGAATCCATCTGGTCCTGGG + Intergenic
987611765 5:20213492-20213514 CTGTGAATCCATCTGGTTCTGGG + Intronic
987656844 5:20818134-20818156 CTGTGAATCCATCTGGTCCTGGG - Intergenic
987834406 5:23143052-23143074 CTGTGAATCCATCTGGTCCTGGG + Intergenic
987837112 5:23175940-23175962 CTGTGAATCCATCTGGCCCTGGG + Intergenic
987922975 5:24307863-24307885 CTGTGAATCCATCTGGTCCTGGG + Intergenic
987957466 5:24759336-24759358 CTGTGAATCCATCTGGCACTGGG + Intergenic
988003653 5:25381143-25381165 CTGTGAATCCATCTGGTCCTGGG + Intergenic
988261310 5:28889507-28889529 CTGTGAATCCATCTGGCCCTTGG - Intergenic
988340660 5:29966663-29966685 CTGTGAATCCATCTGGTCCTGGG - Intergenic
988364947 5:30285768-30285790 CTGTGAATCCATCTGGTCCTTGG + Intergenic
988642285 5:33053739-33053761 CTGTGAAGCCATCTGGTCCTGGG - Intergenic
988719524 5:33862573-33862595 CTGTGAATCCATCTGGTCCTGGG - Intronic
988766709 5:34385817-34385839 CTGTGAATCCATCTGGTCCTGGG + Intergenic
988775292 5:34472485-34472507 CTGTGAATCCGTCTGGGCCTAGG - Intergenic
988862158 5:35293593-35293615 CAGTGGAGCCATCTGGTCCTGGG + Intergenic
988867391 5:35350607-35350629 CTGTGAATCCATCTGGTCCTGGG + Intergenic
989083756 5:37653550-37653572 CTGTGAATCCATCTGGTCCTGGG + Intronic
989222781 5:38987334-38987356 CTGTGAATCCATCTGGTCCTGGG + Intronic
989324021 5:40169225-40169247 CTGTGGATCCATCTGGTTCAGGG - Intergenic
989324789 5:40179487-40179509 CTGTGAATCCATCTGGTCCTGGG - Intergenic
989365880 5:40654575-40654597 CTGTGAATCCATCTGGCCCTGGG - Intergenic
989504764 5:42215100-42215122 CTCTGGACCCATCTGGGTCCTGG - Intergenic
989533518 5:42536775-42536797 CTGTGAATCCATCTGGTCCTGGG + Intronic
989657908 5:43764137-43764159 CCATGAAGCCATCTGGGGCTAGG + Intergenic
989676398 5:43978463-43978485 CTGTGAATCCATCTGGTCCTGGG + Intergenic
989789199 5:45374529-45374551 CTGTGAATCCATCTGGTCCTGGG - Intronic
989970679 5:50520994-50521016 CTCTGGACCCATCTGGGATCTGG - Intergenic
990443935 5:55875467-55875489 CAGTGAAGCCATCTGGGCCTGGG + Intronic
991039789 5:62163107-62163129 CTATGGAGCCAGCAGGGGCTAGG - Intergenic
991055871 5:62319482-62319504 CAGGGGACCCATCTTAGGCTAGG - Intronic
991199314 5:63973058-63973080 CTGTGAATCCATCTGGTCCTCGG - Intergenic
991238070 5:64422385-64422407 CTGTGAATCCATCTGGTCCTGGG - Intergenic
991627053 5:68614092-68614114 CAGTGAAGCCATCTGGTGCTGGG - Intergenic
992026895 5:72679235-72679257 CTGTGAATCCATCTGGTCCTGGG + Intergenic
992511915 5:77445308-77445330 CTGTGAATCCATCTGGTCCTGGG - Intronic
992965899 5:81999908-81999930 CTGTGAATCCATCTGGTCCTGGG - Intronic
993146591 5:84101700-84101722 CTGTGAATCCATGTGGGCCTGGG - Intronic
993404255 5:87491586-87491608 CTGTGGAGCCACCTGGTCCTGGG + Intergenic
993544704 5:89196912-89196934 CTGTGAATCCATCTGGTCCTGGG + Intergenic
993986636 5:94605295-94605317 CTGTGAATCCATCTGGTTCTGGG - Intronic
994224519 5:97236875-97236897 CTGTGAATCCATCTGGTCCTGGG + Intergenic
994344836 5:98672150-98672172 CTGTGAATCCATCTGGTCCTGGG - Intergenic
994423942 5:99560355-99560377 CTGTGAATCCATCTGGTCCTGGG + Intergenic
994428665 5:99627850-99627872 TTCTGGACTCATCTGGGGCTTGG - Intergenic
994550958 5:101234400-101234422 CTGTGAATCCATCTGGTCCTAGG + Intergenic
994585744 5:101707185-101707207 CTGTGAATCCATCTGGTCCTGGG + Intergenic
994917728 5:106001654-106001676 CTGTGAATCCATCTGGTCCTGGG + Intergenic
995257998 5:110069564-110069586 CTGTGAATCCATCTGGTCCTGGG + Intergenic
995329424 5:110930445-110930467 CTGTGAATCCATCTGGTCCTGGG + Intergenic
995416315 5:111917239-111917261 CTGTGAATCCATCTGGTCCTGGG - Intronic
995471534 5:112507063-112507085 CTGTGAATCCATCTGGTCCTGGG - Intergenic
995593742 5:113726862-113726884 CTGTGAATCCATCTGGTCCTGGG + Intergenic
995777907 5:115745518-115745540 CTCTGGACCCACCTGGGGCATGG - Intergenic
996046242 5:118876758-118876780 CTGTGAATCCATCTGGTCCTTGG - Intronic
996133329 5:119809038-119809060 TTCTGGACCCACCTGGGGCCTGG - Intergenic
996306174 5:122050354-122050376 CTGTGGATCCATCTGGTCTTGGG + Intronic
996326732 5:122283396-122283418 CTGTGAATCCATCTGGTCCTGGG + Intergenic
996663043 5:126026954-126026976 CCCTGGAGCCATCTGGGGCCTGG - Intergenic
996663479 5:126030813-126030835 CTGTGAATCCATCTGGTTCTGGG - Intergenic
996963728 5:129282733-129282755 CTGTGAATCCATCTGGTCCTGGG - Intergenic
996987121 5:129581045-129581067 CTGTGAATCCATCTGGTCCTGGG + Intronic
997040593 5:130248591-130248613 CTGTGAATCCATCTGGTCCTGGG + Intergenic
997054027 5:130419149-130419171 CTGTGAATCCATCTGGTCCTGGG - Intergenic
997220027 5:132154037-132154059 CTGTGAATCCATCTGGTCCTGGG + Intergenic
997580704 5:135015018-135015040 CAGCAGACCCATCTGGGGCCAGG - Intergenic
997773163 5:136572959-136572981 CTGTGGATCCATCTGGTCCAGGG + Intergenic
997804383 5:136900708-136900730 CTGTGAATCCATCTGGTCCTGGG + Intergenic
997876138 5:137549178-137549200 CTGTGAATCCATCTGGTGCTGGG - Intronic
997879720 5:137578849-137578871 CTGTGAAGCCTTCTGGGGCTGGG + Intronic
998941168 5:147283822-147283844 CTGTGAATCCATCTGGTCCTGGG - Intronic
999029728 5:148277884-148277906 CTGTGAATCCATCTGGTCCTGGG + Intronic
999337796 5:150738149-150738171 CTGTGAATCCATCTGGTCCTAGG - Intronic
999345717 5:150817320-150817342 TTCTGAACCCACCTGGGGCTTGG + Intergenic
999688637 5:154125692-154125714 CTGTGAATCCATCTGGTCCTGGG - Intronic
999984261 5:156987945-156987967 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1000406808 5:160896574-160896596 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1000455002 5:161437943-161437965 TTCTGGACCCACCTGGGGCCTGG + Intronic
1000521817 5:162304707-162304729 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1000523824 5:162330754-162330776 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1000653867 5:163852260-163852282 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1000860098 5:166447135-166447157 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1001165092 5:169357473-169357495 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1001768782 5:174276718-174276740 CTGTGCACCCAACTGGGGATTGG + Intergenic
1001844328 5:174907910-174907932 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1001871465 5:175159728-175159750 CTGGGGACCAGTCTGGGACTAGG + Intergenic
1001887533 5:175308857-175308879 CAGTGAAGCCATCTGGGCCTGGG - Intergenic
1002380098 5:178821041-178821063 CTGTGAATCCATCTGGTGCAGGG + Intergenic
1002431723 5:179207970-179207992 CTGTGGCCCCTGCTGTGGCTGGG - Intronic
1002599522 5:180346365-180346387 TCCTGGACCCATCTGGTGCTAGG - Intronic
1003827446 6:9968646-9968668 CTGTGAATCCATCTGGTCCTGGG + Intronic
1004003131 6:11614140-11614162 CTGTGGGCCCAGCATGGGCTTGG + Intergenic
1004833879 6:19508565-19508587 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1005208197 6:23429287-23429309 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1005782177 6:29203227-29203249 CCCAGGAGCCATCTGGGGCTGGG + Intergenic
1005795113 6:29351819-29351841 CTGTGAGTCCATCTGGTGCTGGG + Intergenic
1005919355 6:30385696-30385718 CTGGGAACCCATCTGGTCCTAGG - Intergenic
1005930035 6:30476341-30476363 CTGTGCATCCATCTGGTTCTGGG - Intergenic
1006339942 6:33441396-33441418 CTCTGGAGCCATCTGGGGATAGG - Intronic
1006574265 6:35032502-35032524 CTATGCACCCGTTTGGGGCTGGG - Intronic
1007334622 6:41145129-41145151 CAGTGAAGCCATCTGGGCCTGGG + Intergenic
1007354237 6:41299794-41299816 CTGTGAATCCATCTGGTTCTGGG - Intergenic
1007401690 6:41606143-41606165 CTGGGGACCAAGCTGGGGCTTGG + Intergenic
1007516448 6:42416779-42416801 CTGTGAAACCATCTGGTCCTGGG + Intronic
1008121410 6:47621654-47621676 CTGTGAATCCATCTGGTCCTGGG + Intronic
1008192438 6:48476033-48476055 CTCTGGACCCACCTGGGTGTGGG + Intergenic
1008243952 6:49147716-49147738 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1008785428 6:55161863-55161885 CTGTGAATCCATCTGGTCCTGGG - Intronic
1008858011 6:56114108-56114130 TTCTGGACCCATTTGGGGGTTGG + Intronic
1009054627 6:58319938-58319960 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1009236510 6:61130632-61130654 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1009336391 6:62495547-62495569 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1009381921 6:63042131-63042153 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1009399228 6:63234391-63234413 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1009756744 6:67949728-67949750 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1009794748 6:68452863-68452885 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1010313789 6:74420917-74420939 CTCTGGACCCATCTATGGCCTGG + Intergenic
1010343286 6:74781981-74782003 TGCTGGACCCATCTGGGGCCTGG + Intergenic
1010482907 6:76376122-76376144 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1010496200 6:76536172-76536194 TTGTGAATCCATCTGGGCCTGGG + Intergenic
1010532003 6:76979907-76979929 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1010692267 6:78924447-78924469 CTGTGAATCCATCTGGTCCTGGG - Intronic
1010722175 6:79295876-79295898 CTGTGAAACCATCTGGTGCAGGG + Intergenic
1010812130 6:80313039-80313061 CTGTGAATCCATCTGGTCCTGGG + Intronic
1010914836 6:81603122-81603144 CTGTGAATCCATCTGGTCCTGGG - Intronic
1010945960 6:81973589-81973611 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1010956724 6:82098627-82098649 CTGTGGATCCACCTGGTCCTTGG - Intergenic
1010976168 6:82316447-82316469 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1010994321 6:82515790-82515812 CTGTGAATCCATCTGGTTCTGGG - Intergenic
1011006262 6:82648870-82648892 CTGTGAATCCATCTGGTTCTGGG - Intergenic
1011238923 6:85249683-85249705 CTGTAGACCCATCTGGCCCAGGG + Intergenic
1011411856 6:87074462-87074484 GTGGGGACCCAGCTGGGGCCTGG + Intergenic
1011776461 6:90736355-90736377 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1012003686 6:93685492-93685514 CTCTGGACCCACCTGGGACCTGG + Intergenic
1012016057 6:93853307-93853329 CTGTGAATCCATCTGGCTCTGGG + Intergenic
1012028682 6:94030163-94030185 CTCTGGACCCACCTGGGGCCTGG + Intergenic
1012079686 6:94740286-94740308 CTGTGAATCCATCTGGACCTGGG - Intergenic
1012190457 6:96273293-96273315 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1012312002 6:97737123-97737145 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1012363571 6:98412382-98412404 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1012514436 6:100042286-100042308 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1012680485 6:102173062-102173084 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1012787183 6:103645934-103645956 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1013382747 6:109593394-109593416 CTGTGAATCCATCTGGTCCTGGG - Intronic
1013625338 6:111931601-111931623 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1013672911 6:112424879-112424901 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1013874066 6:114802520-114802542 CTGTGAATCCATCTGGTCCTTGG + Intergenic
1013880830 6:114898288-114898310 CTGTGAACCCATCTGATCCTGGG - Intergenic
1013901583 6:115163252-115163274 CTGTGAATCCATCTGGACCTGGG + Intergenic
1014085117 6:117333374-117333396 CTGTGAATCCATCTGGTCCTGGG - Intronic
1014393248 6:120891619-120891641 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1014413095 6:121150614-121150636 CTGTGAATCCATCTGGTCCTGGG + Intronic
1014853630 6:126371691-126371713 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1014862338 6:126485060-126485082 CTCTGGACCCACCCAGGGCTGGG + Intergenic
1014872297 6:126611609-126611631 CTGTGAATCCGTCTGGGTCTTGG + Intergenic
1014902595 6:126986001-126986023 CTGTGAATCCATCTGGCCCTGGG - Intergenic
1014968747 6:127789405-127789427 CTGTGAATCCATCTGGTCCTAGG - Intronic
1015030381 6:128587176-128587198 CTCTGGACCCACGTGGGGCCTGG + Intergenic
1015205807 6:130637516-130637538 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1015387295 6:132638691-132638713 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1015931595 6:138366194-138366216 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1016111788 6:140233621-140233643 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1016333389 6:142977797-142977819 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1016483168 6:144504870-144504892 CTGTGAATCCATCTGGTCCTGGG + Intronic
1016900877 6:149100800-149100822 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1017141499 6:151194421-151194443 CTGTGAAGCCATCTGGTCCTAGG - Intergenic
1017322976 6:153114461-153114483 CTGTGAATCCATCTGGTCCTGGG - Intronic
1017762432 6:157580499-157580521 CTGTGAATCCATCTGGTCCTGGG + Intronic
1018484820 6:164230390-164230412 CTGTAGACCCATCTGGCTCAGGG + Intergenic
1018696454 6:166395289-166395311 CTGTGGATCCAGCTGGGCGTGGG - Intergenic
1018988838 6:168658159-168658181 CTGTGGAACCATCAGGGGTGAGG - Intronic
1019071568 6:169350488-169350510 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1019170642 6:170131459-170131481 CTGTGCTCCCGTCTGGGCCTTGG + Intergenic
1020515078 7:9107406-9107428 CTTTGGACCCATTTGGGGTCTGG + Intergenic
1020519266 7:9165981-9166003 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1020996718 7:15274672-15274694 TTGTGGATCCATCTGGTGATGGG + Intronic
1021046212 7:15925623-15925645 CTGTGGACCCACCCAGGGCCTGG + Intergenic
1021208189 7:17810498-17810520 CTGTGAAGCCATCTGGTCCTGGG - Intronic
1021501979 7:21341955-21341977 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1021584228 7:22190782-22190804 TTTTGGACCCATCAGAGGCTGGG - Intronic
1021780141 7:24096526-24096548 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1021797869 7:24275592-24275614 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1021965968 7:25918618-25918640 CAGTGAAGCCATCTGGGCCTAGG - Intergenic
1022173930 7:27855743-27855765 CTGTGAATCCATCTGGTCCTGGG - Intronic
1022686155 7:32598817-32598839 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1023320885 7:38996327-38996349 CACTGCACCCAGCTGGGGCTTGG + Intronic
1023870435 7:44260443-44260465 CTGTGGAGGCTTCTGGGGCCTGG - Intronic
1024235922 7:47398191-47398213 CTGTGAATCCATCTGGCCCTGGG - Intronic
1024450538 7:49536958-49536980 CTGTGAAGCCATCTGGCCCTGGG - Intergenic
1024560003 7:50635918-50635940 CTGTGGATCCATCTGGTCCTGGG - Intronic
1024669005 7:51574399-51574421 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1024950136 7:54852286-54852308 CTGTGAATCCATCTGGTACTGGG + Intergenic
1024998187 7:55291537-55291559 TTGTGGATCCATCTGGTCCTGGG + Intergenic
1025609304 7:63063615-63063637 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1025789576 7:64676685-64676707 CTGTGGACACATATGGGGGGAGG - Intronic
1026458198 7:70591169-70591191 CTTGGGACCCATCTGGGGTGGGG - Intronic
1027368697 7:77485280-77485302 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1027575934 7:79931046-79931068 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1027790712 7:82636815-82636837 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1027808321 7:82859149-82859171 TTCTGGACCCACCTGGGGCCTGG + Intronic
1027838335 7:83275301-83275323 CTGTGAATCCATCTGGCCCTAGG + Intergenic
1027864244 7:83626316-83626338 CTGTGAATCCATCTGGTCCTGGG + Intronic
1027996182 7:85427654-85427676 ATGTGGACCCACCTGGGCCTGGG + Intergenic
1028264390 7:88705239-88705261 CTCTGGACCCAGCTGGAGCCTGG - Intergenic
1028327333 7:89543475-89543497 CTGTGAATCCATCTGGGCTTGGG - Intergenic
1028459498 7:91075021-91075043 CTGTGAATCCATCTGGTCCTGGG - Intronic
1028499231 7:91499741-91499763 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1028759226 7:94476370-94476392 CTGTGGATGCATCTGGGGATGGG + Intergenic
1028782575 7:94754217-94754239 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1028886734 7:95942402-95942424 CTGTGAATCCATCTGGTCCTGGG - Intronic
1029325116 7:99800240-99800262 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1030231944 7:107217274-107217296 CTGTGGAGCCATCAGGTCCTGGG - Intronic
1030619139 7:111770382-111770404 TTGTGGGGCCATCTGGGGCAAGG - Intronic
1030696633 7:112592040-112592062 CTGTGCATCCATCTGGACCTGGG - Intergenic
1030718724 7:112843672-112843694 CTGTGAATCCATCTGGTCCTGGG - Intronic
1031267693 7:119601997-119602019 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1031311912 7:120209299-120209321 TTGTGGATCCATCTGGTCCTGGG - Intergenic
1031782235 7:125983034-125983056 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1031888765 7:127269498-127269520 CTGTGAATCCATCTGGTCCTAGG + Intergenic
1031902328 7:127425059-127425081 CTGTGAATCCATCTGGTCCTGGG + Intronic
1032249633 7:130243809-130243831 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1032593741 7:133218109-133218131 CTGTGGACCTCACTGGGACTGGG + Intergenic
1033028194 7:137798223-137798245 CAGTGGAGCCCTCTGGGTCTGGG - Intronic
1033178980 7:139155878-139155900 CAGTGAAGCCATCTGGGCCTGGG + Intronic
1033502419 7:141965436-141965458 CTGTGGACCCACCCAGGGCCTGG - Intronic
1033639994 7:143253527-143253549 CTGTGAAGCCATCTGGTCCTGGG - Intronic
1033679241 7:143577191-143577213 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1033692596 7:143752259-143752281 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1033867714 7:145713199-145713221 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1035136331 7:156707266-156707288 CTGTGAATCCATCTGGTCCTGGG - Intronic
1035333825 7:158113155-158113177 CTCTGGACCAATCTGAGGCCCGG - Intronic
1035343540 7:158181546-158181568 CTGTGAATCCATCTGGTCCTGGG + Intronic
1035492004 7:159287983-159288005 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1035990849 8:4488727-4488749 CTGAGGGCCCATTTGGTGCTGGG - Intronic
1036394272 8:8354301-8354323 CTGTGAAGCCATCTGGTCCTGGG - Intronic
1037230248 8:16649832-16649854 CTGTGAATCCATCTGGTTCTGGG + Intergenic
1037354080 8:17998779-17998801 CTGTGGACCCATTAGGGACCTGG - Intronic
1038011417 8:23479530-23479552 GTGTGGACTCCTCTGGGGCCAGG + Intergenic
1038369039 8:26969575-26969597 CTGTGGCAGCATCTGGGGCTAGG + Intergenic
1039264753 8:35812567-35812589 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1039802094 8:40967362-40967384 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1039839083 8:41280756-41280778 CTGTGGTCTCCTCTAGGGCTGGG - Intronic
1040043119 8:42937001-42937023 CTGTGAATCCATCTGGTCCTGGG + Intronic
1040095772 8:43440858-43440880 CTCTGGACCCACATGGGGCCTGG + Intergenic
1041023974 8:53665697-53665719 CTGTGCGCCCTGCTGGGGCTGGG - Intergenic
1041385167 8:57293536-57293558 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1042108336 8:65352701-65352723 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1042162703 8:65912928-65912950 CTCTGGACCCACCTGGGGCCTGG + Intergenic
1042452807 8:68968772-68968794 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1042473427 8:69217539-69217561 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1042768162 8:72349580-72349602 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1042833772 8:73059281-73059303 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1042976404 8:74474899-74474921 CTGTGAATCCATCTGGTCCTGGG + Intronic
1042981830 8:74538225-74538247 CTGTGAATCCATCTGGTCCTAGG + Intergenic
1043298859 8:78702081-78702103 CTGTGAATCCATCTGGTCCTGGG + Intronic
1043545380 8:81309668-81309690 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1043556405 8:81435572-81435594 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1043619493 8:82171200-82171222 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1043951641 8:86316113-86316135 CTGTGAATCCATCTGGTCCTGGG - Intronic
1044037458 8:87324414-87324436 CTGTGAATCCATCTGGTCCTGGG + Intronic
1044113612 8:88306314-88306336 CTGTGAATCTATCTGGTGCTGGG - Intronic
1044183292 8:89221753-89221775 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1044192991 8:89342127-89342149 CTCTGGACCCACTTGGAGCTTGG - Intergenic
1044377812 8:91496962-91496984 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1044395153 8:91702707-91702729 TTCTGGACCCATCTGGGGCCTGG - Intergenic
1044509105 8:93054880-93054902 CTGTGAATCCATCTGGTCCTAGG + Intergenic
1044825466 8:96192274-96192296 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1044939936 8:97331757-97331779 CTGTGAATCCATCTGGCCCTGGG + Intergenic
1045134665 8:99202577-99202599 CTGTGAATCCATCTGGTCCTGGG - Intronic
1045199994 8:99970759-99970781 CTGTGAATCCATCTGGTCCTAGG - Intronic
1045389073 8:101697325-101697347 CTGTGAATCCATCTGGTCCTGGG - Intronic
1045590024 8:103582833-103582855 CTCTGGACCCACCTGGGGCCTGG + Intronic
1045777381 8:105821759-105821781 CTTTGGACCCACCTGGGGCCTGG - Intergenic
1046111063 8:109725451-109725473 CTGTGAACACATCTGGTCCTAGG - Intergenic
1046171522 8:110514262-110514284 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1046268122 8:111858416-111858438 CTCTGGACCCACCTGGAGCCTGG - Intergenic
1046278126 8:111989090-111989112 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1046295995 8:112219289-112219311 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1046338598 8:112823245-112823267 CTGTGAATCCATCTGGTCCTGGG + Intronic
1046385206 8:113500317-113500339 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1046486116 8:114891033-114891055 CTGTGAAACCATCTGGTCCTCGG + Intergenic
1046513448 8:115227928-115227950 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1046703031 8:117422174-117422196 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1046709172 8:117490191-117490213 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1046744629 8:117863712-117863734 ATGTGGAGCCATCTGGAGCCGGG - Intronic
1046975658 8:120273821-120273843 CTGTGAATCCATCTGGCCCTGGG - Intronic
1046977959 8:120303849-120303871 CTGTGAATCCATCTGGCCCTGGG + Intronic
1047121681 8:121911785-121911807 CTGTGAACCCATCTGGTCCTGGG - Intergenic
1047342131 8:123992310-123992332 CTGTGAATCCATCTGGCCCTAGG + Intronic
1047342709 8:123998659-123998681 CTCTGGACCCATCTGGGGCCAGG - Intronic
1047369243 8:124242181-124242203 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1047634003 8:126739951-126739973 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1047661709 8:127044513-127044535 CTGTGAATCCGTCTGGTGCTGGG - Intergenic
1048094525 8:131277026-131277048 CTGTGGTTTCATCTGGGGTTTGG - Intergenic
1048646730 8:136428832-136428854 CTTTGGACCTGTCTGGGGCCAGG + Intergenic
1049115501 8:140683382-140683404 CTGTGAAGCCATCTGGTCCTGGG - Intronic
1049128488 8:140814184-140814206 CTGTGAATCCATGTGGTGCTGGG - Intronic
1049447388 8:142637597-142637619 CTGTGGTCCCAGCTGGGCCATGG - Intergenic
1049536190 8:143183556-143183578 CTGAGGGCTCACCTGGGGCTCGG + Intergenic
1049616191 8:143576748-143576770 GTGTGTGCCCACCTGGGGCTGGG - Exonic
1049748166 8:144271753-144271775 CTGGGGCCCCACCTTGGGCTGGG - Intronic
1049961350 9:741297-741319 CTGTGAACACATCTGGACCTGGG - Intronic
1050032084 9:1396889-1396911 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1050200885 9:3144529-3144551 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1050248253 9:3714240-3714262 CTCTGGACACACCTGGGGCCTGG + Intergenic
1050300165 9:4250230-4250252 CTGTGAATCCATCTGGTCCTGGG + Intronic
1050355948 9:4782594-4782616 CAATGGACCCACCTGGGGCCTGG + Intergenic
1050393465 9:5170870-5170892 CTGTGAATCCATCTGGTCCTGGG - Intronic
1050403302 9:5280190-5280212 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1050404118 9:5289586-5289608 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1050864052 9:10475514-10475536 CTGTGAATCCATCTGGTCCTGGG - Intronic
1050924249 9:11242698-11242720 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1051063990 9:13079486-13079508 CAGTGAAGCCATCTGGGCCTGGG - Intergenic
1051096641 9:13473901-13473923 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1051823997 9:21198524-21198546 CTGAGGACCCATCTGGGAGGTGG + Intergenic
1051968416 9:22858235-22858257 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1052076653 9:24150596-24150618 CCGTGGACCCATCTGGGTCGGGG + Intergenic
1052096260 9:24388084-24388106 CTGTGAATCCATCTGGTTCTAGG + Intergenic
1052106506 9:24523674-24523696 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1052154630 9:25169625-25169647 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1052384912 9:27811161-27811183 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1052475092 9:28949640-28949662 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1052551037 9:29949463-29949485 CTGTGAATCCATCTGGTCCTTGG + Intergenic
1052703306 9:31963696-31963718 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1052746347 9:32445223-32445245 CTGTGAATCCATCTGGTCCTGGG + Intronic
1052753068 9:32512098-32512120 CTGTGAATCCATCTGGTCCTGGG - Intronic
1053108038 9:35430194-35430216 CTGTGAAGCCATCTGGTCCTGGG - Intergenic
1053428020 9:38023801-38023823 CTGTGGACCCCTCAGGGCCCTGG - Intronic
1054387663 9:64576292-64576314 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1054728715 9:68678674-68678696 CTGTCCACCAATCAGGGGCTGGG - Intergenic
1054884607 9:70182466-70182488 CTGTGAATCCATCTGGTCCTGGG + Intronic
1055210629 9:73786560-73786582 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1055373050 9:75620965-75620987 CTGTGAATCCATCTGGTCCTAGG + Intergenic
1055378260 9:75675021-75675043 CTGTGAAGCCATCGGGTGCTGGG + Intergenic
1055386512 9:75768549-75768571 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1055387338 9:75776351-75776373 CTCTGGACCCATCTGGGGTCTGG + Intergenic
1055629068 9:78204457-78204479 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1056416328 9:86380079-86380101 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1056862179 9:90195703-90195725 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1057018018 9:91671160-91671182 CTGTGAATCCATCTGGCCCTGGG + Intronic
1058042132 9:100314043-100314065 CTGTGAATCCATCTGGTTCTGGG + Intronic
1058198750 9:102011894-102011916 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1058405130 9:104664375-104664397 CTGTGAATCCATCTGGTGCTGGG - Intergenic
1058514432 9:105755169-105755191 CTGTGAATCCATCTGGTCCTGGG - Intronic
1058730343 9:107844073-107844095 CTGTGTTCCCAACTGGGGATGGG + Intergenic
1058745162 9:107983278-107983300 CTGTTTACCCATGTGGGGTTGGG - Intergenic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1059077990 9:111215275-111215297 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1059261289 9:112979275-112979297 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1059515458 9:114890023-114890045 CTCTGCACTCATCTGGGGCTTGG + Intergenic
1059791832 9:117648685-117648707 CTGAGGACCCACCTGAGGCAGGG - Intergenic
1059895442 9:118859141-118859163 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1060026888 9:120180483-120180505 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1060397709 9:123327648-123327670 TGGTGGACCCGTCTGGGTCTGGG + Intergenic
1060555471 9:124505273-124505295 CTGTGAACCCAGCTGGGTCGTGG + Intronic
1060779216 9:126399405-126399427 CTGTGGCCCTCTTTGGGGCTGGG + Intronic
1060806547 9:126581189-126581211 CTGTGGGTCCCTCTGGGGTTGGG + Intergenic
1061325143 9:129859145-129859167 CTGAGGACACACCTGGGGCCGGG - Intronic
1061407746 9:130402161-130402183 TTCTGGTTCCATCTGGGGCTGGG + Intronic
1061436257 9:130564132-130564154 CTGAGGTTCCATCTGAGGCTTGG - Intergenic
1062045955 9:134424635-134424657 CAGTGGACCTTACTGGGGCTTGG - Intronic
1062069370 9:134547279-134547301 CTGTGGACGGCTCTGGAGCTGGG + Intergenic
1062357180 9:136170517-136170539 CTGTAGACCCAGCAGGGGCAGGG + Intergenic
1062590956 9:137274463-137274485 CTGGGGACCCAGGTGAGGCTGGG + Intergenic
1186369761 X:8934771-8934793 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1186686113 X:11926284-11926306 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1186736866 X:12474842-12474864 CTGTGAATCCATCTGGGTCCTGG - Intronic
1186936917 X:14460483-14460505 CTGTGCATCCATCTGGTCCTGGG + Intergenic
1186975850 X:14904033-14904055 CAGTGAAGCCATCTGGGCCTGGG - Intronic
1187641013 X:21289770-21289792 CTGTGAATCCATCTGGTTCTGGG + Intergenic
1187776972 X:22771192-22771214 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1187836292 X:23435409-23435431 CTGTGGGCCTGTCTGGGGCTAGG + Intergenic
1187846335 X:23541502-23541524 TTCTGGACCCACCTGGGGCCTGG + Intergenic
1188045599 X:25422963-25422985 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1188046178 X:25428201-25428223 CTTTGGACCCGCCTGGGGCCTGG - Intergenic
1188609001 X:32072459-32072481 CTGTGGGCCCCTCTGGGTTTTGG - Intronic
1188708176 X:33361062-33361084 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1188738889 X:33752752-33752774 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1188785715 X:34343979-34344001 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1188826910 X:34846424-34846446 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1188889856 X:35596298-35596320 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1188924551 X:36023556-36023578 CTCTGGACCCACCCGGGGCCTGG - Intergenic
1188930102 X:36098458-36098480 CTCTGGACCCACCTGGGGTCTGG - Intronic
1189280666 X:39818462-39818484 CCCTGTACCCATCTAGGGCTAGG - Intergenic
1189409030 X:40753682-40753704 CTGTGAAGCCATCTGGTCCTGGG + Intergenic
1189572149 X:42309535-42309557 CTGTGAGCCCATCTGGTGCTGGG - Intergenic
1189574691 X:42339061-42339083 CTGTGAATCCATCTGGTGCTGGG + Intergenic
1189583963 X:42438220-42438242 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1189657928 X:43266824-43266846 CTCTGGACCCACCTGGGACATGG - Intergenic
1189664927 X:43343795-43343817 CAGTGGACCCAGCTGGGCGTGGG - Intergenic
1189754460 X:44256666-44256688 CTGTGAATCCATCTGGTCCTGGG - Intronic
1189920746 X:45901020-45901042 CTGTGGAGCCATGATGGGCTGGG - Intergenic
1190341052 X:49296128-49296150 CTGTGAATCCATCTGGTCCTGGG + Intronic
1190541754 X:51484475-51484497 CTGTGGAGCCATTTGGAACTGGG - Intergenic
1190588078 X:51967393-51967415 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1190614666 X:52217841-52217863 CTCTGGACCCACTTGGGGCCTGG + Intergenic
1191027580 X:55930995-55931017 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1191179220 X:57541281-57541303 CTATGGCCCCATCCAGGGCTAGG + Intergenic
1191181835 X:57572680-57572702 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1191632277 X:63334781-63334803 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1191772154 X:64772637-64772659 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1191799636 X:65063768-65063790 CTGTGAATCCCTCTGGAGCTTGG + Intergenic
1191863200 X:65682854-65682876 ATGTGGACCCAGCTGGGCCCTGG + Intronic
1191946870 X:66544175-66544197 TTGTGGACCCACCTGGGACCTGG - Intergenic
1191950290 X:66583900-66583922 CTGTGAATCCATCTGGTCCTAGG - Intergenic
1191962801 X:66722123-66722145 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1192027211 X:67466409-67466431 TTCTGGACCCACCTGGGGCCTGG + Intergenic
1192043064 X:67643622-67643644 AGGTGGTCCCAGCTGGGGCTTGG + Intronic
1192061628 X:67833441-67833463 CTGTGAACCCGTCTGGTCCTGGG - Intergenic
1192183680 X:68931544-68931566 CTGTGGACCCAGCTTGGCCTAGG - Intergenic
1192236248 X:69297952-69297974 CTGGAGACATATCTGGGGCTGGG - Intergenic
1192290138 X:69785904-69785926 CTGTGAATCCATCTGGTCCTGGG + Intronic
1192302986 X:69925760-69925782 CTGTGAATCCATCTGGTCCTGGG + Intronic
1192376417 X:70567015-70567037 CTGTGAATCCATCTGGTCCTGGG + Intronic
1192380875 X:70614555-70614577 CTCTGGACTCACCTGGGGCCTGG + Intronic
1192607430 X:72533396-72533418 CAGTGAAGCCATCTGGGCCTGGG - Intronic
1192663454 X:73067229-73067251 CTATGAAGCCATCTGGGTCTGGG - Intergenic
1192712135 X:73602097-73602119 CTGTGAATCCATCTGGCCCTGGG - Intronic
1192712316 X:73604115-73604137 CTGTGAATCCATCTGGCCCTGGG + Intronic
1192721046 X:73698620-73698642 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1192725871 X:73751853-73751875 CTCTGGACACATCTGAGGCCTGG - Intergenic
1192855900 X:75011594-75011616 TTCTGGACCCACCTGGGGCTTGG - Intergenic
1192883262 X:75310451-75310473 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1192887517 X:75351052-75351074 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1192899146 X:75476319-75476341 CTGTGAAGCCATCTGGTCCTTGG + Intronic
1192923345 X:75730847-75730869 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1192984572 X:76383211-76383233 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1193010829 X:76673161-76673183 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1193012908 X:76697476-76697498 CTCTGAACCCACCTGGAGCTTGG + Intergenic
1193171678 X:78344666-78344688 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1193174033 X:78370942-78370964 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1193196452 X:78638254-78638276 CTGTGAATCCATCTGGTCCTAGG + Intergenic
1193209655 X:78791403-78791425 CTGTAAACCCATCTGGTCCTGGG - Intergenic
1193233322 X:79075095-79075117 CTGTGGATCCATCTTGTCCTGGG - Intergenic
1193260854 X:79404558-79404580 TTCTGGACCCAACTGGGGCCTGG + Intergenic
1193441114 X:81539845-81539867 CTCTGGACCCACCTGGGACTAGG + Intergenic
1193498596 X:82243246-82243268 CTGTGAATCCATCTGGTTCTGGG - Intergenic
1193504561 X:82326249-82326271 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1193544599 X:82810894-82810916 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1193563326 X:83047258-83047280 CTCTGGACCCACCTAGGGCCTGG - Intergenic
1193571943 X:83154706-83154728 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1193575359 X:83188626-83188648 CTGTGAATCCATCTGGATCTGGG + Intergenic
1193647344 X:84085789-84085811 CTGTGAATCCATCTGGTCCTGGG + Intronic
1193670358 X:84376794-84376816 CTCTGGACCCACCTGGGGCCTGG + Intronic
1193683659 X:84552289-84552311 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1193703700 X:84794250-84794272 CTGTGAATCCATCAGGTGCTGGG - Intergenic
1193752456 X:85362856-85362878 CTGTGAATCCATCTGGTCCTGGG + Intronic
1193780506 X:85695794-85695816 CTGTGAATCCATCTGGTTCTGGG + Intergenic
1193782124 X:85716272-85716294 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1193784436 X:85742423-85742445 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1193805416 X:85987891-85987913 CTGTGAATCCATCTGGTCCTGGG - Intronic
1194005739 X:88489218-88489240 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1194007946 X:88520599-88520621 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1194028259 X:88781190-88781212 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1194098904 X:89677657-89677679 CTGTGCATCCATCTGGTCCTGGG - Intergenic
1194130042 X:90070435-90070457 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1194217212 X:91145692-91145714 CTGTGAACCCATCTGGTCCCGGG + Intergenic
1194235339 X:91376376-91376398 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1194485699 X:94483177-94483199 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1194497729 X:94637764-94637786 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1194530796 X:95045744-95045766 CTGTGGACCCACCTGGAGTCTGG + Intergenic
1194591583 X:95805914-95805936 CTCCGGACCCACCTGGGGCCTGG + Intergenic
1194615123 X:96091229-96091251 CTGTGAATCCATCTGGCTCTGGG - Intergenic
1194625094 X:96218055-96218077 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1194635323 X:96339392-96339414 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1194782819 X:98045962-98045984 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1194787556 X:98105908-98105930 CTCTGGACCCACCTGGGGCATGG - Intergenic
1194791867 X:98160354-98160376 CTCTGGACCCACCTGGGGCCTGG + Intergenic
1194905360 X:99569142-99569164 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1194908580 X:99610191-99610213 CTGTGATCTCATCTGAGGCTCGG + Intergenic
1195172196 X:102280793-102280815 TTCTGGACCCACCTGGGGCTTGG - Intergenic
1195186664 X:102406300-102406322 TTCTGGACCCACCTGGGGCTTGG + Intronic
1195344625 X:103937280-103937302 CTGTGAATCCATCTGGTCCTGGG + Intronic
1195414540 X:104605849-104605871 CTGTGAATCCATCTGGTCCTGGG - Intronic
1195435558 X:104839698-104839720 CTGTGAACCTATCTGGTCCTGGG + Intronic
1195479117 X:105322437-105322459 TTGTGTTCCCATCTGGAGCTTGG + Intronic
1195567549 X:106360148-106360170 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1195568531 X:106373645-106373667 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1195607733 X:106828321-106828343 CTGTGAATCCATCTGGTCCTGGG - Intronic
1195610404 X:106860305-106860327 CTGTGAATCCATCTGGTACTGGG + Intronic
1195786679 X:108531967-108531989 CTGTGTATCCATCTGGTCCTGGG - Intronic
1195806114 X:108768140-108768162 CTGTGATGCCATCTGGGCCTTGG + Intergenic
1195843933 X:109205917-109205939 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1196096674 X:111808228-111808250 CTCTGGACCCACCTGGGGACTGG - Intronic
1196554792 X:117073840-117073862 CTGTGAATCCATCTGGTTCTGGG - Intergenic
1196573362 X:117289177-117289199 CTCTAGACCCATCCGGGGCCTGG + Intergenic
1197046114 X:122000645-122000667 CTGTGAATCCATCTGGCCCTGGG + Intergenic
1197048948 X:122035201-122035223 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1197113001 X:122798167-122798189 CTCTGGACCCACCTGGGGCTGGG + Intergenic
1197132744 X:123023516-123023538 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1197135608 X:123056499-123056521 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1197349499 X:125365947-125365969 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1197376062 X:125682942-125682964 CTCTGGACACACTTGGGGCTTGG + Intergenic
1197388594 X:125831610-125831632 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1197398848 X:125963794-125963816 CTGTGAATCCATCTGGCCCTGGG - Intergenic
1197402649 X:126010478-126010500 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1197581146 X:128285663-128285685 CTGTGAATCCATCTGGTTCTGGG - Intergenic
1197613977 X:128671629-128671651 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1197623472 X:128778635-128778657 CTCAGGACCCACCTGGGGCCCGG - Intergenic
1197627593 X:128820063-128820085 CTTTTGACCCATCTTGGGCAAGG + Intergenic
1197847363 X:130817298-130817320 CTGTGAATCCATCTGGTTCTGGG - Intronic
1197880443 X:131161013-131161035 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1197987071 X:132278233-132278255 TTCTGGACTCACCTGGGGCTCGG - Intergenic
1198008853 X:132529603-132529625 CTGTGAAACCATCTGGCCCTTGG + Intergenic
1198053415 X:132970594-132970616 CTGTGATCTCATCTGGGGCCTGG + Intergenic
1198515137 X:137399831-137399853 CTCTGGACACACCTGGGGCATGG - Intergenic
1198556186 X:137795828-137795850 CTGTGAATCCATCTGGTACTGGG - Intergenic
1198657530 X:138931298-138931320 CTGTGGGCCCATCTACAGCTAGG + Intronic
1198678966 X:139160875-139160897 CTGTGAATCCATCTGGTCCTGGG - Intronic
1198718853 X:139593416-139593438 CTGTGAATCCATCTGGTCCTGGG - Intronic
1198785392 X:140282944-140282966 CTCTGGACCCATCTGGGACCTGG - Intergenic
1198888797 X:141369181-141369203 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1198945675 X:142010920-142010942 CTGTGAATCCATCTGGGCCAGGG + Intergenic
1199227161 X:145390921-145390943 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1199437620 X:147830332-147830354 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1199485657 X:148345313-148345335 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1199568699 X:149246051-149246073 ATCTGGACCCATCTGGGGCTGGG - Intergenic
1199617612 X:149670471-149670493 CTGTGGACCCAGCTGGGGAGAGG - Intergenic
1199625031 X:149732778-149732800 CTGTGGACCCAGCTGGGGAGAGG + Intergenic
1199706793 X:150434014-150434036 CTGTGAATCCATCTGGTCCTGGG + Intronic
1199831032 X:151549639-151549661 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1200336577 X:155357237-155357259 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1200349893 X:155483990-155484012 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1200451925 Y:3339036-3339058 CTGTGCATCCATCTGGTCCTGGG - Intergenic
1200547698 Y:4536980-4537002 CTGTGAATCCATCTGGTTCTAGG - Intergenic
1201067275 Y:10109572-10109594 CTGTGAATCCATCTGGTCCTAGG + Intergenic
1201778503 Y:17692695-17692717 CTGTGAATCCATCTGGTCCTGGG + Intergenic
1201823053 Y:18213297-18213319 CTGTGAATCCATCTGGTCCTGGG - Intergenic
1201927758 Y:19308003-19308025 TTCTGAACCCATCTGGGGCTTGG - Intergenic
1202060800 Y:20885831-20885853 CTGTGAATCCATCTGGTTCTGGG - Intergenic