ID: 1106075762

View in Genome Browser
Species Human (GRCh38)
Location 13:26459559-26459581
Sequence CTCAAAGACAAGCTGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106075754_1106075762 17 Left 1106075754 13:26459519-26459541 CCTGGGCTGAGGGAGTGGCTGTC 0: 1
1: 0
2: 3
3: 44
4: 374
Right 1106075762 13:26459559-26459581 CTCAAAGACAAGCTGGGCCAGGG 0: 1
1: 0
2: 2
3: 28
4: 195
1106075753_1106075762 18 Left 1106075753 13:26459518-26459540 CCCTGGGCTGAGGGAGTGGCTGT 0: 1
1: 0
2: 3
3: 62
4: 889
Right 1106075762 13:26459559-26459581 CTCAAAGACAAGCTGGGCCAGGG 0: 1
1: 0
2: 2
3: 28
4: 195
1106075756_1106075762 -10 Left 1106075756 13:26459546-26459568 CCAGCCAAGGAGCCTCAAAGACA 0: 1
1: 0
2: 0
3: 20
4: 165
Right 1106075762 13:26459559-26459581 CTCAAAGACAAGCTGGGCCAGGG 0: 1
1: 0
2: 2
3: 28
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106075762 Original CRISPR CTCAAAGACAAGCTGGGCCA GGG Intergenic
901390643 1:8943705-8943727 CTCAGAGAAAGCCTGGGCCAAGG - Intergenic
901491369 1:9597997-9598019 CACAAAGACAGGCCTGGCCAGGG + Intronic
902966983 1:20012497-20012519 CTCCAAGACACACTGGGGCAGGG + Intergenic
903163240 1:21503961-21503983 CTGGAAGACAACCCGGGCCAGGG + Intergenic
904484508 1:30815935-30815957 CTCAGAGAATAGCTGGGCCAGGG + Intergenic
905298568 1:36970633-36970655 CTCCAAGACAAGCTGGATCTGGG - Intronic
905403328 1:37718075-37718097 CTCAGAGAAAAGCTGGGGCAGGG - Exonic
911315608 1:96353143-96353165 CTCAAAGAAAAGGTGAGCTAGGG - Intergenic
916254447 1:162772212-162772234 TTCAAAGAGAAGCTGGGAGAAGG + Exonic
916378353 1:164181056-164181078 TGCAAAGAAAAGCTGAGCCAGGG + Intergenic
917018557 1:170561680-170561702 CTCAAAGTCATGCTGAGACATGG - Intergenic
917038520 1:170776580-170776602 CTCAAAATCAAGCTTTGCCAAGG + Intergenic
917970151 1:180201083-180201105 TTCACAGACGAGCTGAGCCAAGG - Exonic
918451377 1:184662404-184662426 CTCTAAGACAGTGTGGGCCATGG - Intergenic
920055020 1:203185172-203185194 CTCAAGAACAGGTTGGGCCAGGG - Exonic
921052138 1:211518265-211518287 CTCTTAGCCAGGCTGGGCCAAGG + Intergenic
922659178 1:227414353-227414375 GTCAAAGATAGGCTGGGGCATGG + Intergenic
924643755 1:245857948-245857970 CTCAAGGAGAAGCTGAGGCAGGG + Intronic
1065553314 10:26890428-26890450 CTCAACCACAAGCTGGGCCCTGG + Intergenic
1065599808 10:27356888-27356910 CTCAACCACAAGCTGGGCCCTGG - Intergenic
1068164510 10:53311457-53311479 CACAAAGACAATCTGGACCCAGG + Intergenic
1071495222 10:86163300-86163322 CTCAAGGACAGGATGGGCCATGG - Intronic
1073343612 10:102764986-102765008 CTCAAAGCAGAGCTGGGCCATGG - Intronic
1074160307 10:110831256-110831278 CTCAGAGGCAAGCAAGGCCAAGG - Intronic
1075330434 10:121570113-121570135 ATCAAAGACAACCCCGGCCAGGG + Intronic
1075517639 10:123121303-123121325 TTCAAAGCCACCCTGGGCCACGG + Intergenic
1075586989 10:123665611-123665633 GTCAAAGACAGGCTGAGTCAAGG - Intergenic
1076866868 10:133170961-133170983 CTCAGAGAAAAGCTGGCCGACGG + Intronic
1078701886 11:13693258-13693280 TTCAAAGCCATCCTGGGCCATGG + Intronic
1079620912 11:22552786-22552808 CTGAAAGAAAAGCTAAGCCAAGG + Intergenic
1083419075 11:62543442-62543464 CTCAGAGACAAGCTGTGACATGG + Intronic
1083643751 11:64160025-64160047 TTGGAGGACAAGCTGGGCCATGG + Intronic
1087071143 11:94082081-94082103 CAGAGAGAGAAGCTGGGCCAGGG + Intronic
1088972803 11:114788318-114788340 GTCACTGACAAGCAGGGCCATGG + Intergenic
1091158750 11:133399542-133399564 TTCACAGACAGGCTGTGCCATGG - Intronic
1091826964 12:3520076-3520098 CCCAGAGCCAGGCTGGGCCAGGG + Intronic
1092020148 12:5195063-5195085 TTCAAGGACAAGCAGGGGCAAGG + Intergenic
1092852535 12:12643502-12643524 CTCAAAGACAATCTAGACTACGG - Exonic
1095823896 12:46511196-46511218 CTGAAAGACAACCTAGGCAATGG - Intergenic
1096609869 12:52794059-52794081 CTCTGAGACAGGGTGGGCCATGG + Intronic
1097837069 12:64283804-64283826 TTCAAACACAAGGTGAGCCAGGG - Intronic
1100037208 12:90266762-90266784 CTCAAGCTCAAGCTGTGCCAGGG - Intergenic
1100437904 12:94588758-94588780 TTCAAAGCCATGCTGGGCCGTGG - Intronic
1101547793 12:105732963-105732985 CTCAACAACAAGCAGGGACAAGG - Intergenic
1101701682 12:107179685-107179707 CTGAGAGCTAAGCTGGGCCATGG + Intergenic
1102896051 12:116599506-116599528 TTCAGAGCCAATCTGGGCCAGGG + Intergenic
1104392151 12:128400266-128400288 CCCAGAGACAAGCTCAGCCACGG - Intronic
1104809797 12:131613201-131613223 CTCAGGGACAAGCTGGGCCCTGG + Intergenic
1105461532 13:20594180-20594202 AACAAAGAGAAGCTGGACCAGGG - Intronic
1106075762 13:26459559-26459581 CTCAAAGACAAGCTGGGCCAGGG + Intergenic
1106699188 13:32210912-32210934 CTCAAAGAGAAGCTCTTCCATGG - Exonic
1108945444 13:56017743-56017765 TTCAAAACCAACCTGGGCCACGG + Intergenic
1112307029 13:98284104-98284126 TTCAAAGCCATCCTGGGCCATGG - Intronic
1112400726 13:99075939-99075961 CTGGAAGACAGGCTGGGTCAGGG - Intronic
1113606638 13:111612559-111612581 CTCCAAGACGAGCACGGCCATGG + Intronic
1119439588 14:74619385-74619407 CTCAAAGCCAAGGTGGGCACAGG - Intergenic
1121635302 14:95449988-95450010 CTCCAAGAGCCGCTGGGCCAGGG + Exonic
1122719185 14:103712667-103712689 GTCACAGACAGGCTGGGCCTGGG + Intronic
1123128098 14:105964224-105964246 TCCAAAGAGAAGCTGGGCCCTGG - Intergenic
1124609803 15:31200771-31200793 CTCCTTGACAAGCTGGGCCATGG - Intergenic
1124783054 15:32654431-32654453 CACAAATACTAGCTGGGCTATGG - Intronic
1127857729 15:62966552-62966574 CTCAGAGGCAGGCTGGGCCATGG - Intergenic
1128219101 15:65955119-65955141 CTAGAAGCCAAGCTGGGACAGGG + Intronic
1128281940 15:66402926-66402948 CTCAAGGACCTCCTGGGCCAGGG + Intronic
1129336955 15:74858106-74858128 CTTCAAGACAAGCTGAGCCCTGG + Intronic
1129711383 15:77821935-77821957 CACAAAGCCAAGCTCGGACACGG - Intergenic
1133303723 16:4797703-4797725 CTCAAGGACAAGGTGGGCCCGGG - Exonic
1133775437 16:8891591-8891613 GTGAAAGAGAAGCTGGGTCAGGG + Intergenic
1137451494 16:48578513-48578535 CTGAAAGGCAACTTGGGCCAAGG - Intronic
1138410936 16:56839750-56839772 CTCACAGAAAAGCCAGGCCAAGG - Intronic
1139377760 16:66511077-66511099 CCCAGAGCCAAGCTGGGGCAAGG - Exonic
1140750353 16:78017924-78017946 CCCAAAGACAAGGTGGGGCAGGG + Intergenic
1141040904 16:80671438-80671460 CTGAAAGACAGGCTGGGGCCAGG - Intronic
1141098480 16:81179787-81179809 CTGAAAGACAGGATGGCCCAGGG + Intergenic
1141478754 16:84292304-84292326 CTCAAATGGAACCTGGGCCAAGG + Intergenic
1141872336 16:86795933-86795955 TTCAAAGCCATTCTGGGCCACGG + Intergenic
1142178898 16:88657734-88657756 CTCAATGACCAGCTGGGCTTGGG - Intronic
1142204499 16:88776492-88776514 CTCCAAGGGAAGCTGGGCCCCGG - Intronic
1143405091 17:6671936-6671958 CTCAAAGACAAGCAGCCACAGGG - Intergenic
1149398718 17:56271725-56271747 CTATAAGACAAGTTGGGACATGG + Intronic
1149594424 17:57855821-57855843 CTCAAAGGAAAGCTGGGCCTGGG - Intergenic
1151539702 17:74758765-74758787 CTCACCGCCAAGCTGGGGCAGGG - Intronic
1157006564 18:43590257-43590279 CCCAAGGAGGAGCTGGGCCAGGG - Intergenic
1157357168 18:46946555-46946577 CTAAAATACAAGCTGACCCAGGG - Intronic
1157556010 18:48613308-48613330 CTCAAAGTCAGACTTGGCCAGGG + Intronic
1157712953 18:49862659-49862681 CTCGAAAATAAGCTGAGCCAGGG - Intronic
1158405578 18:57156629-57156651 TACAAAGACTATCTGGGCCAAGG + Intergenic
1158499224 18:57984841-57984863 CTGAAAGACAAGCTGGTCAGGGG - Intergenic
1158654073 18:59312983-59313005 CTCAAAGACAATTTGGTCCTAGG + Intronic
1160127448 18:76189513-76189535 CTCAAAGAGGAGCTTGCCCAGGG + Intergenic
1161124938 19:2550587-2550609 CTCAGAGCCCAGCAGGGCCATGG - Intronic
1163006214 19:14398106-14398128 CTCCAAGACAAGCTCAGCCGAGG + Exonic
1163008257 19:14409586-14409608 CTCCACGAGGAGCTGGGCCAGGG + Exonic
1165225054 19:34348985-34349007 CAGAGAGAGAAGCTGGGCCAGGG - Intronic
1165460673 19:35942492-35942514 CTCACGGCCAGGCTGGGCCAAGG + Intronic
1165602982 19:37073831-37073853 CTCAAAGACAAATGGGGACACGG + Intronic
1166406680 19:42526667-42526689 CTCACAGACAAGCTCAGCCCTGG - Intronic
924965570 2:73447-73469 CACAAAGAGAGGCTGAGCCATGG + Intergenic
925866246 2:8229667-8229689 CTCAAAGACAACCTTAGCCTTGG - Intergenic
928950034 2:36806272-36806294 CTCAAAGACAAACCTGTCCAAGG - Intronic
930173547 2:48276943-48276965 CTCAAAGAAAACGTGAGCCAAGG - Intergenic
930479377 2:51927079-51927101 CTCAATGACAGGCTGTGCCTTGG + Intergenic
930722044 2:54647217-54647239 CTCCAAGACCAGCCGGGCCCTGG + Exonic
931438097 2:62266469-62266491 TTCAAAGCCATCCTGGGCCACGG + Intergenic
933715435 2:85356295-85356317 CTCACACACAGGCTGGGTCAGGG - Intronic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
936012185 2:108931977-108931999 CCAGAAGACCAGCTGGGCCATGG + Intronic
938921176 2:135996484-135996506 CTCAAAACCAAGCTGAGCAAAGG - Intergenic
943698485 2:190962630-190962652 CTCCAAGACAAGTTGGGATATGG - Intronic
945069459 2:205976452-205976474 ATCAAAAACAAGAAGGGCCATGG + Intergenic
1170842940 20:19938840-19938862 CTCAAAGAGAGGATTGGCCAAGG - Intronic
1170896564 20:20420216-20420238 CTGAAAGACAAGCTGGGCCTGGG + Intronic
1172395078 20:34597334-34597356 CTCAAAAACAAGCTGGTTGAAGG + Intronic
1172774211 20:37397809-37397831 CTGGAGGTCAAGCTGGGCCAGGG + Exonic
1174459633 20:50673316-50673338 CTCACTGACCAGCTGGGCCTGGG - Intronic
1176661992 21:9645699-9645721 CTCAAAAATTAGTTGGGCCATGG - Intergenic
1177586348 21:23101393-23101415 CTCATAGCCCAGCTTGGCCAGGG - Intergenic
1181545120 22:23598216-23598238 GTCAAGGAGAAGCTGGGTCAGGG - Intergenic
1181623706 22:24107927-24107949 CTGAAAGACAAGCTAGGGCTGGG - Intronic
1181815191 22:25431665-25431687 GTCAAGGAAAAGCTGGGTCAGGG + Intergenic
1182905238 22:33930247-33930269 TCCAAAGACAAGATGGACCATGG - Intergenic
1183432416 22:37773760-37773782 CTGAAAGACAAGGTGCGGCAGGG - Intronic
1183828837 22:40407498-40407520 CTCAAAGTCCAGCAGGGCCTTGG - Exonic
1183996416 22:41636572-41636594 TTCCAAGACATGATGGGCCACGG + Exonic
1184053284 22:42025275-42025297 TTCAAAGCCATCCTGGGCCATGG - Intronic
1184511862 22:44938575-44938597 CTCATAGAAAGGCAGGGCCAAGG + Intronic
1184527677 22:45035181-45035203 CTCAAAGACATCTTTGGCCAAGG + Intergenic
1185238121 22:49726337-49726359 CTCAAAGAGAAGCAGGTTCATGG - Intergenic
949903788 3:8841404-8841426 CTCAAAGGCAAGCAAGGTCATGG + Intronic
950806394 3:15606847-15606869 TTCAAAGCCATCCTGGGCCAAGG - Intronic
950961394 3:17111691-17111713 TCCAAACACAAGATGGGCCAGGG + Intergenic
952535395 3:34304044-34304066 CTCTAAGAAAAGCAGGGTCAGGG + Intergenic
953410052 3:42685685-42685707 CTCAAAGACATGCTGGACCATGG + Exonic
954289281 3:49640868-49640890 CTGTACAACAAGCTGGGCCAGGG + Intronic
954426028 3:50443605-50443627 TCCAAGGCCAAGCTGGGCCAGGG - Intronic
956022231 3:64945231-64945253 GACAATGTCAAGCTGGGCCATGG - Intergenic
956666826 3:71649925-71649947 CACAAAGTCTAGCTGGGGCAGGG + Intergenic
960275364 3:115722786-115722808 CTCATAGACATGCATGGCCAGGG + Intergenic
962157630 3:132965269-132965291 CTCAAAGACAAGGAGGGGCATGG + Intergenic
962853952 3:139328053-139328075 CTCAGAGAGAAGCTGGGTTATGG - Intronic
964406195 3:156351889-156351911 CTCAAAGCCAAGCGGGAGCAAGG - Intronic
966678000 3:182609995-182610017 CTCAAAGCCACTCTGGGCCTTGG + Intergenic
967075156 3:185995192-185995214 TTGAAAGACAATCTGGGCAAAGG + Intergenic
967110022 3:186284866-186284888 CTTACAGAGAGGCTGGGCCAAGG + Intronic
969372888 4:6745421-6745443 CACAAAAATTAGCTGGGCCATGG + Intergenic
969786211 4:9459265-9459287 GTCAAAGACACACAGGGCCACGG + Intergenic
974472107 4:62331703-62331725 CTCAGTGATAAGCAGGGCCATGG - Intergenic
974743719 4:66042321-66042343 CTCAAACAAAAAATGGGCCATGG + Intergenic
977381022 4:96273521-96273543 CTCACAGATATGCAGGGCCAAGG - Intergenic
980215645 4:129849749-129849771 TACAAAAATAAGCTGGGCCATGG + Intergenic
984157465 4:176209651-176209673 TTGAAAGACAAGCTGGGACAAGG - Intergenic
984514010 4:180716008-180716030 AACAAAGTCTAGCTGGGCCATGG + Intergenic
984705390 4:182843993-182844015 CTCAAAGGCAGGCAGGGACATGG + Intergenic
985413403 4:189710847-189710869 CTCAAAAATTAGTTGGGCCATGG + Intergenic
985541178 5:488477-488499 CTGGAAGACAAGCCGGGCCGCGG + Intronic
988621858 5:32831381-32831403 CCCAAAGACACGCTGAGCCCTGG + Intergenic
989133525 5:38130662-38130684 TTATGAGACAAGCTGGGCCAAGG - Intergenic
989990858 5:50764069-50764091 CTCAGAGAGAAGCTGACCCATGG - Intronic
990803159 5:59628638-59628660 CTCCAAGACAAGTAGGGCCCTGG + Intronic
991634498 5:68690685-68690707 CTCAAAGCCATCCTGGGCCACGG + Intergenic
995121119 5:108536144-108536166 CTCAGAGAAGAGTTGGGCCAGGG + Intergenic
995492958 5:112711562-112711584 ATGAAAGATAAGCTGGGCCATGG + Intronic
996676251 5:126177996-126178018 CACTAAGACAAGTTGGGCAAAGG + Intergenic
997248727 5:132372520-132372542 CCCAAAGGCCAGCTGTGCCAGGG + Intronic
997944930 5:138191704-138191726 CTGAAAGCAAAGCTGGGCCAAGG - Intronic
999055405 5:148570148-148570170 CTCAAAAAGAGGCTTGGCCAAGG + Intronic
999823265 5:155249760-155249782 CTCAAAGACAGCCTGGTCTAGGG - Intergenic
1000184219 5:158843403-158843425 CTCAAAGATGAGCTGGGGCAGGG + Intronic
1000664957 5:163983681-163983703 TTCAATGACCAGCTGGGCCGGGG - Intergenic
1001843425 5:174900909-174900931 CTGGAAGACATGCTGGGTCATGG + Intergenic
1003207520 6:4026885-4026907 AGCAAAGACAAGGTAGGCCAAGG + Intronic
1003506035 6:6740970-6740992 GTCAAAGACAGGCTGGAGCAAGG + Intergenic
1004000460 6:11592609-11592631 TTCATAGACTACCTGGGCCATGG - Intergenic
1006938351 6:37734102-37734124 CACAAATATTAGCTGGGCCATGG + Intergenic
1007400110 6:41598606-41598628 TTCAAAGAAAAGCTGGTCCTGGG - Intronic
1007647713 6:43395770-43395792 CCCAGAGCCAGGCTGGGCCAGGG + Intergenic
1011641029 6:89416183-89416205 TTCAAAGCCATCCTGGGCCATGG - Intergenic
1014389548 6:120843726-120843748 CACAAAGACAAGGTGGCCTACGG - Intergenic
1019726828 7:2607407-2607429 ACAAAGGACAAGCTGGGCCAAGG - Intronic
1022449402 7:30501038-30501060 CTTAGAGACAAGCTGGGTGATGG + Intronic
1023949191 7:44828382-44828404 CTGAAAAACAAACAGGGCCATGG + Intronic
1024345915 7:48313143-48313165 CTCAAAGACGTGCTGGGCTTTGG - Exonic
1025719748 7:63999121-63999143 CTAAAAGCCGAGCTGGGACAAGG - Intergenic
1026260666 7:68752668-68752690 CTGGAAGTCCAGCTGGGCCAGGG - Intergenic
1029111272 7:98214088-98214110 CTCAGGGCCAAGCCGGGCCAGGG + Intergenic
1029293138 7:99517890-99517912 TTCAAAGCCATCCTGGGCCACGG + Intronic
1032164168 7:129532801-129532823 ATCAAAGCAAAGCTGGGCCAAGG - Intergenic
1033956406 7:146854188-146854210 CTCCAATCCAAGCTGGACCAGGG + Intronic
1034348956 7:150404363-150404385 GTGGAACACAAGCTGGGCCACGG + Intronic
1034529287 7:151685322-151685344 CTCAAAGAGAAGCTGAGCATGGG - Intronic
1034702564 7:153109139-153109161 CTCAAAGAAAGGCTGGGTCACGG + Intergenic
1036735797 8:11314985-11315007 CTCTAAGATGATCTGGGCCAAGG - Exonic
1036748747 8:11429701-11429723 CTCAGAGGCGAGCTGGGCCCAGG + Intronic
1037280909 8:17240997-17241019 TTCAAAGCCATCCTGGGCCAAGG + Intronic
1037731390 8:21526598-21526620 CCCACAGGCAAGCTGGGCCCTGG + Intergenic
1038257796 8:25966648-25966670 CTCAAAGAGGAGATGGGCCAAGG - Intronic
1038670695 8:29580728-29580750 CTCAAAGGAAAGATGGTCCATGG - Intergenic
1039865975 8:41502233-41502255 CTCAGAGACAAACTGGGAAAGGG - Intronic
1040386920 8:46920297-46920319 CACCAGGACAAGCTGGGACAGGG + Intergenic
1042042440 8:64607010-64607032 CTGACAGACCAGCTGGGCCCTGG + Intronic
1044541912 8:93417791-93417813 CTCAAAGATAATCTGATCCATGG - Intergenic
1049176408 8:141195320-141195342 CCCATCCACAAGCTGGGCCACGG + Exonic
1049525857 8:143126672-143126694 CCCAGAAACAAGCTGGGACATGG + Intergenic
1049772662 8:144390943-144390965 CTCTACGTGAAGCTGGGCCAGGG + Exonic
1051145861 9:14026715-14026737 CTCAAATACTAGTTGTGCCATGG + Intergenic
1051390608 9:16559205-16559227 TTCAAAGCCATCCTGGGCCATGG - Intronic
1053309360 9:37006623-37006645 CTCATACCCAAGCTGGGCCATGG + Intronic
1057826552 9:98376607-98376629 CTAGAAGACAAGATGGGCCCTGG - Intronic
1059465279 9:114465470-114465492 CTCAAAGGCCACCTGTGCCATGG + Intronic
1060000002 9:119950003-119950025 CTCAAAGTCAAGCAGGGTGAGGG + Intergenic
1060490993 9:124084025-124084047 CTCAATGAAAAACTGGGCAAAGG - Intergenic
1061403045 9:130378620-130378642 CTGACAGGCAAGCTGGGCGATGG + Intronic
1061590415 9:131594250-131594272 CTCAAAGACCAGGTGAGCCAGGG - Intronic
1061932753 9:133841732-133841754 CTCAGAGACAGGCAGAGCCAGGG - Intronic
1062139764 9:134949446-134949468 CTCAAAGCCACGCTGGGGCATGG - Intergenic
1062533377 9:137011239-137011261 CCCAACTACAACCTGGGCCACGG - Exonic
1203639553 Un_KI270750v1:147542-147564 CTCAAAAATTAGTTGGGCCATGG - Intergenic
1187007716 X:15248751-15248773 CTCCAAGAAGAGCTGGGCCAAGG + Exonic
1187181105 X:16945202-16945224 TACAAAAACTAGCTGGGCCATGG - Intergenic
1195847378 X:109242742-109242764 ATCAAAGACAAGCTGCCCTAGGG + Intergenic
1196455906 X:115891454-115891476 CTCAAAGAAAGGCTGGGTCAAGG + Intergenic
1198816899 X:140600919-140600941 CTAAAAGACCAGCAGGGCCAGGG - Intergenic
1199022986 X:142904385-142904407 TTCAAAGACATCCTGGGCCGTGG + Intergenic
1200215466 X:154366271-154366293 CCCACAGACCAGCTGGGCCTTGG + Intronic
1200757890 Y:7008330-7008352 CTCAAAGACAAGCTGACCTCTGG - Intronic