ID: 1106080355

View in Genome Browser
Species Human (GRCh38)
Location 13:26495659-26495681
Sequence TAGTAGCCATGGGCCCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106080349_1106080355 16 Left 1106080349 13:26495620-26495642 CCCAACTTTCCTGTGTTCTGCAC 0: 1
1: 1
2: 0
3: 21
4: 248
Right 1106080355 13:26495659-26495681 TAGTAGCCATGGGCCCTGGTAGG 0: 1
1: 0
2: 1
3: 5
4: 121
1106080350_1106080355 15 Left 1106080350 13:26495621-26495643 CCAACTTTCCTGTGTTCTGCACT 0: 1
1: 0
2: 0
3: 32
4: 305
Right 1106080355 13:26495659-26495681 TAGTAGCCATGGGCCCTGGTAGG 0: 1
1: 0
2: 1
3: 5
4: 121
1106080346_1106080355 19 Left 1106080346 13:26495617-26495639 CCCCCCAACTTTCCTGTGTTCTG 0: 1
1: 0
2: 2
3: 24
4: 334
Right 1106080355 13:26495659-26495681 TAGTAGCCATGGGCCCTGGTAGG 0: 1
1: 0
2: 1
3: 5
4: 121
1106080348_1106080355 17 Left 1106080348 13:26495619-26495641 CCCCAACTTTCCTGTGTTCTGCA 0: 1
1: 0
2: 2
3: 25
4: 289
Right 1106080355 13:26495659-26495681 TAGTAGCCATGGGCCCTGGTAGG 0: 1
1: 0
2: 1
3: 5
4: 121
1106080351_1106080355 7 Left 1106080351 13:26495629-26495651 CCTGTGTTCTGCACTAAATTACT 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1106080355 13:26495659-26495681 TAGTAGCCATGGGCCCTGGTAGG 0: 1
1: 0
2: 1
3: 5
4: 121
1106080347_1106080355 18 Left 1106080347 13:26495618-26495640 CCCCCAACTTTCCTGTGTTCTGC 0: 1
1: 0
2: 2
3: 31
4: 313
Right 1106080355 13:26495659-26495681 TAGTAGCCATGGGCCCTGGTAGG 0: 1
1: 0
2: 1
3: 5
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106080355 Original CRISPR TAGTAGCCATGGGCCCTGGT AGG Intergenic
900636366 1:3667937-3667959 CAGTGGCCATGAGCCCTGGGGGG - Intronic
903648804 1:24910811-24910833 TTGTTGCCAAGGGCCCTGGGAGG - Intronic
904559786 1:31388704-31388726 TAATGGCCCTGTGCCCTGGTGGG - Intergenic
905804849 1:40868986-40869008 TAGTAGACTTTGGCCCAGGTGGG + Intergenic
910515403 1:88054568-88054590 TACTTGCCATGGGCCTTGGGTGG - Intergenic
913361814 1:117989426-117989448 TAGTTGCCATGAGAGCTGGTTGG - Intronic
913371314 1:118102914-118102936 TAGAAGCCATGGGCCCCTCTGGG - Intronic
919734296 1:200935892-200935914 TAGAAGCCCTGGGCCATGGTGGG - Intergenic
921769796 1:219022491-219022513 TGGTAGCCATGGGCCTGGGGTGG + Intergenic
923647578 1:235839623-235839645 TAGTAGAGATGGGGCGTGGTGGG - Intronic
1066075662 10:31873499-31873521 TAGTAGCCACTGGCCATGGGTGG - Intronic
1071472504 10:85993620-85993642 TACTAGTCATGGGCCCTGGCTGG - Intronic
1071574880 10:86717975-86717997 TGGTAGCCATGGGCCGTTCTTGG + Exonic
1072233023 10:93429055-93429077 TAGTGGAGTTGGGCCCTGGTGGG + Intronic
1073691577 10:105815000-105815022 TATTAGAGATGGGGCCTGGTGGG - Intergenic
1074016805 10:109542681-109542703 TTGAAGCCCAGGGCCCTGGTAGG + Intergenic
1074473687 10:113750370-113750392 GAGTAGCCATGTCACCTGGTGGG + Intergenic
1074634341 10:115296127-115296149 TGGTAGCAATGGGGGCTGGTGGG + Intronic
1074705657 10:116127682-116127704 TAGTCGCCATGTGCCCTGAAAGG + Intronic
1076701428 10:132275233-132275255 GAGTAGCCATGGGGCCTGGTGGG - Intronic
1077210391 11:1368449-1368471 AAGTGGCCTTGGGCCCTGGCGGG + Intergenic
1080474418 11:32576268-32576290 TTGAAACCATAGGCCCTGGTGGG + Intergenic
1084323778 11:68387670-68387692 TAGTAGCCAGGGGCCTTCCTGGG + Intronic
1090558558 11:127903514-127903536 CAGTAGAGATGGGGCCTGGTAGG + Intergenic
1094824053 12:34253706-34253728 TAGTAGCGATGGGGCCAGGCTGG + Intergenic
1097054578 12:56242000-56242022 GAGTAGCCACGGTCCCTTGTCGG + Exonic
1101343040 12:103860001-103860023 CTGAAGCCCTGGGCCCTGGTGGG + Intergenic
1101744927 12:107532237-107532259 CAGTGGCAGTGGGCCCTGGTTGG - Intronic
1104979412 12:132567100-132567122 CAGTAGCTGTGGGCCCTGCTGGG - Intronic
1105618692 13:22046009-22046031 AAGCAGCCAGGGGTCCTGGTAGG + Intergenic
1106080355 13:26495659-26495681 TAGTAGCCATGGGCCCTGGTAGG + Intergenic
1106723079 13:32455715-32455737 TAGTGGGCTTGGGCACTGGTGGG - Intronic
1106865538 13:33960124-33960146 TATTAGACGTGGGGCCTGGTGGG - Intronic
1107092179 13:36493711-36493733 AACTAGCTATGGGCCCTAGTTGG + Intergenic
1110219609 13:73059315-73059337 TTGTAGCCATGGGCACTCGGGGG - Exonic
1112161114 13:96868866-96868888 TAGTAGCCTGGGGCTCTGCTGGG + Intergenic
1113933004 13:113978253-113978275 TACTGACCATGGGCCCTGGAGGG + Exonic
1118573623 14:67219240-67219262 TGGTAGCAATGGGGGCTGGTGGG + Intronic
1118709913 14:68510507-68510529 TAGAAGCCCTGGGTCCTGTTGGG + Intronic
1119033871 14:71213699-71213721 TAGTAGCCATGGGAGCTACTGGG - Intergenic
1119940851 14:78639597-78639619 TGGTAGACAAGAGCCCTGGTAGG - Intronic
1120656827 14:87200497-87200519 TAGAAGCCATGGGTGCTGCTAGG + Intergenic
1121517401 14:94561688-94561710 TAGGGTCCATGGGCACTGGTGGG + Intronic
1122888515 14:104722234-104722256 AAATAGCCACGGGCCCGGGTAGG - Intronic
1125657211 15:41367722-41367744 CAGTAGCAATGGGGGCTGGTGGG + Intronic
1133162172 16:3919389-3919411 TTGTAGCCATGGTCACGGGTTGG - Intergenic
1134236039 16:12467214-12467236 TACTGGCCATGGACCATGGTTGG - Intronic
1136025312 16:27464762-27464784 TGGTAGCCATGGGCTCTGCCTGG - Exonic
1138095262 16:54206458-54206480 TAGAAGGCATGTGCCCTGATAGG + Intergenic
1141776685 16:86127786-86127808 TGGTAGCCCTGGGCCCCGCTTGG + Intergenic
1142231946 16:88904077-88904099 TGGTGGCCATGAGCCCTTGTTGG - Intronic
1143456447 17:7070950-7070972 TGGTAGCCATGGGCAGAGGTTGG + Intergenic
1143594841 17:7907828-7907850 TAGTAGTCTTGGGACCTGGGAGG + Intronic
1148845684 17:50528572-50528594 CAATAGCCTTGAGCCCTGGTAGG - Intronic
1149779130 17:59382307-59382329 AAGAAGCCATGGGCCCTTGGAGG + Intronic
1150327394 17:64268144-64268166 GAGTAGCCCTGGGCCAGGGTAGG + Intergenic
1151379720 17:73717408-73717430 TAGTTGCCACGGGCTGTGGTGGG + Intergenic
1154058509 18:11035197-11035219 TATTGGACATGGGGCCTGGTGGG + Intronic
1154294690 18:13137801-13137823 TATTAGCCCTGGGGCCTTGTAGG + Intergenic
1155443388 18:25885045-25885067 TACTTGCCATGGGCCTTGGGTGG + Intergenic
1156560086 18:38115148-38115170 TGGCAGCCATGGGCCGTGGCAGG - Intergenic
1160811213 19:1013743-1013765 TGGTGGCCTTGGGCACTGGTGGG - Intronic
1167236673 19:48319891-48319913 TAGAAGCCATGGACACTGCTTGG + Exonic
1168173386 19:54606263-54606285 TGGTGGCCATGGGCCTGGGTCGG + Intronic
1168478614 19:56697825-56697847 TAGTAGGCATGGTGCCTGATAGG + Intergenic
926269893 2:11357458-11357480 TGGGAGCCATGGGCCCTGTCGGG - Intergenic
930268222 2:49224851-49224873 TGGTGGCCAAGGGCCCTGGCAGG - Intergenic
938188602 2:129254966-129254988 TAGTAGCCAAGTACCCAGGTGGG - Intergenic
940472392 2:154115567-154115589 AAGTAGCCATGTGTCATGGTGGG - Intronic
948180233 2:235973664-235973686 TGGTAACCATGGGACCTGATGGG + Intronic
948972979 2:241443551-241443573 CAGGTGCCATGGGCCCTGCTGGG + Intronic
1169906453 20:10609557-10609579 CAGTAGCCCTGGGCACTGATGGG - Intronic
1170825716 20:19793354-19793376 TAGCAGCCACGGGCCCTGTGTGG - Intergenic
1173196590 20:40919101-40919123 TAGTAGCCATGTTCTCTGGGTGG + Intergenic
1175707159 20:61188245-61188267 TAGTTGCCATGGCCCCTGCTCGG + Intergenic
1177347726 21:19895249-19895271 TGTTAGAGATGGGCCCTGGTGGG - Intergenic
1179380671 21:40896207-40896229 TACTGGACATGGGGCCTGGTTGG + Intergenic
1182671578 22:32000614-32000636 TAGTAGCCAAGGGGCAGGGTGGG + Intergenic
1183900604 22:41003110-41003132 TGGGAGCCTTGGGCCCTGATGGG + Intergenic
1184507922 22:44915489-44915511 GAGTTGTCATGGGCCATGGTGGG - Intronic
1184841347 22:47054137-47054159 TAGCAGCCATGGGTGCTGGGGGG - Intronic
954686909 3:52376034-52376056 GAGGAGCCCTGGGCTCTGGTTGG + Intronic
954750528 3:52811017-52811039 TAGTAGCCATGTGAACAGGTTGG + Intergenic
957388710 3:79533095-79533117 TAGTAGGCTTGAGCCCTGGAGGG + Intronic
957976125 3:87447543-87447565 TAGTTGCCATGGGCCTGGGGTGG - Intergenic
962476996 3:135763560-135763582 GGGCAGCCATGGGCCATGGTGGG - Intergenic
963433870 3:145243026-145243048 TAATAACCATGGGTCATGGTAGG - Intergenic
964499776 3:157335922-157335944 TGGTAGCCATGGTGCCTAGTGGG - Intronic
968787112 4:2630882-2630904 GAGCACCCATGGGCCCTGGTGGG + Intronic
983788017 4:171759156-171759178 TTGAAACCCTGGGCCCTGGTGGG - Intergenic
984717075 4:182935902-182935924 TAGAAACCAGGTGCCCTGGTTGG + Intergenic
986802901 5:11279961-11279983 TATTAGAGATGGGGCCTGGTGGG - Intronic
993028994 5:82681828-82681850 TAGTTGCCATGGCTCCTGGGTGG - Intergenic
994737457 5:103572595-103572617 TGATATCCAAGGGCCCTGGTAGG + Intergenic
995588567 5:113674549-113674571 TGGTAGCTATGGTCCCTGGCTGG + Intergenic
1001324563 5:170712632-170712654 TGGGAGCCATGGGCACTGGGAGG + Intronic
1005071934 6:21869997-21870019 TATTAGCAATGGGCCTAGGTAGG - Intergenic
1010201282 6:73284368-73284390 CAGGAGTCATGGGCCCCGGTAGG - Intronic
1011945983 6:92903883-92903905 CAGTATCCATGGGACATGGTAGG + Intergenic
1012188889 6:96256377-96256399 TAGGAGCTATGGACACTGGTAGG - Intergenic
1013091935 6:106908057-106908079 ATGTAGCAATGGGCCATGGTGGG + Intergenic
1013846546 6:114459664-114459686 AAGTCCCCATGGGCCATGGTTGG + Intergenic
1015793714 6:136989701-136989723 TAGTCACCATGGCCCCTGGTTGG - Intergenic
1017728244 6:157290993-157291015 AAGGAGCCAGGGGCCATGGTGGG - Exonic
1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG + Exonic
1019460313 7:1154770-1154792 TCCTAGTCATGGGTCCTGGTTGG - Intronic
1019912351 7:4108212-4108234 CAGCTGCCATGGGCCCTGATGGG + Intronic
1021655573 7:22870425-22870447 TAGTTTCCTTGGGCCTTGGTGGG + Intergenic
1023148290 7:37174642-37174664 TTGTACCCATGGGACCTAGTGGG - Intronic
1025158107 7:56628630-56628652 GAGGAACCATGGGCCCTGGGTGG - Intergenic
1026524390 7:71141622-71141644 GAGCAGCCCTGGGCCATGGTAGG + Intronic
1026534801 7:71230697-71230719 TAGGAGCCATGGACCCTGCCCGG + Intronic
1032092724 7:128919412-128919434 TAGAAGCCATCGGCACTGGGAGG + Intergenic
1035249729 7:157589119-157589141 TAGTAGCCAGGGGCTCAGGGAGG - Intronic
1044949151 8:97418613-97418635 AAGTTCCCATGTGCCCTGGTTGG + Intergenic
1045657621 8:104403307-104403329 TAGAAGCCATGGGTCATGGAAGG - Intronic
1047982762 8:130200051-130200073 CAGTAGCCCAAGGCCCTGGTAGG - Intronic
1049689126 8:143951076-143951098 TTGGAGCCGTGGGGCCTGGTGGG - Intronic
1049870314 8:144970040-144970062 TAGGAGCAAAGGGTCCTGGTTGG - Intergenic
1053129625 9:35607595-35607617 AAGGAGCCATTGGCCGTGGTGGG + Exonic
1057565007 9:96159920-96159942 TAGTGGCCAGAGGCCCTGGAGGG - Intergenic
1062226947 9:135457636-135457658 GAGGAGCCAGGGTCCCTGGTAGG + Intergenic
1062246903 9:135573761-135573783 AAGTAGCCATGGGTGGTGGTGGG - Intergenic
1189085319 X:38017142-38017164 TTGTAGCAATGGGCATTGGTTGG - Intronic
1193075148 X:77347506-77347528 TTGAAACCCTGGGCCCTGGTGGG - Intergenic
1193366212 X:80637205-80637227 TATTTGCCATGGGCCTGGGTTGG - Intergenic
1193554851 X:82940936-82940958 TGTTAGACATGGGGCCTGGTGGG - Intergenic
1199666232 X:150098598-150098620 TATTAGCCATGGACCCAAGTAGG + Intergenic