ID: 1106081094

View in Genome Browser
Species Human (GRCh38)
Location 13:26500864-26500886
Sequence GCTCCTTCTCTCCAGGCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 180}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106081094_1106081102 3 Left 1106081094 13:26500864-26500886 CCCTTAGCCTGGAGAGAAGGAGC 0: 1
1: 0
2: 4
3: 16
4: 180
Right 1106081102 13:26500890-26500912 CCCTGGGCGAGGACAGAACCTGG 0: 1
1: 0
2: 3
3: 19
4: 215
1106081094_1106081099 -8 Left 1106081094 13:26500864-26500886 CCCTTAGCCTGGAGAGAAGGAGC 0: 1
1: 0
2: 4
3: 16
4: 180
Right 1106081099 13:26500879-26500901 GAAGGAGCCAGCCCTGGGCGAGG 0: 1
1: 0
2: 0
3: 69
4: 538
1106081094_1106081107 18 Left 1106081094 13:26500864-26500886 CCCTTAGCCTGGAGAGAAGGAGC 0: 1
1: 0
2: 4
3: 16
4: 180
Right 1106081107 13:26500905-26500927 GAACCTGGATAGCGGCTGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 108
1106081094_1106081105 14 Left 1106081094 13:26500864-26500886 CCCTTAGCCTGGAGAGAAGGAGC 0: 1
1: 0
2: 4
3: 16
4: 180
Right 1106081105 13:26500901-26500923 GACAGAACCTGGATAGCGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 92
1106081094_1106081108 19 Left 1106081094 13:26500864-26500886 CCCTTAGCCTGGAGAGAAGGAGC 0: 1
1: 0
2: 4
3: 16
4: 180
Right 1106081108 13:26500906-26500928 AACCTGGATAGCGGCTGGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1106081094_1106081106 15 Left 1106081094 13:26500864-26500886 CCCTTAGCCTGGAGAGAAGGAGC 0: 1
1: 0
2: 4
3: 16
4: 180
Right 1106081106 13:26500902-26500924 ACAGAACCTGGATAGCGGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 62
1106081094_1106081109 20 Left 1106081094 13:26500864-26500886 CCCTTAGCCTGGAGAGAAGGAGC 0: 1
1: 0
2: 4
3: 16
4: 180
Right 1106081109 13:26500907-26500929 ACCTGGATAGCGGCTGGGTGGGG 0: 1
1: 0
2: 1
3: 27
4: 301
1106081094_1106081104 10 Left 1106081094 13:26500864-26500886 CCCTTAGCCTGGAGAGAAGGAGC 0: 1
1: 0
2: 4
3: 16
4: 180
Right 1106081104 13:26500897-26500919 CGAGGACAGAACCTGGATAGCGG 0: 1
1: 0
2: 0
3: 10
4: 112
1106081094_1106081111 26 Left 1106081094 13:26500864-26500886 CCCTTAGCCTGGAGAGAAGGAGC 0: 1
1: 0
2: 4
3: 16
4: 180
Right 1106081111 13:26500913-26500935 ATAGCGGCTGGGTGGGGTCCTGG 0: 1
1: 0
2: 1
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106081094 Original CRISPR GCTCCTTCTCTCCAGGCTAA GGG (reversed) Intergenic
900412020 1:2516826-2516848 GCTCCTTCTATCCTGACAAATGG + Intronic
901152544 1:7113435-7113457 GATCCTTCTCTCCAGACCAAGGG - Intronic
901294207 1:8147894-8147916 GCTTCTTGTCTCCTGGCCAAGGG - Intergenic
903596809 1:24501894-24501916 CTTCCTTCTCTGCCGGCTAAGGG + Intergenic
904345445 1:29865268-29865290 GCCCCTCCTCTCCAGGCTGCAGG - Intergenic
905017578 1:34788130-34788152 GCCCCTTTTCTCCAGGCTGTGGG + Intronic
905313258 1:37065204-37065226 GCACCTGCTCGCCAGGCTCAGGG - Intergenic
906281024 1:44553958-44553980 GCTCCTTCTCTGCCAGCCAAGGG - Intronic
907339980 1:53727987-53728009 GCTCCTCCTTTACAGGCTACAGG + Intronic
911209019 1:95120119-95120141 TCTTCTTCTCTCAAGGCAAATGG - Intronic
915446543 1:155977804-155977826 GCTCCTCCTCTCCTCGCAAATGG - Intronic
920125077 1:203687963-203687985 TCTCCCTCTCTCCAGGCTAAAGG - Intronic
924362369 1:243255040-243255062 GGTCCCTCTCTCCACGGTAAGGG - Exonic
1063038996 10:2317692-2317714 GCTCATCCTGTCCAGGCTGAAGG + Intergenic
1063187432 10:3663862-3663884 GCTCCCTCTCTGCAGGGTCAGGG + Intergenic
1065117450 10:22496689-22496711 GCCCCTCCTCTCCAGTCTCATGG + Intergenic
1065377208 10:25055375-25055397 GCACCTTCCCTCCTGGCTAAAGG + Intronic
1066117573 10:32253972-32253994 CCTCCTCCTCTGCAGGGTAAAGG - Intergenic
1066449097 10:35511840-35511862 TCTCCATCTCTCCAGGTTCACGG - Intronic
1067055673 10:43048502-43048524 GCTCCTTCTCTCCTGGCTGGAGG + Intergenic
1068800858 10:61138277-61138299 TCTCCCTGTCTCCAGGCTCAAGG - Intergenic
1070540556 10:77412459-77412481 GCTCCTTCTCTCCTACCAAAGGG + Intronic
1070761755 10:79028370-79028392 ACTGCTACTCTCCAAGCTAAGGG + Intergenic
1071422613 10:85515769-85515791 TCTGCTTCACTCCAGGCAAAGGG + Intergenic
1074183821 10:111084699-111084721 TCTCCTTCTGTCCAGGCCATGGG + Intergenic
1074195804 10:111183731-111183753 GCTCCTTGTCTCTGGGCTACAGG + Intergenic
1076567706 10:131410272-131410294 GCGCCTTCTCTCCAGCTGAAGGG + Intergenic
1077261125 11:1621638-1621660 GCTGCTTCTCTTCAGGCTGTGGG - Exonic
1077466597 11:2736477-2736499 GCACCTTCTCTCCAGGCACGGGG - Intronic
1080041691 11:27765964-27765986 TCTTCTCTTCTCCAGGCTAAAGG + Intergenic
1080637805 11:34139058-34139080 TCTCCTTCTTTCCAGGCTGGGGG - Intronic
1081708267 11:45199481-45199503 CCTCTTCTTCTCCAGGCTAAGGG + Intronic
1082050599 11:47767480-47767502 GCTCCTCCTCACCAGGAGAAAGG + Intergenic
1083398103 11:62405156-62405178 CCTCCTTACCTCCAGGGTAAGGG - Intronic
1085197448 11:74681136-74681158 GCCCCTGCTTTCCAGGCTAATGG - Intergenic
1088707262 11:112474967-112474989 GCTGCTTTTCTCCATGCTTAGGG + Intergenic
1089183533 11:116599091-116599113 GCTCCTCTTTTCCAGGCAAAAGG + Intergenic
1090427555 11:126619297-126619319 GATTGTTCTCTCCAGGCTATTGG - Intronic
1091239319 11:134041990-134042012 TCTCCCTCTCTCCCGGCTAGAGG - Intergenic
1092618718 12:10239324-10239346 GCTTCTTCTGTCCAGGCAAAAGG + Intergenic
1095990494 12:48030986-48031008 GGGCCTTCTCTCCAATCTAATGG + Intergenic
1096487067 12:51990396-51990418 CCTCCACCTCTCCAGGCTCAGGG + Intronic
1096871902 12:54598077-54598099 GCTCCTTCTCTCCTGTCCCAGGG - Intergenic
1096939410 12:55325762-55325784 GCTGCTTCTGATCAGGCTAAAGG + Intergenic
1098185144 12:67888894-67888916 ACTCCTTCTCCCCATGCTCAGGG - Intergenic
1098768746 12:74524853-74524875 TTTCCTTCACTCCAGGCTTAAGG + Intergenic
1099367869 12:81791891-81791913 AATCATTGTCTCCAGGCTAATGG + Intergenic
1103731891 12:123033265-123033287 GCAGCTTCCCTCCAGGCTGAGGG - Intronic
1103905868 12:124326946-124326968 GCTCCTCCCCACCAGGCTAAGGG + Intronic
1103919621 12:124392719-124392741 GGTCCTGCTCTCCAGGCTCCAGG + Intronic
1104250745 12:127091088-127091110 TCTCCTTCTCTCCAGGCCTCTGG - Intergenic
1106030508 13:25998123-25998145 GCTCCTGCTCTCCAGGTGCAGGG + Intronic
1106081094 13:26500864-26500886 GCTCCTTCTCTCCAGGCTAAGGG - Intergenic
1106132613 13:26952472-26952494 GCCCCTTCTCTCCAGGGCCACGG - Intergenic
1106817545 13:33425434-33425456 GCTCTTTCTCTCTAAGCCAATGG + Intergenic
1113802561 13:113094195-113094217 GCTGCTTCCCTCCTGGCTGAGGG + Intronic
1116085401 14:40231017-40231039 GCTCCTGCTCTCCAAGCTGTGGG - Intergenic
1117581618 14:57157204-57157226 CCTCCTTCTCTCCCAGTTAAGGG + Intergenic
1119438667 14:74613552-74613574 GCTCCCTCCCTACAGCCTAAAGG + Intergenic
1120108102 14:80519459-80519481 GTTCCTTCTCTCCAGGGGAAGGG - Intronic
1120824390 14:88942402-88942424 GCTCCATTTCTCCAAGCAAAAGG - Intergenic
1122166272 14:99826584-99826606 GCTCATTCTCACCAGGCCCATGG - Intronic
1122339560 14:101019420-101019442 CCGACTTCTCTTCAGGCTAAGGG - Intergenic
1123885188 15:24719122-24719144 GGACCTTCTCTCCCAGCTAAGGG - Intergenic
1129718684 15:77866147-77866169 GCTCCATCGCTCCATGCTCATGG + Intergenic
1130027969 15:80286159-80286181 GCCCCTTCTCTCCAGGCACATGG + Intergenic
1130460240 15:84154719-84154741 GCTCCATCACTCCATGCTCACGG - Intergenic
1131796288 15:96020306-96020328 GCTTCTTCACCACAGGCTAAAGG + Intergenic
1133311821 16:4853148-4853170 GTACCTTATCTCCAGGCTGAAGG - Exonic
1137523890 16:49216814-49216836 CCTCCTTCTCTTCAGGCTCCTGG - Intergenic
1137636260 16:49989216-49989238 TTTCCTTCTCTCCAGTCTAAGGG - Intergenic
1137687933 16:50399710-50399732 GCACCTCATCTCCAGGCTCAGGG + Intergenic
1138504866 16:57473263-57473285 GCTCCCTTTCTCCAGGCTCTTGG + Exonic
1140664026 16:77212559-77212581 GCCCCTTCTCCGCAGGCTGAAGG + Exonic
1141142922 16:81509013-81509035 GCTGCTGCTCTTAAGGCTAAGGG - Intronic
1143045336 17:4074192-4074214 GCTCCTCGTCTCCCGGCTGATGG - Exonic
1143274870 17:5703015-5703037 GCTCCTTCTATCCATGTAAATGG + Intergenic
1143708154 17:8714882-8714904 GCTTGTTCTCTCCAGCCTCATGG - Intergenic
1146249396 17:31325223-31325245 GCTCCTTCTCTTCAGTCTTTTGG + Intronic
1148102019 17:45098067-45098089 GCTGCTTCCCTGCATGCTAAAGG + Intronic
1150480273 17:65503828-65503850 GTTCCTGCTCTCCAGGCTCCTGG - Intergenic
1151209434 17:72533338-72533360 GCCACTTCTCTTCAGGCCAAAGG - Intergenic
1152738980 17:82010928-82010950 GCTCCTTCCTTCCAGGCCACAGG + Intronic
1153352123 18:4092640-4092662 GCTCCTTCTCTATCGGCTTAAGG + Intronic
1156638850 18:39065456-39065478 GCTTCTTCTTTCCAGGCTGCTGG + Intergenic
1156899893 18:42288308-42288330 TCTCCTTCTCACCAGCCTACAGG + Intergenic
1157888396 18:51390844-51390866 TCTACTTCTCTCCTGGCAAATGG - Intergenic
1161258310 19:3321902-3321924 GGGCTTTCTCTCCAGGGTAATGG + Intergenic
1161701690 19:5799408-5799430 GCTCCTTATCTCCTGGCTTCAGG + Intergenic
1161826058 19:6566538-6566560 GCCCCTTCCCTCTAGGCTCAGGG + Intergenic
1161842696 19:6692561-6692583 CCTCCTTCTCTCCATCCTTATGG - Intronic
1162105691 19:8368385-8368407 GCTCCTTGTCCCCAGCCTCATGG + Intronic
1164974013 19:32557986-32558008 ACTCCTTCCCTTCAGGCAAAAGG + Intergenic
1167660642 19:50794119-50794141 CCTCCCTCTTTCCAGACTAATGG - Intronic
926580584 2:14629790-14629812 TCTCCTTTGCCCCAGGCTAAAGG - Intergenic
927289987 2:21395743-21395765 GCTGCCTCTCTCCAGCCAAAAGG - Intergenic
927862446 2:26568532-26568554 CCTCCTTCTCTCCAGAAGAAAGG + Intronic
928077563 2:28279087-28279109 GCTCCTTCTCATCATGCTGAAGG - Intronic
928089474 2:28365253-28365275 CCTCCCTCTCTCCAGGCTCCTGG - Intergenic
932275546 2:70449544-70449566 GCTCCTTCTCTTGAGGGGAAAGG + Exonic
934044395 2:88160419-88160441 TCTCCTGCTCTCCAGACTATGGG + Intergenic
934736957 2:96694356-96694378 GCTGCTTCTCTCCAAGCTTCTGG - Intergenic
936328030 2:111522387-111522409 GCCCCGTGTCTCCAGGCCAAAGG + Intergenic
937209845 2:120261357-120261379 TCTCCTTGTCTCCAGCCTCATGG - Intronic
937955281 2:127418685-127418707 CCTCCCTCTTTCCAGGCCAAGGG + Intronic
938754319 2:134365671-134365693 TCTCTTTCTCTCCAGGCTGCAGG - Intronic
939045207 2:137241866-137241888 GCCACTGCACTCCAGGCTAAGGG + Intronic
939902590 2:147868332-147868354 ACTTCTTCTCTCCTGTCTAAAGG - Intronic
941164728 2:162073327-162073349 GCTCCGTCTTACCACGCTAAGGG - Intronic
943346061 2:186738163-186738185 GCTCCCACTCTCCAAGCTATGGG - Intronic
943751307 2:191512422-191512444 GCGCTTTCTCTCCAGGGTTATGG - Intergenic
944198010 2:197075604-197075626 GCTATTTCTATCAAGGCTAAGGG + Intronic
945037570 2:205717178-205717200 GCTTGTTATCTCGAGGCTAAGGG + Intronic
946251738 2:218418281-218418303 GCTCCTCCTCTCCACCCTTAGGG - Intergenic
946962758 2:225002011-225002033 GCTCCCTCTCTCTTGGCTATGGG - Intronic
948071521 2:235131608-235131630 GCTCCTTCTGCCCAGGCTGTAGG - Intergenic
948681934 2:239640989-239641011 ACTCCATCTCTCCAGGGTCAGGG + Intergenic
949032088 2:241802107-241802129 ACTCCTTCTCTCCAGCCTCCAGG - Intronic
1172012418 20:31853192-31853214 GTTCCTGCTCTCAAGCCTAATGG + Intronic
1173103580 20:40110367-40110389 GATCCTTCTCACCAGGGTATGGG - Intergenic
1173165936 20:40687581-40687603 GTAACTTCTCTCCAGGCTGAAGG - Exonic
1173688341 20:44939599-44939621 GCTGCTTCTCGGCTGGCTAAGGG + Intronic
1174296401 20:49548380-49548402 CCGCCTTCTCTCCTGGCTACTGG - Intronic
1175883581 20:62274701-62274723 GCTCCTTCTCCCCAGGCAGGCGG - Intronic
1180106447 21:45621900-45621922 GCTGCTTGTCTCCAGGCTGTGGG + Intergenic
1181518608 22:23432683-23432705 GCTCCTTCTCTGGAGGCTAAGGG - Intergenic
1182089826 22:27586553-27586575 GGTCATTGTTTCCAGGCTAATGG - Intergenic
1184867958 22:47213640-47213662 TCTCCTTCCCTCCAGGCTTGGGG + Intergenic
1185186952 22:49407008-49407030 GCACCTCCTCTCCTGGCTCAGGG - Intergenic
950549914 3:13660055-13660077 GCTGCTTCTCTCCAATCTCATGG - Intergenic
951392994 3:22130052-22130074 GGTCCTTCTCTTCAGGCCATTGG + Intronic
954034837 3:47845898-47845920 CCTCCATCTCTCCAGACTGAAGG + Intronic
954792673 3:53144678-53144700 GCTCCTTATCCCCAGGCAGAAGG - Intergenic
957951767 3:87136390-87136412 ACTCCTTCTCATCAGGCTATTGG + Intergenic
961789880 3:129368051-129368073 GGTGCTTCTGTCCAGGATAATGG + Intergenic
963591566 3:147267284-147267306 GCACCTTGTCTACAGGCTAAAGG - Intergenic
965096643 3:164237020-164237042 GCTCCTGCTCTCCAGGCTGAAGG - Intergenic
965980361 3:174682108-174682130 CCCCCTTCTCTCCAGGCAGAGGG - Intronic
967073036 3:185978761-185978783 TCTCCTTCTCACCTGGCTGATGG - Intergenic
969355293 4:6621392-6621414 GCTGCTCATCTGCAGGCTAATGG + Exonic
969878817 4:10156244-10156266 GCCCATTCTCTCCAGTCCAAAGG - Intergenic
970709612 4:18846533-18846555 ACTCCATCTCTCCAGGGAAATGG - Intergenic
970838999 4:20444479-20444501 ATTCCTTGTCTCCAGGCTTAGGG + Intronic
972845732 4:42986869-42986891 GCTTCTTCTTTCCAGGCTTAGGG - Intronic
978390037 4:108215706-108215728 CATCCTTCTCTCCATTCTAACGG - Intergenic
979678723 4:123436086-123436108 GTTCCTTCTCGCCACGCTACCGG - Intergenic
983437913 4:167739553-167739575 GCTGCCTCTCTCAAGGCTTAAGG - Intergenic
991902624 5:71475818-71475840 TCTCCTTCTTTCAAGGCAAAGGG - Intronic
992665684 5:79006792-79006814 GCTGCTTCTCTGGAGGTTAAGGG - Intronic
993181858 5:84563392-84563414 TCTCCTGCTCTCTAGGTTAAGGG + Intergenic
997264560 5:132487531-132487553 GCTCCATCTCTCAAGGATAAAGG + Intronic
1000500100 5:162037202-162037224 TCTCCTTCTCTCCATGTTCAGGG - Intergenic
1001419846 5:171578283-171578305 GTTCTTTCTGGCCAGGCTAAGGG + Intergenic
1001735232 5:173992371-173992393 ACTCTGTCTCTCCAGGCTGAAGG - Intronic
1004434584 6:15578096-15578118 CTTCCTTCTCTCCTGCCTAAGGG - Intronic
1004549749 6:16635464-16635486 GCTCCTTCTCTCTAGACCAGTGG - Intronic
1007260947 6:40562629-40562651 GCTGCTTCTCTGGCGGCTAAGGG - Intronic
1007591218 6:43021839-43021861 GCACCGTCTCTGCAGGCTCAGGG - Intronic
1009040542 6:58171051-58171073 TTTCCTTCTCTCCAGGATCATGG - Intergenic
1009216399 6:60925581-60925603 TTTCCTTCTCTCCAGGATCATGG - Intergenic
1011545905 6:88481047-88481069 GCCCTTTCTCTCAAGGCTGATGG + Intergenic
1012264109 6:97120208-97120230 TCTCCTTCCCTCCAGGCTTAAGG - Intronic
1013233115 6:108174777-108174799 GCTCCGGGTCTCCAGCCTAAAGG + Intronic
1014994560 6:128125648-128125670 GCTACTGCACTCCAGCCTAAGGG - Intronic
1018107157 6:160499974-160499996 GCTCCATCTCTCCACTCTTAGGG + Intergenic
1019599952 7:1876261-1876283 GCTCCTTCTCTGGAGGCTAAGGG + Intronic
1020502821 7:8944386-8944408 GCACCTTCTCTGCAGCCTCATGG + Intergenic
1021839776 7:24713263-24713285 GCTCCTTTCCTCCAGGCAGAGGG + Intronic
1024554470 7:50591723-50591745 GCTCCTCCTCTGCTGGCTTAGGG - Exonic
1027265976 7:76495483-76495505 CCTCCTCCTCTCCAGGCTTCTGG + Intronic
1027317350 7:76993600-76993622 CCTCCTCCTCTCCAGGCTTCTGG + Intergenic
1033156103 7:138958308-138958330 GCTCATTCTCTCCTGACCAAGGG + Intronic
1036295395 8:7530764-7530786 GCACCCTCTCTCTAGGCTCAGGG - Intergenic
1036327174 8:7790255-7790277 GCACCCTCTCTCTAGGCTCAGGG + Intergenic
1036739759 8:11349192-11349214 GCTCCTTCCTTCCAGCCTCAGGG - Intergenic
1036776710 8:11617819-11617841 GCTCCTGATATCCAGGCTGATGG + Intergenic
1037292494 8:17366177-17366199 GCTCCTTCTCTCCCATATAAAGG + Intronic
1038143868 8:24875710-24875732 CTTCCTCCTCTCCAGGCTCAGGG - Intergenic
1038309481 8:26435298-26435320 GCTGCTTCTCTGCAAGCCAAGGG + Intronic
1041606893 8:59792615-59792637 GTTCCTTCTCTTCAAGATAAGGG - Intergenic
1042013842 8:64284501-64284523 GCTCCTTCCCTCCAGGTACAGGG - Intergenic
1043385435 8:79743428-79743450 ACTCCTCCCCTCCAGGCTGAGGG - Intergenic
1048001042 8:130379922-130379944 GCTCCTTGTCCTCAGGCTCAAGG + Intronic
1048348097 8:133593276-133593298 GTTCCTTCAGTCCAAGCTAACGG - Intergenic
1048591938 8:135828343-135828365 GCTCATTCCCTCCAGGCTCATGG + Intergenic
1049470535 8:142773313-142773335 GGTCCTGCTCTCCAGGCTTAGGG + Intronic
1049662383 8:143825313-143825335 GCTCCTCCTCTGGAGGCTGAAGG - Intronic
1050590366 9:7154137-7154159 CCCCCTTCTCCCCAGTCTAATGG - Intergenic
1051100150 9:13512315-13512337 GATCCTTCTCTCCAGTACAATGG - Intergenic
1060690446 9:125653474-125653496 GCTCCTTTCCTCCAGGCAGAGGG + Intronic
1188694973 X:33178987-33179009 GCTCCTTATTTAAAGGCTAAAGG - Intronic
1192166867 X:68831981-68832003 CCTCCTTCCATCCAGGCTCAGGG + Intronic
1196759297 X:119186951-119186973 GCTCCTGCTCTCCTGGCTCAAGG + Intergenic
1198118326 X:133566276-133566298 GCTCCTGTTCTCCAGACAAATGG - Intronic
1198416226 X:136422446-136422468 TCTCCACCTCACCAGGCTAATGG + Intergenic
1198706304 X:139452202-139452224 GCACATTCTCTACAAGCTAAAGG - Intergenic
1200014003 X:153145262-153145284 TCTTCTTCTCTCCAGGAAAAAGG - Intergenic
1200025597 X:153254691-153254713 TCTTCTTCTCTCCAGGAAAAAGG + Intergenic
1201099966 Y:10663999-10664021 GCCACTTCTCTCCAGCCTGAGGG - Intergenic
1202316389 Y:23582912-23582934 GCTCCTTCTCTTCATGGTATAGG + Intergenic
1202554375 Y:26087146-26087168 GCTCCTTCTCTTCATGGTATAGG - Intergenic