ID: 1106087722

View in Genome Browser
Species Human (GRCh38)
Location 13:26558033-26558055
Sequence CGAGAAGCCCCTGCCAGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 155}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106087722_1106087726 -4 Left 1106087722 13:26558033-26558055 CCCGCGCTGGCAGGGGCTTCTCG 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1106087726 13:26558052-26558074 CTCGCCGTCACGGCGCGGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1106087722_1106087732 22 Left 1106087722 13:26558033-26558055 CCCGCGCTGGCAGGGGCTTCTCG 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1106087732 13:26558078-26558100 CCCTTCTCTCCCGCGCCTCCGGG 0: 1
1: 0
2: 4
3: 38
4: 320
1106087722_1106087734 29 Left 1106087722 13:26558033-26558055 CCCGCGCTGGCAGGGGCTTCTCG 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1106087734 13:26558085-26558107 CTCCCGCGCCTCCGGGCCTCCGG 0: 1
1: 0
2: 1
3: 20
4: 239
1106087722_1106087727 -1 Left 1106087722 13:26558033-26558055 CCCGCGCTGGCAGGGGCTTCTCG 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1106087727 13:26558055-26558077 GCCGTCACGGCGCGGCCAGGCGG 0: 1
1: 0
2: 1
3: 7
4: 91
1106087722_1106087725 -9 Left 1106087722 13:26558033-26558055 CCCGCGCTGGCAGGGGCTTCTCG 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1106087725 13:26558047-26558069 GGCTTCTCGCCGTCACGGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 36
1106087722_1106087730 21 Left 1106087722 13:26558033-26558055 CCCGCGCTGGCAGGGGCTTCTCG 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1106087730 13:26558077-26558099 GCCCTTCTCTCCCGCGCCTCCGG 0: 1
1: 0
2: 1
3: 9
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106087722 Original CRISPR CGAGAAGCCCCTGCCAGCGC GGG (reversed) Intronic
900639514 1:3682055-3682077 TGAGAAGCTCCTGCCTGCCCAGG + Intronic
901125843 1:6928094-6928116 GAAGATGCCCCTTCCAGCGCTGG - Intronic
902549458 1:17210756-17210778 CCAGCAGCCCCAGCCAGCCCCGG + Intronic
903365063 1:22801188-22801210 GGTGAAGCCCCTGCCAAGGCTGG + Intronic
904011442 1:27392640-27392662 CGAGAAGCCCCCGCGGCCGCGGG - Exonic
904839862 1:33365433-33365455 TGAGAACCCCCTTCCAGCCCAGG - Intronic
905319561 1:37106233-37106255 GGAGAAGCCGCTGTCAGCTCGGG + Intergenic
905897433 1:41557882-41557904 CGAGAACCCCCACCCAGCGAGGG + Intronic
909958088 1:81802382-81802404 CGAGCAGCCCGAGCGAGCGCGGG - Intronic
910374507 1:86553551-86553573 GGAGGAGCGCCCGCCAGCGCGGG + Intronic
910777876 1:90893821-90893843 CGGGAAGCCAGTGCTAGCGCTGG - Intergenic
913552075 1:119925658-119925680 CCAGTAGCCCCTGCCAGCACGGG - Exonic
917817639 1:178725975-178725997 CGAGCGGCCCCCGCCAGCCCCGG + Intronic
922116422 1:222618187-222618209 CGAGAACCGCCGGCCAGTGCTGG - Exonic
922533627 1:226363694-226363716 AGAGAAGACACTGCCAGCTCTGG + Intronic
923500371 1:234559411-234559433 TGAGCTGCACCTGCCAGCGCTGG + Intergenic
1067808973 10:49412441-49412463 AGAGAAGCTCATGCCAGGGCGGG + Intergenic
1070770929 10:79081980-79082002 CGACAAGTCCCTGGCAGAGCTGG + Intronic
1071567637 10:86680013-86680035 CCAGAAGCTCCTGCCTGGGCAGG - Intronic
1076885089 10:133258523-133258545 CGAGAAGCCCGAGCCAACCCAGG - Intergenic
1076900775 10:133336378-133336400 CGAGGAGCCGCTGCCCGCACGGG - Intronic
1077011731 11:381796-381818 CGGGCAGCCCCTCCCAGCCCCGG + Exonic
1077049750 11:561289-561311 TGAGCAGCCCCCGCCAGCCCGGG - Exonic
1077283041 11:1754155-1754177 CGTGAAGCCCCTGCCGGGACTGG + Intronic
1077342276 11:2031442-2031464 CAAGGAGGCCCTGCCAGCCCAGG + Intergenic
1077359526 11:2134473-2134495 CTGGAAGCCCCTGCCCGCCCTGG - Intronic
1078105229 11:8354225-8354247 GGAGAAACCCCTGCCAGGCCCGG + Intergenic
1080002675 11:27368057-27368079 CAAGAAGCCACTGCCAATGCAGG + Exonic
1081772527 11:45658806-45658828 CGAGAAGCCACAGCCAGAGTTGG + Intronic
1082076670 11:47980658-47980680 CGCGAAGCCCCTGCGCGCTCAGG + Exonic
1084212246 11:67629648-67629670 CCAGAGGTCCCTGCCAGCCCCGG + Intronic
1084400933 11:68942488-68942510 GCAGGAGCCCCTGCCAGCTCTGG + Intergenic
1085351807 11:75802565-75802587 CCAGAAGCCCCAGCCTGCCCGGG + Intergenic
1086423285 11:86658786-86658808 GGAGAAGCTGCTGCCAGCTCTGG + Intronic
1089493700 11:118898396-118898418 CTAGAAGTCGCTGCCAGGGCTGG - Exonic
1089814718 11:121162201-121162223 CGAGAAGCCCATAGCAGGGCTGG - Exonic
1202825262 11_KI270721v1_random:86631-86653 CAAGGAGGCCCTGCCAGCCCAGG + Intergenic
1098161284 12:67649445-67649467 CGCCAAGCCCCGGGCAGCGCAGG - Intronic
1099654770 12:85475687-85475709 CTAGAACTCCCTGCCAGCCCAGG + Intergenic
1101683015 12:106987317-106987339 CCAGATGCCCCCGCCAGCACAGG - Intergenic
1104108969 12:125688286-125688308 CGGGAAACCCCTTCCAGCACAGG - Intergenic
1104606441 12:130193047-130193069 GCAGAAGCACCTGCCAGCCCTGG - Intergenic
1104804118 12:131574138-131574160 AGAGAAGCCCGTGCCAGCCTTGG + Intergenic
1105615592 13:22009231-22009253 CAAGAAGCCCCTGCTACTGCAGG - Intergenic
1106087722 13:26558033-26558055 CGAGAAGCCCCTGCCAGCGCGGG - Intronic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1107559160 13:41545004-41545026 AGAGAAGCCCATGCAAGCTCTGG - Intergenic
1113632896 13:111900011-111900033 AGGGAAGCCCCTGGCAGCTCAGG - Intergenic
1113745661 13:112742381-112742403 GGAGGAGCCCCTGCGGGCGCTGG + Intronic
1113887287 13:113667623-113667645 AGAGAAGCACCTGCCGGCCCTGG + Exonic
1115665045 14:35535753-35535775 GGAGGAGCCCCCGCCAGAGCGGG - Exonic
1116973994 14:51095476-51095498 CGAGAAGCCCCAGCCCCCTCCGG - Exonic
1117045118 14:51805746-51805768 TGAGAAGCCTCTGCCAGCCTTGG - Intergenic
1118404809 14:65412745-65412767 GGGGAAGCCTCGGCCAGCGCCGG - Intronic
1119716406 14:76862734-76862756 CGAGAGGCTCCTGCCAGCAAAGG + Intronic
1123067728 14:105626881-105626903 CGAGAAGGCCAGGCCAGGGCTGG - Intergenic
1123071747 14:105645606-105645628 CGAGAAGGCCAGGCCAGGGCTGG - Intergenic
1123091411 14:105743882-105743904 CGAGAAGGCCAGGCCAGGGCTGG - Intergenic
1125518849 15:40337399-40337421 GGAGAAGGCCCGGCCAGGGCAGG - Exonic
1127695977 15:61448205-61448227 CCAGAAGCAGCTGCCAGCTCTGG - Intergenic
1128235764 15:66066155-66066177 CGTGAAGCTTCTGCCAGCTCAGG + Intronic
1128526179 15:68414001-68414023 CCAGAAGCCCCAGCCAGGGCAGG - Intronic
1129254833 15:74328337-74328359 CGTGAAGCCCCTGCCCAGGCAGG - Intronic
1131248943 15:90818596-90818618 CCAGAGGCCTCTGCCAGCGGCGG - Intergenic
1132792647 16:1700891-1700913 CCAGAAGTCCCTGCCAGGGGCGG - Exonic
1133002676 16:2858896-2858918 CGAGAATCCACTCCCAGCCCAGG - Intergenic
1133020275 16:2964062-2964084 CGGGAAGCCCCGCCCAGCACTGG - Exonic
1136491316 16:30610115-30610137 CGAGGAGCCCCTGCCGGACCAGG + Exonic
1138079158 16:54072391-54072413 CGAGACACTCCTGCCAGCCCTGG - Intronic
1139492221 16:67292329-67292351 GGACAGGCCCCTGCCAGCCCAGG - Intronic
1142077493 16:88128616-88128638 AGAGAAGCCCCTGCCTCTGCGGG - Intergenic
1142362315 16:89633248-89633270 GGAGAGGCCCGTGCCAGCCCAGG + Intronic
1143202680 17:5123136-5123158 CGCCCAGCCACTGCCAGCGCCGG - Intronic
1145736776 17:27238699-27238721 CTAGAGGCGCCTGCCAGAGCAGG - Intergenic
1145961166 17:28887292-28887314 CGAGAGGCTCCTGCCAGCCTAGG + Intronic
1147769611 17:42858429-42858451 CCAGAAGCCCAGGCCAGGGCAGG + Intergenic
1148118269 17:45191083-45191105 CTAGAAGCCCCTCTCAGGGCTGG + Intergenic
1148759998 17:49994680-49994702 GGAGCAGCCGCTGCCAGCCCAGG - Exonic
1149849320 17:60026008-60026030 CGCCCAGCCACTGCCAGCGCCGG + Intergenic
1149860848 17:60120516-60120538 CGCCCAGCCACTGCCAGCGCCGG - Intergenic
1149997955 17:61414682-61414704 TGAGAAGCCCCTGCCCGACCAGG - Intergenic
1151118443 17:71765697-71765719 CCAGTAGCCCCTGCCAGACCTGG + Intergenic
1151655378 17:75493377-75493399 TGAGGAGCCCCTGCCAGAGGAGG - Intronic
1152064102 17:78100618-78100640 AGAGAAGCCCCTCCCATCACAGG - Intronic
1155422700 18:25672585-25672607 CCAGAAGCCCCTGGCAGAGGAGG - Intergenic
1160030135 18:75250329-75250351 GGAGAAGCTCCTGCCGGGGCTGG - Intronic
1160158847 18:76455575-76455597 GGAGAAGCCCCTGGCAGCCCAGG + Intronic
1160439584 18:78879225-78879247 CTAGAACTCCCTGCCTGCGCTGG + Intergenic
1160444190 18:78914387-78914409 CCAGGGGCCCGTGCCAGCGCGGG - Intergenic
1160525056 18:79530964-79530986 CGAGATGCCCTTGCCAGGGCCGG - Intergenic
1160702114 19:512700-512722 CGAGATGCCCCTGCAAGCCTCGG + Intronic
1160988903 19:1852654-1852676 AGACAGGCCCCTGCCAGGGCTGG + Exonic
1161018737 19:1997594-1997616 CCAGAAGCCTCTGCCATCGGGGG - Intronic
1161843690 19:6697623-6697645 CAAGAAGCCTCTGCCACCCCGGG + Intronic
1162716940 19:12640205-12640227 CGAGAAGACTCTGTCATCGCCGG + Intergenic
1165158832 19:33804062-33804084 CGTGGAGCCCCTGACAGAGCTGG + Intronic
1165331829 19:35144522-35144544 TGAGAAGCCCCTGGCAGTGAAGG + Intronic
1165939425 19:39407801-39407823 CGAGGAGCCCCAGCCTGGGCTGG - Exonic
1166621433 19:44304861-44304883 AGAGAAGCCGCGGCCAGCGCTGG - Intronic
1167259887 19:48452465-48452487 AAAGAAGCCCCTCCCAGCTCAGG - Intronic
926636171 2:15182020-15182042 CCAGAAGCCCCTGGCACTGCTGG + Intronic
927019401 2:19001119-19001141 AGAGAACCACCTCCCAGCGCAGG + Intergenic
936068114 2:109347586-109347608 TGAGAAGCCCCGGCCTGCCCCGG + Intronic
936082744 2:109446084-109446106 CGAGTAGTCCCAGCCAGCTCGGG + Intronic
937203871 2:120223513-120223535 CGGGAAGCCGCGGCGAGCGCGGG - Intergenic
937259205 2:120574712-120574734 CTACAAGCCCCTGCCAGCTCTGG + Intergenic
940699461 2:157023485-157023507 CTAGAAGCCCCTCCCATCACAGG + Intergenic
941987432 2:171522805-171522827 CGTGAAGCCCCTTCCAGCTGAGG + Intronic
946019927 2:216633874-216633896 CGAGCTGCCCCTGCAGGCGCTGG + Exonic
946084101 2:217153765-217153787 CCAGAAGCCTCTCCCACCGCTGG - Intergenic
948913103 2:241015600-241015622 CGGGAGGCCTCAGCCAGCGCAGG - Intronic
1169164061 20:3407521-3407543 GGGGCAGCCCCTGCCGGCGCGGG + Exonic
1171500711 20:25590973-25590995 CCAGAAGCAGCTGCCAGCTCTGG - Intergenic
1174393656 20:50233289-50233311 GGAGGGGCCCCTGCCAGGGCAGG + Intergenic
1175389658 20:58619054-58619076 AGAGTAGCCCCTGCCAGAGCTGG + Intergenic
1175920908 20:62450302-62450324 CCTGAAGACCCTGCCAGCCCTGG - Intergenic
1175927907 20:62480050-62480072 CCAGAAGCCCCTCACAGCCCAGG - Intergenic
1176138322 20:63534706-63534728 GGAGAAGCCCCTGCCCTCCCAGG + Intronic
1176173589 20:63707537-63707559 CCAGGAGCCCCTGCAGGCGCCGG + Intronic
1179951955 21:44713195-44713217 CCAGGACCCCCTGCCAGCTCCGG + Intergenic
1180908446 22:19431811-19431833 CCCGAAGCCCCTGCCAGCGGAGG - Intronic
1181757953 22:25038797-25038819 CGAGAAGCCCCTGGAAGCCTGGG + Exonic
1182299666 22:29330552-29330574 TGAGAGGCCCCAGTCAGCGCGGG + Intronic
1184496807 22:44846843-44846865 GGAGAAGGCCCTGCCAGACCGGG + Intronic
1185336284 22:50272092-50272114 CGGGAACCCCCTGCCTGCCCAGG + Intergenic
950111099 3:10419203-10419225 CCAGAAGCCCCTCCCACCACGGG + Intronic
950396004 3:12734593-12734615 TGAGATGCCCCTGCCCGGGCTGG + Exonic
954468888 3:50675039-50675061 CCAGCAGCCCCTGGCGGCGCGGG - Intergenic
957148774 3:76457990-76458012 AGAGAAGCCCCTCCCATCACAGG - Intronic
968886421 4:3336246-3336268 CGGGAAGCCGCTGCCACCCCAGG - Intronic
969694747 4:8728265-8728287 CCAGTAGCCCCTGCCAGTGCTGG + Intergenic
974229447 4:59091490-59091512 CAGTAAGCCCCTGCCACCGCAGG + Intergenic
979097894 4:116573859-116573881 AGAGAAGCCCCTCCCATCACAGG - Intergenic
985622147 5:961320-961342 CGTGAAGCCTCTGCCACGGCGGG + Intergenic
985749921 5:1667925-1667947 CGAGACCCCTCTCCCAGCGCAGG - Intergenic
985760224 5:1745154-1745176 CAAGAAGCCCCTGCTGGCCCAGG + Intergenic
1002415975 5:179121271-179121293 CGGGAAGCACCTGGCAGTGCCGG + Intronic
1002899955 6:1402137-1402159 CCAGAAGCCCCTGCCGCCCCAGG - Intergenic
1006535556 6:34696404-34696426 CCCGAGGCCGCTGCCAGCGCTGG + Intronic
1012620508 6:101339157-101339179 AGAGGAGCCCCTGCCACCCCAGG + Intergenic
1015994888 6:138987745-138987767 CGCGCAGCCCCTGCCGGCCCAGG - Exonic
1018344144 6:162882993-162883015 CGAGGTGCCCCTGCCAGTGAGGG - Intronic
1019294483 7:266652-266674 CCAGAAGCCTCTGCCTGCCCAGG + Intergenic
1019343069 7:517580-517602 CGAGGAGACCCCGCGAGCGCCGG + Intronic
1026901571 7:74040272-74040294 AGAGAAGCGACTGCCAGCGCAGG + Intronic
1029711202 7:102300936-102300958 CGAGAAGCCCTTGCGAACGCGGG - Exonic
1035083044 7:156233430-156233452 CAAGCACCCCCTGCCAGCGGTGG - Intergenic
1038266799 8:26044353-26044375 CGCGCCGCCACTGCCAGCGCCGG + Intronic
1040038898 8:42896975-42896997 TGCGGAGCCGCTGCCAGCGCTGG + Exonic
1040571439 8:48614976-48614998 GGAGAAGCCGCGGCCAGCACTGG - Intergenic
1048390488 8:133959065-133959087 CAAGAAGCCTTTGCCAGCCCAGG + Intergenic
1049655729 8:143796135-143796157 CCAGAAGCCCCTGCCTGTCCTGG - Intronic
1049686286 8:143940524-143940546 CCGGAGGCCCCAGCCAGCGCAGG - Intronic
1051914987 9:22197999-22198021 CCAGAAGCCCCTCCCATCACAGG + Intergenic
1058615694 9:106824964-106824986 TGAGAAGCCAATGCCAGCTCAGG + Intergenic
1060035792 9:120254531-120254553 AGAGGAGCCCATGCCAGCCCAGG + Intergenic
1060606740 9:124921599-124921621 CCAGAAGCCTTTGCCAGCACCGG + Intronic
1060736954 9:126072079-126072101 GGAGACGCCCCTTCCAGGGCTGG + Intergenic
1061278660 9:129584484-129584506 CATGAAGCCCCTACCAGCCCTGG + Intergenic
1061900658 9:133670514-133670536 CAAGAAGCGCCTGCCTGCCCTGG + Intronic
1062031103 9:134362348-134362370 AGAGATGCCCCTGCCACCCCAGG - Intronic
1062034435 9:134376646-134376668 CGAGATGCACCAGCCAGCACAGG - Intronic
1062516701 9:136940553-136940575 GGAGCAGCCCCTGCCACCACTGG + Exonic
1189747044 X:44179938-44179960 CCAGAAGTCCCTGCTAGCACAGG - Intronic
1192330943 X:70174754-70174776 AGAGAAGCACCTGCCTGCCCTGG - Intergenic
1192624541 X:72714089-72714111 CGGGAAGCCAGTGCTAGCGCTGG - Intronic
1200238217 X:154479318-154479340 GGGGAAGGCCCCGCCAGCGCAGG - Intergenic