ID: 1106087847

View in Genome Browser
Species Human (GRCh38)
Location 13:26558469-26558491
Sequence GCGCCGCGGCTCCGTGCGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 138}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106087847_1106087863 29 Left 1106087847 13:26558469-26558491 CCGCGCGCACGGAGCCGCGGCGC 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1106087863 13:26558521-26558543 CGCGCGCCTGGGCTTTAGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1106087847_1106087860 18 Left 1106087847 13:26558469-26558491 CCGCGCGCACGGAGCCGCGGCGC 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1106087860 13:26558510-26558532 GGGTCTTTACCCGCGCGCCTGGG 0: 1
1: 0
2: 0
3: 0
4: 17
1106087847_1106087854 -3 Left 1106087847 13:26558469-26558491 CCGCGCGCACGGAGCCGCGGCGC 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1106087854 13:26558489-26558511 CGCGCGGGGTATCATCCCCGGGG 0: 1
1: 0
2: 0
3: 0
4: 18
1106087847_1106087853 -4 Left 1106087847 13:26558469-26558491 CCGCGCGCACGGAGCCGCGGCGC 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1106087853 13:26558488-26558510 GCGCGCGGGGTATCATCCCCGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1106087847_1106087859 17 Left 1106087847 13:26558469-26558491 CCGCGCGCACGGAGCCGCGGCGC 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1106087859 13:26558509-26558531 GGGGTCTTTACCCGCGCGCCTGG 0: 1
1: 0
2: 0
3: 1
4: 25
1106087847_1106087852 -5 Left 1106087847 13:26558469-26558491 CCGCGCGCACGGAGCCGCGGCGC 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1106087852 13:26558487-26558509 GGCGCGCGGGGTATCATCCCCGG 0: 1
1: 0
2: 0
3: 0
4: 22
1106087847_1106087864 30 Left 1106087847 13:26558469-26558491 CCGCGCGCACGGAGCCGCGGCGC 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1106087864 13:26558522-26558544 GCGCGCCTGGGCTTTAGCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1106087847_1106087855 -2 Left 1106087847 13:26558469-26558491 CCGCGCGCACGGAGCCGCGGCGC 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1106087855 13:26558490-26558512 GCGCGGGGTATCATCCCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106087847 Original CRISPR GCGCCGCGGCTCCGTGCGCG CGG (reversed) Intronic