ID: 1106087851

View in Genome Browser
Species Human (GRCh38)
Location 13:26558483-26558505
Sequence GGATGATACCCCGCGCGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 18}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106087851_1106087859 3 Left 1106087851 13:26558483-26558505 CCGCGGCGCGCGGGGTATCATCC 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1106087859 13:26558509-26558531 GGGGTCTTTACCCGCGCGCCTGG 0: 1
1: 0
2: 0
3: 1
4: 25
1106087851_1106087860 4 Left 1106087851 13:26558483-26558505 CCGCGGCGCGCGGGGTATCATCC 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1106087860 13:26558510-26558532 GGGTCTTTACCCGCGCGCCTGGG 0: 1
1: 0
2: 0
3: 0
4: 17
1106087851_1106087863 15 Left 1106087851 13:26558483-26558505 CCGCGGCGCGCGGGGTATCATCC 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1106087863 13:26558521-26558543 CGCGCGCCTGGGCTTTAGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1106087851_1106087864 16 Left 1106087851 13:26558483-26558505 CCGCGGCGCGCGGGGTATCATCC 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1106087864 13:26558522-26558544 GCGCGCCTGGGCTTTAGCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106087851 Original CRISPR GGATGATACCCCGCGCGCCG CGG (reversed) Intronic