ID: 1106087856 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:26558504-26558526 |
Sequence | CGCGCGGGTAAAGACCCCCG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 21 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 18} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1106087856_1106087863 | -6 | Left | 1106087856 | 13:26558504-26558526 | CCCCGGGGGTCTTTACCCGCGCG | 0: 1 1: 0 2: 0 3: 2 4: 18 |
||
Right | 1106087863 | 13:26558521-26558543 | CGCGCGCCTGGGCTTTAGCGAGG | 0: 1 1: 0 2: 0 3: 2 4: 31 |
||||
1106087856_1106087866 | 19 | Left | 1106087856 | 13:26558504-26558526 | CCCCGGGGGTCTTTACCCGCGCG | 0: 1 1: 0 2: 0 3: 2 4: 18 |
||
Right | 1106087866 | 13:26558546-26558568 | AGAAGCTTCCTCTCAGTTTGTGG | 0: 1 1: 0 2: 0 3: 17 4: 212 |
||||
1106087856_1106087864 | -5 | Left | 1106087856 | 13:26558504-26558526 | CCCCGGGGGTCTTTACCCGCGCG | 0: 1 1: 0 2: 0 3: 2 4: 18 |
||
Right | 1106087864 | 13:26558522-26558544 | GCGCGCCTGGGCTTTAGCGAGGG | 0: 1 1: 0 2: 0 3: 1 4: 31 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1106087856 | Original CRISPR | CGCGCGGGTAAAGACCCCCG GGG (reversed) | Intronic | ||