ID: 1106087858

View in Genome Browser
Species Human (GRCh38)
Location 13:26558506-26558528
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106087858_1106087864 -7 Left 1106087858 13:26558506-26558528 CCGGGGGTCTTTACCCGCGCGCC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1106087864 13:26558522-26558544 GCGCGCCTGGGCTTTAGCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1106087858_1106087863 -8 Left 1106087858 13:26558506-26558528 CCGGGGGTCTTTACCCGCGCGCC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1106087863 13:26558521-26558543 CGCGCGCCTGGGCTTTAGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1106087858_1106087866 17 Left 1106087858 13:26558506-26558528 CCGGGGGTCTTTACCCGCGCGCC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1106087866 13:26558546-26558568 AGAAGCTTCCTCTCAGTTTGTGG 0: 1
1: 0
2: 0
3: 17
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106087858 Original CRISPR GGCGCGCGGGTAAAGACCCC CGG (reversed) Intronic