ID: 1106087859

View in Genome Browser
Species Human (GRCh38)
Location 13:26558509-26558531
Sequence GGGGTCTTTACCCGCGCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106087851_1106087859 3 Left 1106087851 13:26558483-26558505 CCGCGGCGCGCGGGGTATCATCC 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1106087859 13:26558509-26558531 GGGGTCTTTACCCGCGCGCCTGG 0: 1
1: 0
2: 0
3: 1
4: 25
1106087847_1106087859 17 Left 1106087847 13:26558469-26558491 CCGCGCGCACGGAGCCGCGGCGC 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1106087859 13:26558509-26558531 GGGGTCTTTACCCGCGCGCCTGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106087859 Original CRISPR GGGGTCTTTACCCGCGCGCC TGG Intronic