ID: 1106087863

View in Genome Browser
Species Human (GRCh38)
Location 13:26558521-26558543
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106087856_1106087863 -6 Left 1106087856 13:26558504-26558526 CCCCGGGGGTCTTTACCCGCGCG 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1106087863 13:26558521-26558543 CGCGCGCCTGGGCTTTAGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1106087847_1106087863 29 Left 1106087847 13:26558469-26558491 CCGCGCGCACGGAGCCGCGGCGC 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1106087863 13:26558521-26558543 CGCGCGCCTGGGCTTTAGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1106087858_1106087863 -8 Left 1106087858 13:26558506-26558528 CCGGGGGTCTTTACCCGCGCGCC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1106087863 13:26558521-26558543 CGCGCGCCTGGGCTTTAGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1106087857_1106087863 -7 Left 1106087857 13:26558505-26558527 CCCGGGGGTCTTTACCCGCGCGC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1106087863 13:26558521-26558543 CGCGCGCCTGGGCTTTAGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1106087851_1106087863 15 Left 1106087851 13:26558483-26558505 CCGCGGCGCGCGGGGTATCATCC 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1106087863 13:26558521-26558543 CGCGCGCCTGGGCTTTAGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type