ID: 1106087866

View in Genome Browser
Species Human (GRCh38)
Location 13:26558546-26558568
Sequence AGAAGCTTCCTCTCAGTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 212}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106087865_1106087866 -4 Left 1106087865 13:26558527-26558549 CCTGGGCTTTAGCGAGGGCAGAA 0: 1
1: 0
2: 1
3: 12
4: 111
Right 1106087866 13:26558546-26558568 AGAAGCTTCCTCTCAGTTTGTGG 0: 1
1: 0
2: 0
3: 17
4: 212
1106087861_1106087866 4 Left 1106087861 13:26558519-26558541 CCCGCGCGCCTGGGCTTTAGCGA 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1106087866 13:26558546-26558568 AGAAGCTTCCTCTCAGTTTGTGG 0: 1
1: 0
2: 0
3: 17
4: 212
1106087858_1106087866 17 Left 1106087858 13:26558506-26558528 CCGGGGGTCTTTACCCGCGCGCC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1106087866 13:26558546-26558568 AGAAGCTTCCTCTCAGTTTGTGG 0: 1
1: 0
2: 0
3: 17
4: 212
1106087857_1106087866 18 Left 1106087857 13:26558505-26558527 CCCGGGGGTCTTTACCCGCGCGC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1106087866 13:26558546-26558568 AGAAGCTTCCTCTCAGTTTGTGG 0: 1
1: 0
2: 0
3: 17
4: 212
1106087856_1106087866 19 Left 1106087856 13:26558504-26558526 CCCCGGGGGTCTTTACCCGCGCG 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1106087866 13:26558546-26558568 AGAAGCTTCCTCTCAGTTTGTGG 0: 1
1: 0
2: 0
3: 17
4: 212
1106087862_1106087866 3 Left 1106087862 13:26558520-26558542 CCGCGCGCCTGGGCTTTAGCGAG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1106087866 13:26558546-26558568 AGAAGCTTCCTCTCAGTTTGTGG 0: 1
1: 0
2: 0
3: 17
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106087866 Original CRISPR AGAAGCTTCCTCTCAGTTTG TGG Intronic