ID: 1106088333

View in Genome Browser
Species Human (GRCh38)
Location 13:26562741-26562763
Sequence GGGTGTTGAGGGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1081
Summary {0: 1, 1: 0, 2: 7, 3: 87, 4: 986}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106088326_1106088333 4 Left 1106088326 13:26562714-26562736 CCTCATTGCTGTGGATTGCAGAG 0: 1
1: 0
2: 0
3: 8
4: 203
Right 1106088333 13:26562741-26562763 GGGTGTTGAGGGAGGGAAGCTGG 0: 1
1: 0
2: 7
3: 87
4: 986

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106088333 Original CRISPR GGGTGTTGAGGGAGGGAAGC TGG Intronic
900089129 1:911723-911745 TCGTGCAGAGGGAGGGAAGCAGG + Intergenic
900156269 1:1204495-1204517 GGGTGTGGGGGGAGGGAGGGAGG + Intronic
900190947 1:1351982-1352004 GGATGGGGAGGGAGGGAGGCTGG - Intergenic
900475952 1:2876476-2876498 AGGGGATGAGGGAGGGAACCAGG + Intergenic
900480465 1:2895711-2895733 GGCTGGTGAGTGAGGGAAGCTGG + Intergenic
900514326 1:3074023-3074045 GGCTGTAGGGGGAGGGAAGACGG + Intronic
900675373 1:3881932-3881954 GGGTGTTGAGTGAGCTAAACTGG - Intronic
901433320 1:9231652-9231674 AGGTGGGGAGGGAGGGAAACAGG - Intergenic
901658258 1:10782892-10782914 GAGAGTTGAGGGAGGGATGAGGG + Intronic
901743225 1:11355849-11355871 GGGGGCAGCGGGAGGGAAGCTGG - Intergenic
901787105 1:11632016-11632038 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
902173212 1:14629757-14629779 GGGTGTGGTGGGAGTGGAGCTGG + Intronic
902209345 1:14893535-14893557 GGGTGTGGAGGAAGGGAAGATGG - Intronic
902406891 1:16189261-16189283 GCGAGTGGAGGGAGTGAAGCTGG - Intergenic
902477818 1:16697425-16697447 TGGTGGCGAGGGAGGGGAGCAGG - Intergenic
902488242 1:16762192-16762214 GGATGTTGAGAAAGGGAAGATGG - Intronic
902625343 1:17673187-17673209 GGGAGGTGAGGAAGGGGAGCTGG + Intronic
902762592 1:18592670-18592692 GGCTCTAGAGGGAGGGAAGGGGG - Intergenic
902963992 1:19984822-19984844 AGGTGTGGAGGGAGGGGCGCGGG - Intergenic
903273644 1:22207655-22207677 AGGAGTGGAGGGAGGGAAGACGG - Intergenic
903301037 1:22379063-22379085 AGGGGTTGTGGGAGGGGAGCAGG - Intergenic
903331097 1:22597633-22597655 AGGTGTGGAGGGAGGGCAGTGGG - Intronic
903474773 1:23612031-23612053 GGGGGTAGGGGCAGGGAAGCAGG + Intronic
903829226 1:26164704-26164726 GGATGTGGAGGGAGGGGACCGGG + Intergenic
903891486 1:26573182-26573204 GGGGGTTGGGGGAGGGCTGCAGG - Intronic
904043547 1:27597679-27597701 GGGGGTTTGGGGAGGGAAGAGGG + Intronic
904396180 1:30224057-30224079 GGGTGTAGGGGGAGGGAGGGGGG + Intergenic
905178159 1:36150798-36150820 TGGGGTTGGGGGAGGAAAGCAGG + Intronic
905393974 1:37655666-37655688 GGGTTTTGAGGGAGGGAAGAGGG - Intergenic
905618500 1:39419115-39419137 GGGAGTTGACAGAAGGAAGCAGG + Intronic
905857526 1:41323829-41323851 GGGTGCTGGGGTAGGGCAGCGGG - Intergenic
905887013 1:41496853-41496875 GGCTGGTGTGGGAAGGAAGCGGG + Intergenic
905908468 1:41637443-41637465 GACTGTTGAGGGAGGGGGGCAGG - Intronic
906197731 1:43939287-43939309 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
906244390 1:44262851-44262873 GGAAATAGAGGGAGGGAAGCAGG - Intronic
906262735 1:44406223-44406245 GGGTGTGGAGGGAGGGAGGTGGG + Intronic
906316679 1:44791007-44791029 GGGGGTGGAGGGAGGCAAGAAGG - Intergenic
906568458 1:46816953-46816975 TGGTGGTGAGGGAGGAAAACTGG + Intronic
906627636 1:47338289-47338311 GGGTATTGTTAGAGGGAAGCTGG + Intronic
906683156 1:47744587-47744609 GGGTATGGAGGGAGGGTAGCAGG + Intergenic
906987263 1:50696815-50696837 GGGGGTGGAGGGAGGGCAGTAGG - Intronic
907506538 1:54923163-54923185 GGGTGGGGAGGGAGGGAGGCAGG - Intergenic
907729414 1:57051441-57051463 GGGAGTTGTGGGGGGGAAGTAGG + Intronic
907866269 1:58402309-58402331 GGGTGTTGGGAGAGGGGAGAAGG - Intronic
907941029 1:59087563-59087585 ATGTGTTGTGGGAGGGATGCAGG - Intergenic
908114004 1:60923755-60923777 GGGTGTGGGGGGATGGCAGCCGG + Intronic
908574955 1:65449625-65449647 GGTAGTTGCCGGAGGGAAGCTGG - Intronic
908729047 1:67207483-67207505 AGGTGTTGTGGGAGGGACCCAGG + Intronic
909094084 1:71265680-71265702 GTGGGATGAGGGAGAGAAGCAGG - Intergenic
909559214 1:76990993-76991015 GGCTGTAGAAGGAGGGAAGTAGG + Intronic
909749963 1:79147113-79147135 GCCTGTTGCGGGAGGGAGGCGGG - Intergenic
909881081 1:80879647-80879669 GGGGGTTGAGGGATGGAGGTTGG - Intergenic
910487611 1:87732753-87732775 AGGTGTTGAGGGAGGAAACTGGG + Intergenic
910905796 1:92176302-92176324 GGCTGATGAGGGATGGAATCAGG - Intronic
912344680 1:108953587-108953609 GGGTGTTGAGGTTGGGGAGATGG - Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912699350 1:111864986-111865008 GGGTGGTGGGGGTGGGCAGCAGG + Intronic
912779109 1:112527382-112527404 GGCAGTTGGGGGTGGGAAGCAGG - Intronic
913389647 1:118296202-118296224 GTGTGTTGTGGGAGGGAAGGTGG - Intergenic
913717148 1:121547760-121547782 GCCTGTTGAGGGAGGGCAGGGGG - Intergenic
914248155 1:145901072-145901094 GGGGGTGGAGGGAGGAAAGGAGG - Intronic
914676922 1:149912993-149913015 GGGGCTTGCGGGAGGGCAGCTGG - Intronic
914834220 1:151194028-151194050 GGGTGTTAGGGGAGAGATGCTGG - Intronic
914912744 1:151800656-151800678 GTGTGTGGAGGGGGTGAAGCAGG + Exonic
915078910 1:153337932-153337954 AGGTGTGGAGGGAGAGCAGCTGG - Intronic
915313034 1:155013854-155013876 GGATGTGGGGGGAGGGATGCTGG + Intronic
915722467 1:157994562-157994584 TGGGGTTGGGGGAGGGAAGAGGG + Intronic
915944502 1:160140079-160140101 GGGTGTTGAGGAACAGAAGCAGG - Intronic
915945667 1:160149753-160149775 GAGTTTGGAGGGAGGGAAGGTGG + Intergenic
916071492 1:161172706-161172728 GGGGGATGTGGGAGAGAAGCTGG - Intronic
916222539 1:162459330-162459352 GGGGGTTGAGAGTGGGAAGGAGG + Intergenic
916271961 1:162952822-162952844 GGGGGTTGAGGGTGGGAGGGTGG - Intergenic
916556578 1:165899025-165899047 GGGTGCTGGGGTAGGGAGGCTGG + Intronic
916756307 1:167773394-167773416 AGGGGTGGAGGGAGGGAATCAGG + Intronic
916921667 1:169475617-169475639 GGTTGATGGGGGAGGGAAGGAGG - Intronic
917495202 1:175534215-175534237 GGATGTTGAGGAAAGCAAGCTGG + Intronic
918002205 1:180508591-180508613 AGGTGTGGAGGGAGAGGAGCAGG + Intergenic
918407367 1:184224166-184224188 GGGTGGAGAGAGAGGGAAGGAGG - Intergenic
918512046 1:185322052-185322074 AGGTGTGGAGGGAGAGACGCGGG - Intergenic
919207027 1:194431344-194431366 AGGTGTGGAGGGAGAGATGCTGG - Intergenic
919313711 1:195945757-195945779 AGGTGTTGAAGGAGGGGAACAGG - Intergenic
919335945 1:196233900-196233922 GGGTGATGAGGAGGGGAAGATGG + Intronic
919496968 1:198285039-198285061 GGGTGGAGTGGGAGTGAAGCGGG - Intronic
919664764 1:200281488-200281510 ACGTGTTGTGGGAGGGAACCAGG - Intergenic
919778669 1:201209406-201209428 GGGGGTTCAGGGAGCAAAGCAGG + Exonic
920397565 1:205658310-205658332 GGGTGTTGAAGGAAGGTAGAGGG - Exonic
920687964 1:208124217-208124239 GAGGGTGGAGGGAGGGAAGGGGG + Intronic
920694852 1:208174432-208174454 GGCTGTGGAGGGAGGGAAGAAGG + Intronic
920816371 1:209336933-209336955 GTGGGTGGAGGGAGGGAAGGGGG + Intergenic
921074701 1:211690929-211690951 TAGTGTTGGGGGACGGAAGCTGG - Intergenic
921096755 1:211893413-211893435 GGGGAATGAGGGAGGGAAGTGGG + Intergenic
921293868 1:213683837-213683859 GGGTGAGGAGGGAGGGAGGCTGG - Intergenic
921317352 1:213905131-213905153 GAGAGGTGAGGGAGGGAAGAAGG + Intergenic
921899655 1:220436851-220436873 GTGTGTTGAGCTAGGGAATCTGG + Intergenic
921946323 1:220888264-220888286 GGGAGTAGAGGGAGAGAAGCGGG - Intergenic
922215375 1:223516035-223516057 AGGTGGCGGGGGAGGGAAGCTGG - Intergenic
922228777 1:223667843-223667865 TGATGTTGAGGGAAGGAAGACGG - Intergenic
922723474 1:227910727-227910749 GGGTGGTGAGGAAGGGAATCAGG - Intergenic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
922855555 1:228772204-228772226 AGGACTTGTGGGAGGGAAGCAGG + Intergenic
922933491 1:229407673-229407695 GTCTGTGGAGGGAGGGAAGGAGG + Intergenic
922934017 1:229410179-229410201 GGGTGTTGGGGGAGGGGTGCAGG - Intergenic
922969961 1:229727976-229727998 TGTGGTTTAGGGAGGGAAGCAGG - Intergenic
923010273 1:230083028-230083050 GGATGATGGAGGAGGGAAGCTGG + Intronic
923330934 1:232923977-232923999 GGCTGTAAAGGGAGGGAAGATGG + Intergenic
923532200 1:234820321-234820343 GGATGTTGAGAAAGGGAAGATGG + Intergenic
923751813 1:236753802-236753824 GGGTGTAGGGGGAAGGAAGAGGG - Intronic
923946839 1:238897933-238897955 GGGTGAATAAGGAGGGAAGCAGG + Intergenic
924060986 1:240174050-240174072 GGGAGTTGGTGGAGAGAAGCAGG - Intronic
924519525 1:244794219-244794241 GGGTGTGGAGGGACGGGAGGAGG - Intergenic
1062840430 10:666361-666383 GGGCGGTGAGGGAGGGAGGCGGG - Intronic
1062908153 10:1193057-1193079 AGGTGTTGAGGGTGGAAGGCAGG + Intronic
1062974410 10:1672738-1672760 GTGCGTGGAGGGAGGGAGGCAGG - Intronic
1063247906 10:4242237-4242259 AGGTGTTGGGGCAGGGAAGGTGG + Intergenic
1063300431 10:4845286-4845308 AGGTGTGGAGGGAGAGACGCCGG - Intronic
1063595983 10:7435988-7436010 GGGGGGTGGGGGAGGGCAGCAGG + Intergenic
1063607472 10:7535371-7535393 TGGAGTTGAGTGAGGGAAGTGGG - Intergenic
1063762336 10:9094090-9094112 GCGGGTGGAGGGAGGGAAGAGGG + Intergenic
1063910014 10:10819975-10819997 GTGTGTTGTGGGAGGGACCCAGG + Intergenic
1063980249 10:11446644-11446666 GAATGTTGAGGAAGGGAGGCAGG + Intergenic
1063982211 10:11463295-11463317 GGATGCTGAGGACGGGAAGCGGG - Exonic
1064500196 10:15963144-15963166 GGGGGTGGAGGGAGGGATGTGGG + Intergenic
1064756546 10:18576626-18576648 TAGTGTTGGGGGATGGAAGCTGG - Intronic
1065097492 10:22296181-22296203 TAGTGTAGAGGGAGGGAAGAGGG - Intergenic
1065204520 10:23344256-23344278 AGGTGTGGAGGGAAGGAAGAGGG + Intronic
1065330245 10:24588876-24588898 GGTCCTAGAGGGAGGGAAGCAGG + Intronic
1065341256 10:24708270-24708292 GGTCATTGAGGGAGGGAAGAGGG - Intronic
1065495965 10:26328327-26328349 GGCTGTGGAGGGAGGGAACAGGG - Intergenic
1066658215 10:37713842-37713864 GGCTGGGGAGGGAGGGAAGTGGG - Intergenic
1067562179 10:47311816-47311838 GGGTGTGGTGGGAAGGGAGCAGG - Intronic
1067907370 10:50307441-50307463 TGGTGATGAGAGAGAGAAGCTGG - Intronic
1067988891 10:51186569-51186591 GGGAGTTGAGGGAGTGGAGTAGG + Intronic
1068603768 10:58982666-58982688 GGGAGGTGATGCAGGGAAGCTGG + Intergenic
1068896528 10:62209604-62209626 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1069138421 10:64794343-64794365 AGGTGTTGAAGGAGGGAAGAAGG + Intergenic
1069344978 10:67458135-67458157 GGTAAATGAGGGAGGGAAGCTGG - Intronic
1070809068 10:79288497-79288519 GTGTGTTGGGGGAGGGAAATTGG - Intronic
1070937856 10:80315424-80315446 AGGTGTGGAGGGAGGGGCGCAGG + Intergenic
1070940183 10:80337647-80337669 GCGTGTAGAGGGAGTGAGGCAGG - Intronic
1071878278 10:89866168-89866190 GGGTTTTGGGGGTGGGAGGCAGG + Intergenic
1072518253 10:96208032-96208054 GGGTGGAGAGGGATGGAAGTGGG + Intronic
1073269047 10:102245922-102245944 GGTTGTTGTGGGAGGGAACAGGG + Intronic
1073404733 10:103287248-103287270 GACTGGTGAGGGAGGGAAGAAGG + Intronic
1073855739 10:107671211-107671233 ACGTGTTGTGGGAGGGACGCAGG - Intergenic
1073868985 10:107839754-107839776 GGGGGTTGTGGAAGGGAAGGAGG + Intergenic
1074375876 10:112940450-112940472 GGTTGTGGGGGGAGGGGAGCGGG - Intergenic
1074543577 10:114385638-114385660 GGGTGTGGGGGCAGGGAGGCAGG - Intronic
1074978016 10:118596369-118596391 GGGTGTTTGGGGAAGGAACCTGG + Intergenic
1075054549 10:119207662-119207684 GCGTGTTGAGGGAGGGGGGAGGG + Exonic
1075245354 10:120817679-120817701 AGGTGAGGAGGGAGGGAAGAGGG - Intergenic
1075625761 10:123963517-123963539 GGATGAGAAGGGAGGGAAGCTGG - Intergenic
1075674921 10:124289755-124289777 GGGTGTGGAGGGAGGCAAGGAGG - Intergenic
1076095883 10:127735183-127735205 GGGTGTTATGGGAGGAAAGTGGG + Intergenic
1077186281 11:1236808-1236830 GGGGATGGAGGGAGGGCAGCCGG - Intronic
1077212027 11:1375499-1375521 GGGTATTGAGGGGGTGACGCAGG + Intergenic
1077366351 11:2162846-2162868 GAGTGTGTAGGGAGGGAGGCTGG + Intergenic
1077772109 11:5230969-5230991 GAGGGTTGAGGGTGGGAAGAGGG - Intergenic
1077858456 11:6152866-6152888 AGGAGTTGAGGTTGGGAAGCTGG - Intergenic
1078624155 11:12938965-12938987 AGGTGTTGAGACAGGGAAGGGGG - Intronic
1078809850 11:14747691-14747713 GTGTATTGGGGGAGGGAAGGAGG + Intronic
1079803677 11:24902305-24902327 GAGTGTTGAGGGTGGGAGGAGGG - Intronic
1079828411 11:25229787-25229809 TGGGGTGGAGGGAGGGAAGAGGG - Intergenic
1080567076 11:33520283-33520305 GGCTGTTGAGGGAGAGAAATGGG - Intergenic
1080801577 11:35615181-35615203 TGGAGTTGAGGGTTGGAAGCAGG - Intergenic
1080836415 11:35944469-35944491 GTGTGTTGAGGAACGGAGGCGGG + Intronic
1081773471 11:45663564-45663586 GGGTGTTGAGTGAAGGGGGCTGG + Intronic
1081858523 11:46318859-46318881 GGGCCTTGAGGGGAGGAAGCTGG + Intronic
1081859687 11:46325734-46325756 GGGAGGTGAGGGAAGGCAGCCGG + Intergenic
1081975206 11:47229429-47229451 GGGAGTGGAGAGAGGGAAGAGGG + Intronic
1083148538 11:60775812-60775834 ATGTGGTGAGGGAGGGCAGCTGG - Exonic
1083332725 11:61906448-61906470 AGGAGGTGAGGGTGGGAAGCGGG - Exonic
1083747271 11:64743299-64743321 GGCTGTGGAGGGAGGGAAGCGGG - Intronic
1083790050 11:64978791-64978813 GCGTGTTGTGGGAGGGACCCAGG - Intergenic
1083911390 11:65712249-65712271 GGCAGTGGAGGGAGGGAAGATGG + Exonic
1083978823 11:66147718-66147740 GGGGGTAGTGGGAGGGAAGTGGG + Intronic
1084014046 11:66368425-66368447 GGGTGAAGATGGAGGTAAGCAGG - Intronic
1084111414 11:67016308-67016330 AGATGTTGCGGGAGGGAAGTGGG + Intronic
1084144355 11:67256205-67256227 GTGTGTGGAGGGAGGGAGGGAGG + Exonic
1084941467 11:72615492-72615514 GTGGGTAGAGGGAGGGAGGCAGG + Intronic
1085026431 11:73239276-73239298 GGGTGTGGGAGGAGGGAAGCAGG + Intergenic
1085326104 11:75607705-75607727 GGGTCTGGTGGGAGGGGAGCCGG + Intronic
1085397129 11:76212186-76212208 GGGCATTGAGGAAGGGAAGGCGG + Intergenic
1085464237 11:76713358-76713380 GGGTGGTGAGGGATGGATGGAGG + Intergenic
1085861314 11:80239265-80239287 GGGTGGTGAGGGAGAGAAGGAGG + Intergenic
1086231567 11:84576958-84576980 GTGTGTTGTGGGAGGGACTCGGG + Intronic
1086248982 11:84791216-84791238 TGGTGTTGAGGGAGGGAACTGGG - Intronic
1086415932 11:86588951-86588973 GGGAGGTGAGGGAGGGCAGGGGG - Intronic
1086552461 11:88069040-88069062 AGGTGTGGAGGGAGAGATGCAGG + Intergenic
1087171974 11:95058410-95058432 GAGAGTTGAGGGAGGGAGGGAGG - Intergenic
1088607534 11:111545780-111545802 GGGAGCTGAGGGGTGGAAGCAGG - Intronic
1088679035 11:112222901-112222923 GGGAGTTGAGGCAGGAAGGCTGG + Intronic
1089078709 11:115759535-115759557 GGAGGTAGAGGTAGGGAAGCTGG + Intergenic
1089180382 11:116579570-116579592 GAGTGGTGAGGAAGGGCAGCTGG - Intergenic
1089220409 11:116866294-116866316 GGCTGTGGAGGAAGGGAAGAAGG + Intronic
1089260857 11:117223102-117223124 GAGTGTTGGGGCGGGGAAGCAGG + Intronic
1089369191 11:117942102-117942124 AGGGCTTGGGGGAGGGAAGCTGG - Intergenic
1089887753 11:121844875-121844897 GGGAGTGGAGGGAGGGGAGAGGG - Intergenic
1090635089 11:128686129-128686151 GGGTGGTGAGGAAGTCAAGCAGG + Intergenic
1091169711 11:133509204-133509226 GGGGGTTGAGGGAGAGCATCAGG - Intronic
1091546483 12:1504612-1504634 GGGTGCCGAGGGAGGGCAGGCGG - Intergenic
1091590587 12:1840700-1840722 TGGTGTTGAGGCCAGGAAGCTGG - Intronic
1092010965 12:5112239-5112261 GGGTGGAAAGGGTGGGAAGCTGG + Intergenic
1092894685 12:13000572-13000594 GGGTGTCTGGGGAGGGAACCCGG + Intergenic
1094108751 12:26839168-26839190 GGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1094236862 12:28177903-28177925 ACGTGTTGAGGGAGGGAGGTGGG + Intronic
1094405396 12:30110819-30110841 AGGTGTGGAGGGAGAGACGCAGG - Intergenic
1094589790 12:31809431-31809453 GGAGGGTGAGGGAGGGAAGCAGG - Intergenic
1094641817 12:32283113-32283135 AGGTTTTCAGGGAGGGAAGATGG + Intronic
1095625520 12:44309545-44309567 AGGAGTTGAGGGAGGGAAGAAGG + Intronic
1096207776 12:49737865-49737887 TAGTGTTGAGAGACGGAAGCTGG - Intronic
1096218272 12:49810174-49810196 GGGGGTGGGGGGAGGGAAGGGGG + Intronic
1096498002 12:52049900-52049922 GGGGGTTGAGGGTGGAAATCGGG + Intronic
1096670810 12:53197330-53197352 GGGTGTCTAGGGAGAGATGCAGG + Intronic
1096777707 12:53974132-53974154 GGGTGGGGAGGGAGGGAAAAGGG + Intronic
1096782543 12:53999524-53999546 GGGCGGTGAGGGAGGGAGGGTGG - Intronic
1096864574 12:54554662-54554684 GTGGCTGGAGGGAGGGAAGCAGG + Intronic
1096994798 12:55831745-55831767 GTGTGTGGAGGGAGGGGTGCTGG - Intergenic
1097053373 12:56236754-56236776 GGGTGGGAACGGAGGGAAGCAGG + Intronic
1097158158 12:57027505-57027527 GTGAGTTAAGGGAAGGAAGCGGG + Intronic
1098454184 12:70653447-70653469 GGGTGTGGTAAGAGGGAAGCAGG + Intronic
1098889185 12:75991488-75991510 GGGAGTTGAGGGAGGGAGGTGGG - Intergenic
1099564382 12:84222978-84223000 GTGTGTCGAGGGAGGGATGGAGG - Intergenic
1100123299 12:91394289-91394311 GGATGCTGATGGAGGGAAACTGG + Intergenic
1100321038 12:93493226-93493248 GGGGGTCGGGGGAGGGAGGCAGG - Intronic
1100321636 12:93498772-93498794 GGGGGTCGGGGGAGGGAGGCAGG + Intronic
1101032205 12:100671663-100671685 TGGAGTTGAGGGCTGGAAGCAGG + Intergenic
1101327346 12:103727649-103727671 GGGAGTGGAGGGAGAGATGCTGG + Intronic
1101664112 12:106793930-106793952 TGGGGGTGGGGGAGGGAAGCAGG + Intronic
1101909288 12:108850174-108850196 GGGAGCTGGGGGAGGGAAGATGG + Intronic
1101909375 12:108850405-108850427 GGGAGATGGGGGAGGAAAGCTGG + Intronic
1101909439 12:108850582-108850604 GGGGATTTAGGGAGGGGAGCTGG + Intronic
1102046804 12:109834464-109834486 GGGGGGTGGGGGAGGGCAGCCGG + Intergenic
1102561043 12:113762526-113762548 GGGTGGGGAGGGAGGGGGGCCGG - Intergenic
1102567881 12:113808912-113808934 GGGTGTGGAGGGAGAGGAGGTGG + Intergenic
1102572130 12:113833303-113833325 GGCTGTGGAGGTGGGGAAGCAGG - Intronic
1102903986 12:116660715-116660737 AGGTGTGGAGGGAGAGACGCAGG + Intergenic
1103074460 12:117970769-117970791 GTGTGTTGAGGGAGAGCATCAGG - Intergenic
1103075005 12:117974910-117974932 GGGTGCGGAGAGAGGGCAGCAGG - Intergenic
1103415003 12:120737758-120737780 GGGTGTGGAGGGAGTGAGGCTGG + Intronic
1103527602 12:121578625-121578647 GGGTGGTGAGGGAGGAGGGCAGG - Intronic
1103557833 12:121776520-121776542 GGATGTTGTGGGAGGGAGGTGGG + Exonic
1103678748 12:122676968-122676990 AGGTGTGGAGGGAGGGGCGCGGG - Intergenic
1103926040 12:124423755-124423777 AGGTATTGAGGGAGGGGAACAGG - Intronic
1104036458 12:125100779-125100801 GAGTGTTGTGGGAGGGAGGCTGG - Intronic
1104273679 12:127305356-127305378 GGGAGGTGAGGGAGGGAGCCAGG + Intergenic
1104400113 12:128468241-128468263 GGGTGTGCAGGGAGGGCAGGGGG + Intronic
1104437872 12:128770123-128770145 GGCGGCTGAGGGAGGGGAGCTGG - Intergenic
1104737721 12:131148352-131148374 GAGAGTGGAGGGAGGGAGGCAGG - Intergenic
1104858803 12:131914181-131914203 GTGTGTAGAGGCATGGAAGCCGG + Intronic
1105530102 13:21211386-21211408 GTGTGTTGTGGGAGGGACCCAGG + Intergenic
1105896022 13:24718090-24718112 GGGGGTGGAGGGAGGGAGGAAGG + Intergenic
1106088333 13:26562741-26562763 GGGTGTTGAGGGAGGGAAGCTGG + Intronic
1106421686 13:29590681-29590703 GGGTGCTGGAGGAGGGATGCGGG - Intronic
1106665557 13:31847084-31847106 GGGTGGGGACCGAGGGAAGCGGG + Intergenic
1106835485 13:33630240-33630262 GGCTAATGAGGGAGGGACGCAGG - Intergenic
1107568353 13:41629900-41629922 GGGTGTTGAGGGATTAAAGAGGG - Intronic
1107795726 13:44049550-44049572 GGGTGCTGAGTGGAGGAAGCAGG + Intergenic
1107830212 13:44368390-44368412 GGGGGTTGAGGGGGGGTGGCGGG + Intergenic
1107907290 13:45072858-45072880 GCATGTTGGGGAAGGGAAGCAGG + Intergenic
1108326227 13:49334395-49334417 GGGAGCTGAGGAAAGGAAGCAGG - Intronic
1108518062 13:51221568-51221590 GGGTGAAGAGGGAGGCAAGTTGG - Intergenic
1109075639 13:57831845-57831867 GTGTGTTGATGTTGGGAAGCGGG + Intergenic
1109482590 13:62974991-62975013 ACGTGTTGTGGGAGGGATGCAGG - Intergenic
1110856167 13:80298921-80298943 TGGTATTGGGGGAGGGTAGCTGG + Intergenic
1111414948 13:87927734-87927756 AGAGGTTGAGGGAGGGAAGATGG + Intergenic
1111428385 13:88120155-88120177 GGGCAATGAGGGAGGGATGCAGG - Intergenic
1111433223 13:88172071-88172093 GGGTATTGGGGCAGGGAAGCAGG - Intergenic
1111736031 13:92140400-92140422 GGATGTTCAGTGAGGGAAGAGGG + Intronic
1112604271 13:100888754-100888776 GGCTGTTGACATAGGGAAGCTGG + Intergenic
1113336355 13:109379821-109379843 GGGTTTTGAGGCAGGAAAGTTGG + Intergenic
1113613138 13:111662015-111662037 GAGAGTTGAGAGAGGGGAGCTGG + Intronic
1113754804 13:112803892-112803914 GGGAGGTGAAGGAGGGAAGGAGG - Intronic
1113754839 13:112803992-112804014 GGGAGGTGAAGGAGGGAAGGAGG - Intronic
1113754859 13:112804053-112804075 GGGAGGTGAAGGAGGGAAGGAGG - Intronic
1113754896 13:112804149-112804171 GGGAGGTGAAGGAGGGAAGGAGG - Intronic
1113754915 13:112804202-112804224 GGGAGGTGAAGGAGGGAAGGAGG - Intronic
1113754932 13:112804245-112804267 GGGAGGTGAAGGAGGGAAGGAGG - Intronic
1113754955 13:112804306-112804328 GGGAGGTGAAGGAGGGAAGGAGG - Intronic
1113754975 13:112804358-112804380 GGGAGGTGAAGGAGGGAAGGAGG - Intronic
1113754998 13:112804419-112804441 GGGAGGTGAAGGAGGGAAGGAGG - Intronic
1114311104 14:21468051-21468073 GGGGGATGGGGGAGGGAAGATGG + Intronic
1114473181 14:22977745-22977767 GGGTAATGAGGGAGGGGAGGGGG + Intronic
1114846334 14:26327148-26327170 GAGTGATGAGTAAGGGAAGCTGG - Intergenic
1115016908 14:28628036-28628058 GGTTGTAGAGGGAGGGGAGGAGG + Intergenic
1116140178 14:40983389-40983411 GGGAGTTGAGAGTGGGAAGGAGG - Intergenic
1116400466 14:44500271-44500293 ACGTGTTGTGGGAGGGATGCAGG - Intergenic
1117030176 14:51660759-51660781 GAGTGCTGGGGGAGGGAGGCAGG + Intronic
1117302953 14:54446406-54446428 TGGTATTGAGGAAGGGAAGGGGG + Intergenic
1117528715 14:56637997-56638019 GGCTGGTGAGGGAGGGAGGAAGG + Intronic
1117735033 14:58760268-58760290 GGGAGTTCTGGGAGGGATGCTGG + Intergenic
1118187619 14:63551521-63551543 GGGGGAGGAGGGAGGGAAGAGGG - Intergenic
1118727358 14:68638582-68638604 GGGTGATGGGGGAGGGGAGCTGG + Intronic
1118796847 14:69152294-69152316 GGGTCTTGGGGCTGGGAAGCGGG - Intronic
1119419848 14:74502044-74502066 GGGTGCTTAGGGAGTGAAGAGGG - Intronic
1119850186 14:77861358-77861380 GTGGGTGGAGGGAGGGGAGCGGG + Intronic
1120152494 14:81052930-81052952 GGGGGCTGAGGGAGGGGAGAGGG + Intronic
1120687617 14:87556238-87556260 GGGGGTTGAGGGAGTGGAGAGGG + Intergenic
1120884453 14:89441083-89441105 GGTTGGGGAGGAAGGGAAGCCGG - Intronic
1121314419 14:92952669-92952691 GGGTGTTGTGGGAGGCAGGCGGG - Intronic
1121316558 14:92964403-92964425 GGGTGGGGAGGGAGGGGAGCTGG + Intronic
1121874087 14:97435034-97435056 GGATGGTGGGGGAGGGAGGCAGG + Intergenic
1121916006 14:97837424-97837446 GAGTGGAGAGGGAGGGCAGCAGG + Intergenic
1121928715 14:97952533-97952555 GGGTGGAGAGGGAGGGAAAGGGG - Intronic
1122082223 14:99273941-99273963 GGGTGTTGGGGGTGGGCAGCCGG - Intergenic
1122087594 14:99318293-99318315 GGATGGAGAGGCAGGGAAGCTGG + Intergenic
1122115028 14:99523309-99523331 AGCTTTTGAGGGAGGCAAGCAGG - Intronic
1122115268 14:99524335-99524357 GGATGTGGAGGAAGGGACGCCGG - Intronic
1122156545 14:99753535-99753557 GGGAGTAGAGGGAGTGAAGGAGG - Intronic
1122403343 14:101480727-101480749 GGGTGTTTATGAAGGAAAGCGGG + Intergenic
1122631385 14:103109213-103109235 GGGTGGAGAGGGAGGGAGGGAGG - Intronic
1122631399 14:103109250-103109272 GGGTGGAGAGGGAGGGAGGGAGG - Intronic
1122631413 14:103109287-103109309 GGGTGGAGAGGGAGGGAGGGAGG - Intronic
1122631427 14:103109323-103109345 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631441 14:103109359-103109381 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631455 14:103109395-103109417 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631469 14:103109431-103109453 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631483 14:103109467-103109489 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631497 14:103109503-103109525 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631511 14:103109540-103109562 GGGTGGAGAGGGAGGGAGGGAGG - Intronic
1122631525 14:103109576-103109598 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631539 14:103109612-103109634 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631553 14:103109648-103109670 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631568 14:103109685-103109707 GGGTGGAGAGGGAGGGAGGGAGG - Intronic
1122787829 14:104172076-104172098 GGACGATGAGGGAGGTAAGCAGG - Intronic
1122805418 14:104253927-104253949 GGGTGAGAAGGGAGGGGAGCAGG + Intergenic
1122815888 14:104313815-104313837 GGGTGTTGATGGATGCAACCAGG - Intergenic
1122861985 14:104586826-104586848 GGGTGTTGGAGGAGGGAAGAGGG + Intronic
1122967224 14:105137025-105137047 GGGGGTTGGGGGAAGGGAGCGGG - Intergenic
1123046256 14:105517661-105517683 ACGTGTTGTGGGAGGGAACCAGG + Intergenic
1124074499 15:26431888-26431910 GGGAGTTGGGGGAAGGAAGTGGG + Intergenic
1124223398 15:27869246-27869268 GGGTGCTGAGGGTGGGATGCTGG - Intronic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1124418165 15:29491243-29491265 AGGTGTGGAGGGAGGGGTGCGGG - Intronic
1124635029 15:31359931-31359953 TGGTCTTGGGGGAGGGAGGCAGG + Intronic
1124637594 15:31374855-31374877 GGGGGGTGGGGGAGGGAAGCGGG + Exonic
1125299945 15:38244718-38244740 GAGAGTTGAGGGCGGGAAGGCGG + Intergenic
1125513349 15:40304470-40304492 AGGTGTTCATGGAGGGAAGAAGG - Intronic
1125541072 15:40470663-40470685 GGGTCTGGAGGCAGGGAGGCGGG - Intergenic
1125574328 15:40745012-40745034 GGGTGATGAGCAAGGCAAGCGGG - Exonic
1125729443 15:41884740-41884762 GGGTGACGAGGTAGGGAAGGAGG - Intronic
1125765982 15:42136699-42136721 ACGTGTTGAGTGAGAGAAGCTGG + Intergenic
1126238771 15:46417110-46417132 GTGTGTTGAGGGAGGGACCTGGG + Intergenic
1126467910 15:48977242-48977264 GAGGGTGGAGGGTGGGAAGCTGG - Intergenic
1126604803 15:50465341-50465363 GGGTGGTGGGGGAGGGGAGGGGG + Intronic
1127381771 15:58436792-58436814 GGGTGTTGAAGGATGGTATCCGG + Intronic
1127465008 15:59235299-59235321 TTGTCTTGAGGGAGGGGAGCTGG - Intronic
1127658719 15:61080182-61080204 GGGTTTGGAGGTAGGGAAGTGGG - Intronic
1127873331 15:63091144-63091166 GGGTGGGGTGAGAGGGAAGCCGG - Intergenic
1128246149 15:66134214-66134236 GCCTGTTGTGGGAGGGAGGCTGG - Intronic
1128552275 15:68606031-68606053 GGGTTTTGAGGGTGAGCAGCTGG + Intronic
1128705936 15:69837532-69837554 GGGTGTGGGGGGAGGGAGGGAGG + Intergenic
1128794552 15:70455770-70455792 GGGGGGTGGGGGAGGGAAGTAGG - Intergenic
1128919074 15:71594035-71594057 GGGTGGTGAGGTGGGGCAGCTGG + Intronic
1129108439 15:73324032-73324054 GGGTGTTGGGGGAGGAGGGCAGG - Intronic
1129115922 15:73365458-73365480 GGGTGTGGGGATAGGGAAGCGGG - Intronic
1129118012 15:73376042-73376064 GGGGCTTGTGGGAGGGAGGCTGG - Intergenic
1129314412 15:74732520-74732542 GGGAGATGAGGGGAGGAAGCGGG + Intergenic
1129328247 15:74813191-74813213 GGGTGTTGAGGCGGTGGAGCAGG - Intronic
1129535944 15:76313814-76313836 GGGTGGGGAGGTAGGGAAGGAGG - Intergenic
1129698369 15:77753533-77753555 GGGGGTAGGGGGAGGGAAGTAGG + Intronic
1129874188 15:78961804-78961826 GGCTGGGGAGGGACGGAAGCAGG + Exonic
1130324945 15:82872326-82872348 GGGTGATGAGGGATGGAGGGTGG - Intronic
1130394792 15:83492707-83492729 GGGGATAGAGGGAAGGAAGCTGG - Intronic
1130736028 15:86549879-86549901 GGGAGTGGAGGGAGGGAGGGAGG + Intronic
1130970254 15:88726633-88726655 GGGGCATGGGGGAGGGAAGCAGG + Intergenic
1131493463 15:92882670-92882692 GGATGGTGGGGGAGGGGAGCGGG + Intergenic
1132098902 15:99008606-99008628 AGGTGTGGAGGGAGAGACGCGGG - Intergenic
1132589471 16:720439-720461 GAGTGTGGTGGGAGGAAAGCCGG - Intronic
1132622371 16:873925-873947 TGGTGCTCAGGGAGGGAGGCTGG + Intronic
1132789999 16:1680458-1680480 GGATGGTGAGGAAGGAAAGCCGG + Intronic
1132810011 16:1792938-1792960 GGGTGCTGCGGGAGGGGACCGGG + Intronic
1132903729 16:2271791-2271813 GTGTGTTGAGGAAGGAAGGCAGG + Intergenic
1133214797 16:4285398-4285420 GGGTGTTTCGAGTGGGAAGCAGG - Intergenic
1133219940 16:4315720-4315742 GAGGGGTGAGGGAGGGAAGTGGG - Intronic
1133814302 16:9184532-9184554 AGGTGTTGAGGGAGAGGCGCGGG - Intergenic
1134052483 16:11146498-11146520 GGATGTAGAGGGAGGGAGGGAGG + Intronic
1134551516 16:15141047-15141069 GGGTGCTCAGGGATGGAGGCCGG - Intergenic
1134633765 16:15776880-15776902 GGGTGATGGGAGAGGGCAGCTGG + Intronic
1134813784 16:17189176-17189198 TGGTGTTGAGAGAAGGAAGAAGG + Intronic
1135393852 16:22115949-22115971 GGGTGGGGAGGGAGGGAGGGAGG + Intronic
1135583679 16:23650427-23650449 GTGTGGGGAGGGAGGGAGGCAGG - Intronic
1136045904 16:27614777-27614799 GGGTCTAGAGAGAGGGAAGTCGG + Intronic
1136062336 16:27735228-27735250 GGGAACTGAGAGAGGGAAGCAGG - Intronic
1136269040 16:29137760-29137782 GGAAGATGAGGGAGGGAAGATGG - Intergenic
1136398694 16:30006370-30006392 GGGTGTTGAGGGCGGGCAAGTGG - Intronic
1136413714 16:30091396-30091418 GGGTGGGGAGGGAGGGGAGGAGG - Intronic
1136416431 16:30107048-30107070 GGGAGGAGAGGGAGGGAAACAGG - Intronic
1137063286 16:35811408-35811430 GGGTGTGAAGGCAGGGAAGTGGG + Intergenic
1137463993 16:48691435-48691457 GGGTGGTGGTGGGGGGAAGCAGG + Intergenic
1137556402 16:49473102-49473124 GGGTGATGGGGGAGGCAACCAGG + Intergenic
1137720727 16:50625909-50625931 GACTGTGGAGAGAGGGAAGCAGG - Intronic
1138069010 16:53971967-53971989 GAGTGGTGAAGGAGGGAAGGGGG - Intronic
1138436599 16:57004114-57004136 GGGACGTGAGGTAGGGAAGCAGG + Intronic
1138450984 16:57093210-57093232 GGGTGTTGAGGGGTGGGAGGAGG - Intronic
1139018983 16:62724861-62724883 AGGTGTGGAGGGAGAGACGCGGG + Intergenic
1139492674 16:67294850-67294872 TGGGGTTGAGGGAGTGAAGCAGG - Intronic
1140914621 16:79482969-79482991 GGGAGGGGAGGGAGGGAAGGAGG - Intergenic
1140914673 16:79483104-79483126 GGGAGGGGAGGGAGGGAAGTAGG - Intergenic
1140914716 16:79483205-79483227 GGGAGGGGAGGGAGGGAAGGAGG - Intergenic
1140919174 16:79520897-79520919 GGGTGTTGTAGGACGGAAGTAGG - Intergenic
1140948834 16:79796588-79796610 GGGAGGTGAGGGAGGGACCCTGG - Intergenic
1141155986 16:81597574-81597596 GGGAGGTGAGCGAGGGGAGCGGG + Intronic
1141466369 16:84208428-84208450 GGGTGTGGAGGGGAGGAAGAGGG + Intergenic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141539524 16:84708938-84708960 GGGTAGTGAGGGAGAGAAGCAGG + Intronic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1141693672 16:85610301-85610323 GGGAGTGGAGGGTGGGAAGGAGG + Intergenic
1141764110 16:86047320-86047342 GAGGGTTGAGGGAGGGAAGCTGG + Intergenic
1142271397 16:89091463-89091485 ATGTGGTGTGGGAGGGAAGCAGG + Intronic
1142376144 16:89708052-89708074 GGGTGCTGAGGGTGGGCAGGTGG + Intronic
1142567404 17:849614-849636 GGACGTGGAGGGAGGGAAGAGGG - Intronic
1142638663 17:1272320-1272342 GGGGGTTGAGTGAGGGCAGAGGG + Intergenic
1143078828 17:4366576-4366598 GCGGGTTGAAGGAGGGAAGCGGG - Intronic
1143332878 17:6150344-6150366 GGGTGTGGAGAGAGGGAGGGAGG + Intergenic
1143552711 17:7640887-7640909 AGGTGTGGAGGGAGAGACGCGGG + Intergenic
1143555218 17:7655663-7655685 GGGTGGTGAGCTAGGGAAGGAGG + Intronic
1143584366 17:7844038-7844060 GGGTCCTGAGGGAGGGAGGAGGG - Intronic
1144035932 17:11366083-11366105 GTGGTGTGAGGGAGGGAAGCTGG + Intronic
1144447506 17:15344566-15344588 GGGAGGGGAGGGAAGGAAGCAGG + Intergenic
1144577204 17:16436623-16436645 GCTTGTGGAGTGAGGGAAGCAGG + Intronic
1144761711 17:17710936-17710958 GGGTGTTGATGGGGGGCAGGTGG + Intronic
1145241630 17:21243697-21243719 GGGGGTGGAGGAGGGGAAGCCGG + Intronic
1145733276 17:27209912-27209934 GGGAGGGGAGGGAGGGAAGCAGG - Intergenic
1145735743 17:27230294-27230316 GGGGGTGGAGAGATGGAAGCAGG - Intergenic
1145813807 17:27781324-27781346 GGGTCTTGAGGGAGGGCAGCAGG - Intronic
1146737026 17:35247222-35247244 GGGTGTTGTCGTAGGGAAGTTGG - Intronic
1147258732 17:39196815-39196837 GGGTGTGGGGGGAGGGGAGCAGG + Intronic
1147267700 17:39244715-39244737 GGGTGTTGGTGGAGGGAGACTGG + Intergenic
1147388001 17:40092898-40092920 CGGTGATGGGGGAGGGAGGCAGG + Exonic
1147460026 17:40562457-40562479 GGATGTTGGGGGATGGAAGCAGG - Intronic
1147742081 17:42675499-42675521 GAGGGGGGAGGGAGGGAAGCAGG - Intronic
1147757738 17:42779958-42779980 GGGAGCTGAGGGGGGTAAGCCGG + Intergenic
1147882417 17:43662718-43662740 GGGGGATGAGAAAGGGAAGCAGG - Intergenic
1148063381 17:44851671-44851693 GGGGGTTGAGGGATGGCAACAGG + Intronic
1148135481 17:45289123-45289145 AGGTGCTGAGGGAGGGAGCCCGG + Intronic
1148157632 17:45432691-45432713 GGGGGTTGGGGGTGGGAAGTGGG - Intronic
1148865133 17:50624339-50624361 GCCTGTGGAGGGAGGGAAGCGGG - Exonic
1149338447 17:55662206-55662228 GGGAGTTGAGAGGAGGAAGCTGG - Intergenic
1149521107 17:57318888-57318910 AGCTGTTGAGGGAGAGAAGCAGG + Intronic
1150505155 17:65691160-65691182 AGGTGTTGGGGGAGAGGAGCCGG + Intronic
1150628610 17:66859846-66859868 GGGTGGAGAGGGAGAGAAGAGGG - Intronic
1150649438 17:67000372-67000394 GCCTGTGGAAGGAGGGAAGCTGG + Intronic
1150775787 17:68080647-68080669 AGGTGTAGAGGGAGAGACGCGGG + Intergenic
1150782315 17:68133840-68133862 AGGTGTTGGGGGGGGGAAGGTGG + Intergenic
1150863999 17:68830833-68830855 GGATGATCAGGGAGGGAAGGAGG - Intergenic
1151744047 17:76001959-76001981 GGGGATTGAGGTGGGGAAGCTGG + Intronic
1151854194 17:76710136-76710158 GGGGGGCGAGGGAGGAAAGCTGG - Intronic
1151999923 17:77638784-77638806 GGGTGGGGTGGGGGGGAAGCGGG + Intergenic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152352829 17:79792960-79792982 GCTTGTTGAGGGAGGGGCGCGGG - Exonic
1152423272 17:80205294-80205316 GCGTGGTGGGGGAGGGAAGGAGG - Intronic
1152693267 17:81731333-81731355 GGCTGGGGAGGGAGGGATGCGGG + Intergenic
1152790390 17:82275469-82275491 CGGTGACGAGGGAGGGATGCGGG + Intergenic
1152811329 17:82384143-82384165 GGGTGTGGGTGGAGGGTAGCAGG - Intergenic
1153434955 18:5059184-5059206 GTGTGGTGAGGCAGGGAAGGAGG - Intergenic
1153661747 18:7331908-7331930 GGGTGTGGAGGAAGGGGAGGGGG - Intergenic
1153794324 18:8609231-8609253 GGCGGAAGAGGGAGGGAAGCGGG + Intergenic
1154465817 18:14642139-14642161 GGGTGGTGAGGGGGGGAAAACGG - Intergenic
1154942987 18:21132826-21132848 AGGTGTGGAGGGAGAGGAGCGGG - Intergenic
1156455418 18:37290628-37290650 GATTGTGGTGGGAGGGAAGCAGG + Intronic
1156474582 18:37397552-37397574 GGGTGGGGAGGGATGGAGGCTGG + Intronic
1156478658 18:37422403-37422425 GTGTGCTGGGGGAGGGGAGCTGG - Intronic
1157130471 18:45002540-45002562 GGGTGTGGAGGGAGATAAGAAGG - Intronic
1157239674 18:45997632-45997654 GGGAGGGGAGGGAGGGAAGGGGG - Intronic
1157279743 18:46338524-46338546 GTGTGTTGAGGTGGGGAAGGGGG + Intronic
1157446417 18:47749595-47749617 TGGGGTTGATGGAGGGAAGGAGG + Intergenic
1157578381 18:48758909-48758931 GGGTGATGAAGGCGGGAAACAGG - Intronic
1157601642 18:48896794-48896816 GGGAGGTGAGCGTGGGAAGCCGG - Intergenic
1157615137 18:48982417-48982439 CGGTGGGGAGGAAGGGAAGCAGG - Intergenic
1157709118 18:49836716-49836738 GGGTGCTGAGGGAGGTACACAGG + Exonic
1157935219 18:51864740-51864762 GGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1158406575 18:57165412-57165434 GGGAGAAGAGGGAGGGAAGAAGG - Intergenic
1158531401 18:58265568-58265590 GGGAATTGAGGGAGGGAGACAGG + Intronic
1159042780 18:63340899-63340921 CTGTGTTGTGGGAGGCAAGCAGG - Intronic
1159109772 18:64042976-64042998 AGGTGTGGAGGGAGGGGTGCGGG + Intergenic
1160051841 18:75440966-75440988 GTGTGGTGAGGGAGGGATGGAGG + Intergenic
1160137617 18:76286025-76286047 GGGTGTGGAGGGTGGCATGCTGG - Intergenic
1160333461 18:78016330-78016352 AGGTGCTGAGGGAGGGAAAAGGG + Intergenic
1160686321 19:438621-438643 GGGTGCTGGGGGCGGGCAGCAGG - Intronic
1160709535 19:544721-544743 GGGAGATGAGGGAGGGAGGGAGG - Intronic
1160824793 19:1074567-1074589 GGGTGGGGAGGGATGGAGGCAGG - Intronic
1160879849 19:1314409-1314431 AGGGGTAGAGGGAGGGAGGCAGG + Intergenic
1161037843 19:2095542-2095564 GGGTCCTGCGGGAGGGCAGCGGG + Intronic
1161046337 19:2136755-2136777 AGGTGGTGAGCGAGGGAAGGGGG + Intronic
1161088079 19:2344219-2344241 GGGTGATGGGGCAGGGGAGCAGG - Intronic
1161099770 19:2415871-2415893 GGCTGGTGAGGAGGGGAAGCCGG - Intronic
1161426918 19:4208743-4208765 GGCTGGGGAGAGAGGGAAGCAGG - Exonic
1161526562 19:4759735-4759757 GGGAGCTGAGGGAGGGAGGGAGG + Intergenic
1161606032 19:5215464-5215486 AGGTGATGAGGGTGGGAGGCGGG + Intronic
1161773139 19:6242112-6242134 AGGTCTTGAGGCAGGGAGGCTGG - Intronic
1161777574 19:6271998-6272020 GGACGGAGAGGGAGGGAAGCCGG - Intronic
1161961950 19:7528055-7528077 GGGTGATGAGGGAGGGAGCCCGG + Intronic
1161972630 19:7591037-7591059 GTGTGCCGAGGGAGGGGAGCTGG - Intergenic
1162024719 19:7887533-7887555 GGGTGGGGAGGCAGAGAAGCTGG + Intergenic
1162325246 19:9995513-9995535 GGGTGTTGAGGGATGGATAAGGG + Intronic
1162561736 19:11421371-11421393 GAGTGATGAGGGGGTGAAGCTGG - Intronic
1162789875 19:13057291-13057313 GTGCTTGGAGGGAGGGAAGCAGG + Intronic
1163530315 19:17844877-17844899 AGGTGTTGGGGGCTGGAAGCAGG - Intronic
1163537898 19:17888231-17888253 GGCAGTTGGGGGAAGGAAGCAGG + Intronic
1163622139 19:18367419-18367441 GGGTGCTGAGGCAGGGAACAGGG + Exonic
1164149838 19:22541493-22541515 GAGTGTTGACGGTGGAAAGCAGG - Intergenic
1164588810 19:29494853-29494875 GGGTGAGGAGGGAGGGAGGGAGG + Intergenic
1164870736 19:31640680-31640702 GGCTCTGGAGGGAGGGAAGTGGG + Intergenic
1164989555 19:32674609-32674631 GGGTGATGAGGGCGCGGAGCGGG - Intronic
1165078910 19:33296700-33296722 GGCTGTGAGGGGAGGGAAGCTGG - Intergenic
1165353838 19:35291916-35291938 GGGTGTACAGGGATGGAAGATGG + Intergenic
1165386125 19:35511649-35511671 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1165390065 19:35533724-35533746 GGGTGTGGAGGGAGGGAGAGCGG - Intronic
1165706899 19:37982773-37982795 GGCTGTGGAGGGAGAGAGGCTGG + Intronic
1165903843 19:39181573-39181595 GGGAGTCCAGGGTGGGAAGCTGG - Intronic
1166220903 19:41363859-41363881 GCTTGCTGGGGGAGGGAAGCGGG - Intronic
1166231337 19:41427218-41427240 GGGTGTTGCGGGAGGCAGGCTGG - Intronic
1166352678 19:42207492-42207514 GGCTGCTGAGGGAGGGGAGGAGG - Intronic
1166862359 19:45817762-45817784 AGGTGATGAGGGAGGGCAGCTGG - Intronic
1166900364 19:46056900-46056922 GGGTGTATAGGGAGAGAAGAGGG - Intronic
1166948082 19:46409243-46409265 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1166995845 19:46719382-46719404 GGGTTTTGTGGTAGGGCAGCAGG - Intergenic
1167381047 19:49138313-49138335 AGGTGGTGAGGGAGGGGGGCAGG - Exonic
1167502088 19:49854197-49854219 GGGTCCTGAGGGTGGGCAGCGGG + Intronic
1167600403 19:50451457-50451479 GGGTGCTGAGGAAGGGAGGGAGG + Intronic
1167620110 19:50555918-50555940 GGGTGGAGAGGGATTGAAGCCGG + Intronic
1168075477 19:53978865-53978887 GGGTAGGGAGGGAGGGAAGGAGG + Intronic
1168102366 19:54148086-54148108 GGGTGGTGAGGGAGACCAGCTGG + Intronic
1168240064 19:55084400-55084422 GGGTCCTGGGGGAGGGAAGGAGG + Intronic
1168474673 19:56667316-56667338 TGGTGCTGAGAGAGGGAAGGAGG + Intronic
1168530217 19:57121093-57121115 GGGAGGTGAGGGAGCGGAGCGGG - Intronic
1202702955 1_KI270713v1_random:2048-2070 GGATGTTGAGAAAGGGAAGATGG + Intergenic
1202711836 1_KI270714v1_random:23251-23273 TGGTGGCGAGGGAGGGGAGCAGG - Intergenic
925172644 2:1759681-1759703 GGGTGTGGAGGGAGAGGCGCAGG - Intergenic
925277769 2:2662568-2662590 GGCTGTTGAGGCTGGGAGGCTGG - Intergenic
925348924 2:3187994-3188016 GGCTGTTGGGAGAGGCAAGCAGG - Intergenic
925657907 2:6169065-6169087 GGGGAGTGAGGGAGGGAGGCAGG - Intergenic
925667578 2:6277084-6277106 GGGGGGTGAGGGAGGGCAGGGGG + Intergenic
925907421 2:8547726-8547748 GGGTGTTGGAGGAGGGCACCAGG - Intergenic
926666098 2:15524926-15524948 GTGGGTTGAGGGAAGGAAACAGG - Intronic
926754321 2:16223392-16223414 TGGTGTTGGGGGAGGGAGGCTGG - Intergenic
927182096 2:20453971-20453993 GGGGGTCGGGGGAGGGAAGGAGG - Intergenic
927603302 2:24463409-24463431 GGCTGTTTAGGGAGCTAAGCTGG - Intergenic
927694729 2:25232074-25232096 GGGTGGGGAGTGGGGGAAGCAGG - Exonic
927851534 2:26503121-26503143 GGATGCTGGGGGAGGGCAGCCGG + Intronic
928105596 2:28468732-28468754 GGGGGAGGAGGGAGGGAAGGGGG + Intronic
928678837 2:33678299-33678321 GGGAGTTGACGGAGGAAAGAAGG + Intergenic
928736045 2:34290024-34290046 GGGTGTTGAGGGAAGGAATTTGG + Intergenic
929121347 2:38486664-38486686 GGGAGTTGAGGGAGGGAATATGG - Intergenic
929641537 2:43584984-43585006 GGTTGCTGAGTGAGGGAAGAAGG - Intronic
929694510 2:44102675-44102697 GGGTGTTGAGGGTAGGGGGCTGG - Intergenic
929765867 2:44843717-44843739 GGGTGGTGAGGGAGGACAGTGGG + Intergenic
930088770 2:47516961-47516983 GGGTGGAGAGGGAGGGAGGGAGG - Exonic
930194075 2:48491297-48491319 GGGTGTTGGGGGAGGGCTGTGGG + Intronic
931667196 2:64617886-64617908 GGGTGGGGAGGGGAGGAAGCTGG + Intergenic
931834296 2:66082679-66082701 GGATGTAGAGGGAGTGAAGAGGG + Intergenic
931842921 2:66173438-66173460 GGGTGAGGTGGGAGGGAAGGGGG + Intergenic
932029857 2:68172280-68172302 GGGTTTTTAGGGAGGCAAGAGGG + Intronic
932221577 2:70003656-70003678 GGGTGTTGAGAGAGCCCAGCCGG + Intergenic
932492688 2:72132009-72132031 GGGAGTGGCTGGAGGGAAGCTGG + Exonic
933206497 2:79513240-79513262 AGGTGGGGAGGGAGGGAGGCAGG - Intronic
933367185 2:81367741-81367763 ACGTGTTGAGGGAGGGACCCGGG - Intergenic
933557221 2:83846024-83846046 GGGTGTTGGGTGAAGGTAGCTGG - Intergenic
933658277 2:84906368-84906390 GGCTGTGGAGAGCGGGAAGCGGG - Exonic
934529582 2:95076748-95076770 GGGTGTTCCGGGAGGGAGGGAGG - Intergenic
934880447 2:97972449-97972471 GGGAGGGGAGGGAGGGAAGGCGG + Intronic
934926163 2:98383098-98383120 GGAATTTGAGGCAGGGAAGCTGG + Intronic
935554076 2:104488071-104488093 GGCTGTTGAGGCAGGGAGACTGG + Intergenic
935622984 2:105144620-105144642 GGGAGGTGAGGCAGGGGAGCTGG - Intergenic
936079090 2:109419967-109419989 GGGAGAGGCGGGAGGGAAGCAGG + Intronic
936115650 2:109700897-109700919 AGGTGATGTGGGAGGAAAGCGGG + Intergenic
937219412 2:120333186-120333208 GGGTGTTGATGAAGAGAAGAGGG - Intergenic
937400836 2:121582224-121582246 GGGAGCAGAGGGAGGGAAGGAGG + Intronic
937914123 2:127090589-127090611 AGGTGATGAGGGTGGGAGGCGGG - Intronic
938097463 2:128473110-128473132 GGGGATGGAAGGAGGGAAGCGGG - Intergenic
938265213 2:129923381-129923403 GGGTGGTAGGGGAGGGGAGCAGG + Intergenic
940291879 2:152085150-152085172 GGGAGTGGAGGGATGAAAGCAGG + Intronic
941827604 2:169917305-169917327 GGGTGAAGAAGGAGGGAAGCAGG - Intronic
943082814 2:183276898-183276920 GGGTGGTAAGGGAGGGAGGGAGG - Intergenic
943365252 2:186962258-186962280 AGGTGTGGAGGGAGAGACGCCGG + Intergenic
943725270 2:191245851-191245873 GGGGGTGGCGGGAGGGAAGAAGG + Intronic
943896779 2:193372877-193372899 AGGTGGTGTGGGAGGGAAGTTGG - Intergenic
943992881 2:194720125-194720147 AGGAGTTGAGGGTGGGAAGAAGG + Intergenic
944361749 2:198865332-198865354 GGGTGGGCAGGGAGGGCAGCTGG - Intergenic
944590451 2:201212287-201212309 TGATGTTGAGGGGTGGAAGCGGG + Intronic
944663074 2:201937410-201937432 GGCTGATGAGGAAAGGAAGCTGG - Intergenic
945047058 2:205790812-205790834 GGGCGTTGAGGTGGGGAGGCTGG + Intronic
945906295 2:215597307-215597329 GGGTGTGGAGGAAGGGCAGAGGG - Intergenic
945975154 2:216264633-216264655 GGGTGTGGAGAGAGAGAAGTGGG + Intronic
946109737 2:217404111-217404133 GGGAGGGGAGGGAGGGAAGAAGG - Intronic
946268468 2:218568888-218568910 GGGTGCTGAAGGGGGGACGCGGG + Exonic
946410015 2:219511106-219511128 GGGTGCAGGGGGAGGGAGGCTGG + Intergenic
947232475 2:227902219-227902241 GGGTGATGAGGCAGGGAAGCAGG + Intronic
947387731 2:229608710-229608732 GGGTAGAGAGGGAGGGAAGTGGG + Intronic
947594060 2:231399871-231399893 GGGTGCTGAGGGCAGGCAGCTGG - Exonic
947817683 2:233048941-233048963 GGGAGGTGAGGTAGGGAAGCGGG + Intergenic
948434202 2:237941962-237941984 GGCTGTTGACCTAGGGAAGCTGG + Intergenic
948456458 2:238106719-238106741 GGGTCCTGAGGGAGGGAAACAGG + Intronic
948607209 2:239143755-239143777 GGCTGTTGACCTAGGGAAGCCGG - Intronic
948716614 2:239869542-239869564 GGGGGTTGAGGGGGTGAAGGTGG - Intergenic
948800178 2:240429923-240429945 GAGTGTCCAGGGAGGGAAGGAGG - Intergenic
948912619 2:241011970-241011992 GGGTGGGGAGAGAGGAAAGCTGG + Intronic
948915701 2:241034215-241034237 GGGTGTGGAGGGAATGAAACAGG + Intronic
949012669 2:241690123-241690145 GGGTGAAGATGGAGGGAATCTGG + Intergenic
949033731 2:241807368-241807390 GCGTGAGGGGGGAGGGAAGCTGG - Intergenic
949037619 2:241824448-241824470 GGGGTTTGCAGGAGGGAAGCTGG - Intergenic
1168840552 20:907340-907362 GGCTGCAGAGGGAGGGGAGCAGG + Intronic
1168856034 20:1009776-1009798 GGTTGGTGAGGGAGGGGCGCTGG - Intergenic
1168984651 20:2037861-2037883 GGGTCTGGAAGGAGGGATGCAGG - Intergenic
1169091118 20:2861989-2862011 GGGTGTTGAGGCAGGGCTGAGGG + Intronic
1169224701 20:3848703-3848725 GGGTTGTCAGGGAGGGAAGGAGG - Intronic
1169516861 20:6326219-6326241 GGGTGTGGAGGGAGGGAAGGTGG + Intergenic
1169836413 20:9884527-9884549 GGGGCTTGAGGGATGGAAGATGG + Intergenic
1170106780 20:12759900-12759922 ACGTGTTGTGGGAGGGAACCAGG - Intergenic
1170119256 20:12894124-12894146 GAGTGCTGAGGGTGGGAAGTGGG - Intergenic
1170177673 20:13490665-13490687 GAGGGGTGAGGGAGGGAAGGAGG - Intronic
1170276250 20:14593382-14593404 GTGAGGTGAGGGAGGGAAGAAGG + Intronic
1170593362 20:17787620-17787642 GGGTGTGGAGGGAGGCAAGCAGG - Intergenic
1171534408 20:25873487-25873509 ATGTGTTCAGGGAGGGAACCAGG + Intergenic
1172010478 20:31843272-31843294 GGGAGAGGAGGGAGGGATGCTGG - Intergenic
1172281705 20:33712403-33712425 TGGTGTGGGGGGAGGGGAGCAGG - Intronic
1172783732 20:37452227-37452249 GGGTGGGGAGGTGGGGAAGCTGG - Intergenic
1172890565 20:38260876-38260898 GGGGGTGGACGGAGGGAAGGGGG - Intronic
1172919801 20:38472036-38472058 GGGTATTGAGAGAGGGAGGAGGG - Intergenic
1172940705 20:38652338-38652360 GTGGGATGAGGGAGGGAAGAGGG - Intergenic
1172993558 20:39053311-39053333 GGGAGTTGAGGGAGAGAAAATGG + Intergenic
1173178594 20:40784267-40784289 TGGTGAAGAGGGAGGGATGCAGG - Intergenic
1173225975 20:41162735-41162757 AGGGGTTGAGGGAGGGCAGGTGG - Intronic
1173756546 20:45521729-45521751 GGGTGGGGAGGGAGGGAAAGAGG - Intergenic
1174393671 20:50233317-50233339 GGGTGTTGGGGGCAGGGAGCAGG + Intergenic
1174817285 20:53697702-53697724 GGGAGAGGAGGGAGGGAAGGAGG + Intergenic
1175160758 20:57005891-57005913 AGGAGGTGAGGGAGGGAGGCCGG - Intergenic
1175202577 20:57288236-57288258 AGGTCTTGGGGGAGGCAAGCAGG - Intergenic
1175218167 20:57402367-57402389 GAGAATTGAGGGATGGAAGCAGG + Intronic
1175221620 20:57420663-57420685 GGGTGCTGGGGGCGGGAAACTGG + Intergenic
1175413238 20:58785129-58785151 GGGTTTTGGGGGAGGAAAGCGGG + Intergenic
1175830595 20:61963317-61963339 CGGGATTGAGAGAGGGAAGCAGG - Intronic
1175831628 20:61967756-61967778 GGGTGAAGGGGGAGGGGAGCAGG - Intronic
1176297983 21:5084576-5084598 GGGTGGCGAGGGGGGGCAGCAGG + Intergenic
1176304920 21:5118303-5118325 AGGTGTGGAGGGAGAGCAGCCGG - Intronic
1176960598 21:15154753-15154775 GTGTGTTGGGGGAGGGGAGGTGG + Intergenic
1177017771 21:15813964-15813986 GTGTGTTGTGGGAGGGACCCAGG + Intronic
1177085003 21:16692844-16692866 GGCTGTTGAGGGAGGTAGGCTGG + Intergenic
1177182431 21:17757957-17757979 AGGTGTGGAGGGAGGGGCGCAGG - Intergenic
1177736204 21:25092919-25092941 GGGGGAAGAGGGAGGGAAGAGGG - Intergenic
1178538990 21:33433597-33433619 GGTGGTGGAGGGAGGGAAGTGGG + Intronic
1179559906 21:42208974-42208996 GGGTTCTGGGGGAGGGAGGCAGG + Intronic
1179682348 21:43032305-43032327 GGGTGGTGAGGGAAGGAGGAAGG - Exonic
1179711905 21:43268316-43268338 GGCTGGTGGGGGAGGGAAGCAGG + Intergenic
1179852134 21:44143727-44143749 AGGTGTGGAGGGAGAGCAGCCGG + Intronic
1179859046 21:44177373-44177395 GGGTGGCGAGGGGGGGCAGCAGG - Intergenic
1180231300 21:46428311-46428333 TGGTTTTGAGGGCGGGCAGCAGG + Intronic
1180735025 22:18010028-18010050 GGGAGGGGAGGGAGGGAAGCAGG + Intronic
1181034087 22:20161616-20161638 GGGGGCTGGGGGAGGGAAGGGGG + Intergenic
1181373080 22:22433084-22433106 GGGTGTTGGGGGAGGGAATGAGG - Intergenic
1181461594 22:23089085-23089107 AGGTGAGGAGGGAGGGAGGCAGG + Intronic
1181509265 22:23381785-23381807 GGGGGCTGAGGGAGGGAAGGGGG - Intergenic
1181671920 22:24429574-24429596 GGCTTCTGAGGGAGGGGAGCTGG + Intronic
1181795043 22:25302068-25302090 GGGAGCTGAGGGAGGGTAGAAGG - Intergenic
1181835615 22:25605732-25605754 GGGAGCTGAGGGAGGGTAGAAGG - Intronic
1181851452 22:25752821-25752843 AGGTGTGGAGGGAGGGACGCAGG + Intronic
1181981191 22:26767822-26767844 GGATATTCAGGGAGGGAATCTGG + Intergenic
1182070722 22:27461902-27461924 GGATGTTGAGGCAGAGATGCAGG + Intergenic
1182147964 22:28008824-28008846 TGCTGCTGAGGGAGGGACGCTGG + Intronic
1182262291 22:29082579-29082601 GTCTGTTGAAAGAGGGAAGCTGG - Intronic
1182474561 22:30569588-30569610 GGGTCTTGGGGGAGGGAAAGAGG + Intronic
1182911319 22:33987024-33987046 GGGTGGGGAGGGAGGAATGCGGG + Intergenic
1183466514 22:37983054-37983076 GGCTTTGGAGGGAGGGAAGGAGG - Intronic
1183550426 22:38479797-38479819 GGGTCTGGAGGGAAGGATGCAGG - Intronic
1183619126 22:38962385-38962407 GGGAGAGGAGGGAGGGATGCGGG - Intronic
1183624326 22:38992321-38992343 GGGAGAGGAGGGAGGGATGCGGG - Intronic
1183698772 22:39438103-39438125 GAGTGAGGAGGGAGGGAAGGGGG - Intergenic
1183880870 22:40827741-40827763 GGAGGTTGAGGGAGGCAGGCAGG - Intronic
1183927616 22:41217213-41217235 TGGAGCTGAGGGAGGGAGGCCGG + Intronic
1183953500 22:41365897-41365919 GGGTCATTAGGGAGGGAAGGAGG + Intergenic
1183958936 22:41399260-41399282 TGATGTGGTGGGAGGGAAGCCGG + Exonic
1184533749 22:45072565-45072587 GGGGATGGAGGGAAGGAAGCAGG - Intergenic
1184561901 22:45268522-45268544 GGGTGAGGGGTGAGGGAAGCGGG - Intergenic
1184835652 22:47019557-47019579 GGGTGTGCAGGGAGGGAGGATGG + Intronic
1184878279 22:47289176-47289198 GGGTGGTGAGGGAAGGTAGGGGG + Intergenic
1184979344 22:48085017-48085039 AGGTGCTGAGGGAGGGAGCCAGG + Intergenic
1185147969 22:49149658-49149680 GGGAGGTGAGGGAGGGAGGGAGG + Intergenic
1185151615 22:49167146-49167168 AGGGGTGGAGGGAGGGAAGAAGG - Intergenic
1185203522 22:49523188-49523210 GGGTGTGGAGGGAGGGGATTGGG + Intronic
1185229168 22:49670568-49670590 AGGTGTGGAGGGAGGGGCGCGGG - Intergenic
1185377689 22:50489667-50489689 GGGTGTTGTGGGAGTGAAAGAGG + Intronic
949382827 3:3465011-3465033 GGGAGATGGGGGAGGGAAGAGGG + Intergenic
949753354 3:7379909-7379931 GGGTGATGATGAAGGGAAGGCGG - Intronic
950221294 3:11198293-11198315 GGGGGATGGGGGATGGAAGCTGG - Intronic
950249431 3:11452025-11452047 GGGGGTTGTGGGAGGGAAATAGG + Intronic
951720544 3:25693205-25693227 GTGGGAGGAGGGAGGGAAGCAGG - Intergenic
953389966 3:42528220-42528242 GGGTGGGGTGGGAGGGAAGAGGG - Intronic
953406907 3:42664212-42664234 GGGGGTTGGGGGTGGGCAGCAGG - Intronic
953905427 3:46866108-46866130 GGGGGTGGAGGGAGGGAGGGTGG + Intronic
954365792 3:50145351-50145373 GGCAGTCCAGGGAGGGAAGCTGG + Intergenic
954382875 3:50228912-50228934 ACCTGTTGCGGGAGGGAAGCTGG - Intronic
954632001 3:52052794-52052816 GGGAATAGAGAGAGGGAAGCAGG - Intronic
954638043 3:52082167-52082189 GGGTGAGGAGGGAAGGAAGAGGG + Intronic
955500748 3:59580258-59580280 GGGTGATGGGGGAGGCAAGTGGG - Intergenic
955618381 3:60833784-60833806 GGGTGGAGTGGGAGGGAAGTGGG - Intronic
955765684 3:62341943-62341965 GGGTGGTGAGGTAAGGGAGCTGG + Intergenic
956195704 3:66651561-66651583 GGGTGTGGAGGGAGAGGCGCGGG + Intergenic
956359746 3:68435095-68435117 GGGTGTTAAATGATGGAAGCAGG + Intronic
956457589 3:69438689-69438711 AGCAGTTGAGGGAGGGATGCTGG + Intronic
956642816 3:71430808-71430830 GGCTGTTGGGGGAGGGGAGGCGG + Intronic
956750342 3:72339946-72339968 GGGTGAGGGGGGAGGGGAGCTGG + Intergenic
957199330 3:77112240-77112262 GGGGGTGGAGGGGGGGACGCAGG + Intronic
958269713 3:91484555-91484577 GGGAGCTGAGGGAGGGGAGCAGG - Intergenic
959006836 3:101029135-101029157 GAGTGTGGAGGGTGGGAAGAGGG - Intergenic
959418769 3:106108896-106108918 GGGGGTTGGGGGAGAGATGCAGG - Intergenic
959753129 3:109862302-109862324 GGGAGGTGAGGGAGAGAAGAGGG + Intergenic
959945682 3:112123341-112123363 GGTTGTTGTGGGAGATAAGCTGG + Exonic
960052663 3:113252832-113252854 GAGTGCTCAGGGAGGGAGGCAGG + Intronic
960785111 3:121363573-121363595 GGGTGCTCAGGGAGGGAGGGAGG - Intronic
961529093 3:127528939-127528961 GGGTCTGGAGGCAGGGCAGCTGG - Intergenic
961566793 3:127769804-127769826 GGGTGTTGTGGGGTGGAGGCAGG - Intronic
961961821 3:130863653-130863675 AGGTGTTGTGGGAGGGACCCAGG + Intronic
962235028 3:133700240-133700262 GGGTTGTCAGGGAGGGCAGCAGG + Intergenic
963372838 3:144423360-144423382 GGATTTTGGAGGAGGGAAGCAGG + Intergenic
964824257 3:160808329-160808351 GTGTGGTGGGTGAGGGAAGCTGG + Intronic
964824267 3:160808419-160808441 GTGTGGTGGGTGAGGGAAGCTGG + Intronic
964868446 3:161287548-161287570 GAGGGTGGAGGGTGGGAAGCAGG + Intergenic
964932962 3:162048171-162048193 TAGTGTTGGGAGAGGGAAGCTGG + Intergenic
965050726 3:163643508-163643530 TGGGGTTGAGGGAGGGAGGAGGG + Intergenic
965138187 3:164801598-164801620 AGGTGTTGTGGGAGGGACCCAGG - Intergenic
965162523 3:165152588-165152610 GCCTGTTGAGGGAGGGCAGGGGG - Intergenic
965419212 3:168436402-168436424 GTGTGTTGAGGGAGGAAGGAGGG - Intergenic
965500151 3:169446251-169446273 ACGTGTTGTGGGAGGGAACCAGG + Intronic
965637429 3:170797858-170797880 ACGTGTTGAGGGAGGGACCCAGG - Intronic
965726201 3:171719238-171719260 GGGTGATGAGGCAGGGATGGTGG - Intronic
965911432 3:173782204-173782226 GGGTGTTGAAAGAGCTAAGCAGG + Intronic
966091030 3:176136551-176136573 GGGGGTGGAGGGTGGGAAGGTGG - Intergenic
966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG + Intronic
966929283 3:184665292-184665314 GGGAGTTTAGGGAGGGACCCGGG + Intronic
966934474 3:184696904-184696926 GGGACTTGGGGGAGGGGAGCTGG - Intergenic
967221202 3:187249515-187249537 GGGTGTTGAGGGGTGGTTGCAGG + Intronic
967226907 3:187300906-187300928 GGGTGTTGGGGGAGGTAATGTGG - Intergenic
967417903 3:189239368-189239390 ATGTGTTGTGGGAGGGAACCAGG - Intronic
967440499 3:189502312-189502334 GGGTGTTGAGGGACTTAGGCTGG + Intergenic
968815087 4:2817951-2817973 AGGTGTTGGGGGAGTGGAGCGGG + Intronic
968887300 4:3341532-3341554 GGGTGTGGGGGGAGGGAGGGTGG + Intronic
968887348 4:3341656-3341678 GGGTGTGGGGGGAGGGGAGATGG + Intronic
968890356 4:3365392-3365414 AGGTCTTGAGGGAGGGAGGAGGG + Intronic
968904120 4:3443836-3443858 AGGTGTTGAGTGGGGGACGCTGG + Intronic
968976418 4:3824469-3824491 GAGTGCTGAGGGAGGTGAGCTGG - Intergenic
969295926 4:6270458-6270480 AGGTGTTGTGGGGGGGAAGGGGG + Intronic
969339553 4:6531500-6531522 GGGACTTGAGGGAGCAAAGCGGG + Intronic
969695318 4:8730925-8730947 GTGTGGGGAGGGAGGGAACCTGG + Intergenic
970108571 4:12612169-12612191 GGGTGTGGGGGGAGAGTAGCAGG + Intergenic
970415751 4:15855257-15855279 GGCTGGTGAGGAAGGAAAGCAGG - Intergenic
970444520 4:16112703-16112725 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444529 4:16112724-16112746 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444538 4:16112745-16112767 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970569058 4:17361779-17361801 GGGAGAAGAGGGAGGGAAGTGGG - Intergenic
971138546 4:23898197-23898219 GGGTGTGGAGGGAGGAAAAAAGG + Intronic
971158573 4:24109394-24109416 GGGGGTTGTGGGTGGGAAGGAGG + Intergenic
971904644 4:32710687-32710709 GGGGGTTGGGGGAGGGAGGAGGG + Intergenic
972279115 4:37585635-37585657 AGGTGTTGAGGGAGGGGAGGAGG + Intronic
972335673 4:38105582-38105604 GGGTGGAGAGGGAGGGAGGAAGG - Intronic
972358455 4:38304062-38304084 GGGTGGAGAGGGAGGGAAATGGG + Intergenic
972602107 4:40581944-40581966 GGGTGCAGAGGAGGGGAAGCGGG - Intronic
975033927 4:69658293-69658315 AGGTGTGGAGGGAGAGGAGCAGG - Intergenic
975985400 4:80197556-80197578 GGGGGTGGAGGGAGGGAGGGAGG - Intronic
976070665 4:81236279-81236301 GGGTGTTGAGGGGAGGACGTCGG - Intergenic
976286641 4:83376963-83376985 AGGTGTTGTGGGAGGGACCCAGG - Intergenic
977114430 4:93005087-93005109 GGGTGTTGAATGAGTGAATCTGG - Intronic
977401273 4:96535246-96535268 GGGTGTGGAGGGAGAGGATCAGG + Intergenic
977574506 4:98661795-98661817 GGGTGTTGAGGGAATAAAGAAGG - Intergenic
977997951 4:103517591-103517613 GGGAGGAGAGGGAGGGAGGCAGG - Intergenic
978514566 4:109557399-109557421 GGAGGTTGAGGGAGAGACGCGGG + Intergenic
978839026 4:113187276-113187298 GGGAGTTAGAGGAGGGAAGCAGG + Intronic
979780910 4:124650734-124650756 AGGTGTGGAGGGAGAGACGCGGG + Intergenic
980288516 4:130813176-130813198 CGGGGTTGAGGGAGGGAGGAGGG - Intergenic
982169082 4:152643912-152643934 GGGAGAGGAGGGAGGGAAGGAGG - Intronic
982700684 4:158657481-158657503 AGGTGTGGAGGGAGAGATGCGGG + Intergenic
982750706 4:159157903-159157925 GAAGGTTGAGGTAGGGAAGCTGG + Intronic
984017239 4:174441212-174441234 AGGTGTTGCGGGAGGGACCCGGG - Intergenic
984522309 4:180816719-180816741 GGGTGTTCCGGGAGGGTGGCAGG - Intergenic
984932655 4:184860682-184860704 TGATGATGAGGGAGGGATGCAGG - Intergenic
985518595 5:359614-359636 GGGTGATGAGTGAAGGGAGCAGG - Intronic
985968002 5:3352262-3352284 GTGGGTTGAGGGAGGGGGGCAGG + Intergenic
986357795 5:6945612-6945634 GAGTGATGAGGGAGGGCAGGAGG - Intergenic
986452711 5:7882105-7882127 GGGCATGGAGGGATGGAAGCAGG + Intronic
986452977 5:7884663-7884685 GGGTGTGGAGGGTAGGAAGGGGG - Intronic
986650889 5:9962347-9962369 ATGTGTTGAGGGAGGAAAGGAGG - Intergenic
986859094 5:11904777-11904799 GTGGGTTGGGGGAGGGAGGCTGG + Intergenic
987338708 5:16920501-16920523 GGGGTTAGAGGGAGGGAGGCTGG + Intronic
987806485 5:22775834-22775856 GTGTGTTGTGGGAGGGACCCAGG + Intronic
988182580 5:27816490-27816512 GGGGGTTCAGGGGGGGAAGGGGG - Intergenic
988535409 5:32063508-32063530 GGGTGTGGAGGTTGTGAAGCAGG + Intronic
988902210 5:35745551-35745573 AGGTGCTGAGGCAGGGAAGTGGG - Intronic
990749758 5:59001613-59001635 GGGAGTTGAGGGAGAGTAGTAGG - Intronic
991457607 5:66821749-66821771 GGGTGTTGAGGAGGGGCTGCTGG + Intronic
991607380 5:68416583-68416605 AGGAATTGTGGGAGGGAAGCAGG + Intergenic
992116170 5:73540486-73540508 GAGTGTTGAGGGAGGGAGAGAGG + Intergenic
992550505 5:77855370-77855392 GGGGGTTGAGGGTGGGAGGTGGG - Intronic
992619303 5:78576525-78576547 GGCAGTGGAGGGAGGGAAACTGG + Intronic
992882890 5:81128128-81128150 TGGTGGGGAGGAAGGGAAGCGGG + Intronic
994920259 5:106033504-106033526 AAGTGTTGTGGGAGGGAAACAGG - Intergenic
994953662 5:106498734-106498756 AAGTGTAGAGGAAGGGAAGCAGG - Intergenic
994956107 5:106535169-106535191 GGGAGTGGAGGGTGGGAAGAGGG - Intergenic
995126935 5:108586885-108586907 GGGTGGGGAGAGAGGGAAGGGGG + Intergenic
995410627 5:111853225-111853247 GGGTTAGGAGGTAGGGAAGCAGG + Intronic
996460018 5:123731510-123731532 AGGTGTTGTGGGAGGGACCCAGG + Intergenic
997270731 5:132535599-132535621 GGGTGTTGAGGGAGGGTTGTGGG - Intergenic
997365523 5:133322863-133322885 TGGGGTTGACTGAGGGAAGCTGG + Intronic
997622481 5:135307841-135307863 GGCAGTGGAGGGAGGGAAGGAGG - Intronic
997713717 5:136027416-136027438 GGGGCTTGAGTGAGGGACGCGGG - Intergenic
997818606 5:137042289-137042311 GGGTTTTGAGGTAGGGAAAAAGG + Intronic
997870634 5:137502493-137502515 GGGTTTTGGGGGAGAGAAGAGGG - Intronic
998165198 5:139838739-139838761 GGGTGGTGCAGGAGGGCAGCAGG - Exonic
998261756 5:140637066-140637088 TGGTGTTGAGGGAAGGATGCTGG + Intergenic
998352066 5:141508303-141508325 GGGTGTAGAGGGAGGGGCACTGG + Intronic
998388840 5:141774050-141774072 GGGTGTTGATGGAGGCAGGGGGG - Intergenic
998820747 5:146055753-146055775 GTGTGCTGAGGGAAGGAAGGGGG - Intronic
999205857 5:149847425-149847447 GGGTGAAGAGGCAGGGAAGAGGG - Intronic
999486555 5:152002878-152002900 GGGGGTAGAGGGAGGGAAGGGGG - Intergenic
999809541 5:155114833-155114855 AGGTGTGGAGGGAGAGATGCAGG + Intergenic
1000211162 5:159106998-159107020 TGGCCATGAGGGAGGGAAGCTGG - Intergenic
1000225041 5:159252619-159252641 GGGAGTTGAGGAGAGGAAGCAGG - Intergenic
1000304423 5:159982769-159982791 TGTTGCGGAGGGAGGGAAGCAGG - Intergenic
1000357929 5:160418890-160418912 AGGTGTTGAGGGAGCGAGGACGG - Intronic
1000629377 5:163574322-163574344 GGGAATGGAGGGAGGGAAGAAGG - Intergenic
1000725995 5:164771619-164771641 GGGTGAAGATGGAGGGGAGCAGG - Intergenic
1000774789 5:165406309-165406331 GAGGGTGGAGGGAGGGAAGGGGG - Intergenic
1001089465 5:168726534-168726556 GGGAGGGGAGGGAGGGAGGCAGG + Intronic
1001352405 5:170981456-170981478 ACGTGTTGTGGGAGGGAAGCAGG + Intronic
1001879625 5:175232110-175232132 GGGAGGTGAGGCAGGGAAGTAGG - Intergenic
1001919376 5:175588522-175588544 GGGAGGAGAGGGAGGGAAGAAGG + Intergenic
1001934527 5:175694832-175694854 GAGTGTTGGGGGTAGGAAGCAGG + Intergenic
1002079083 5:176727172-176727194 GGGTGTTGAGAGAGAGAAGGTGG - Intergenic
1002400501 5:178989201-178989223 GGGTGGTGAGGGTGGGGAGGGGG - Intronic
1002858594 6:1059404-1059426 GGGGCTTGGGGGAGGGGAGCGGG + Intergenic
1003116708 6:3288265-3288287 GGGTGTTTGGGGAGAGAAGGGGG - Intronic
1003318499 6:5032877-5032899 GGGTGTGGAGGGACGGGAGGCGG - Intergenic
1003387518 6:5683012-5683034 ACGTGTTCAGAGAGGGAAGCAGG + Intronic
1003773641 6:9335745-9335767 GGGAGGGTAGGGAGGGAAGCAGG - Intergenic
1004068217 6:12272298-12272320 GTGTGATGAGGCAGAGAAGCTGG + Intergenic
1004396292 6:15248673-15248695 GGGGGCGGAGGGAGGGAAGAAGG - Intronic
1004483259 6:16040686-16040708 AGGTGTGGAGGGAGAGACGCAGG - Intergenic
1005958254 6:30679445-30679467 GGGGGTTGAGGGAGAGAAAGCGG + Intronic
1006025777 6:31145735-31145757 GGTTGTTGAGGCTGGGAAGCTGG + Exonic
1006061686 6:31425358-31425380 TGGGGTTGGGGGAGGGAAGAGGG - Intergenic
1006409674 6:33865427-33865449 TGGTGTGGAGGGATGGAACCAGG - Intergenic
1006413231 6:33887857-33887879 GGGTCTGGAGGGAGGGAAAGGGG + Intergenic
1006513272 6:34532947-34532969 GGTGGTGGAGGAAGGGAAGCAGG - Exonic
1006636943 6:35467979-35468001 AGGTGCTGAGGGAGGGAGGTCGG + Intergenic
1006945051 6:37779320-37779342 GGGTGGAGGGGGAGGGAAGAAGG + Intergenic
1007178694 6:39913280-39913302 ATGGGTTGAGGGAGGGAAGAAGG - Intronic
1007408631 6:41648960-41648982 GGGAGAGGAGGGAGGGAAGAAGG - Intronic
1007473857 6:42106688-42106710 GGGTGCTGGGGGAGGGAGGGGGG + Exonic
1007681322 6:43635699-43635721 GGGTGTTAAAGGAGGAACGCAGG + Intronic
1007716870 6:43861835-43861857 GGGTGTTGGGGGGAGGGAGCAGG + Intergenic
1007742552 6:44021749-44021771 TGGTGCTGGGGGAGGGAAGGGGG - Intergenic
1007743123 6:44024968-44024990 TGGTGCTGGGGGAGGGAAGGGGG - Intergenic
1007784103 6:44270555-44270577 GGGGGCTGAGGGTGGGAGGCAGG - Exonic
1008318126 6:50072123-50072145 GGGTAGTGAGGGAGGGGAGGAGG + Intergenic
1008434621 6:51461122-51461144 GGGTGGTGAAGGAGTGAAGAGGG - Intergenic
1008471454 6:51889632-51889654 GGGTGATGAGGAAGGGATGAGGG + Intronic
1008717770 6:54310013-54310035 AGGTGTGGAGGGAGGGAAGAAGG - Intronic
1008985444 6:57536817-57536839 GGGAGCTGAGGGAGGGGAGCAGG + Intronic
1009173476 6:60429765-60429787 GGGAGCTGAGGGAGGGGAGCAGG + Intergenic
1009380676 6:63024952-63024974 GGGGGTTGTGGGAAGAAAGCAGG + Intergenic
1010132454 6:72510270-72510292 GGGTGTTGGGGGAGGTATACAGG - Intergenic
1010139689 6:72600254-72600276 GGGTGTTGGGGAAGTGAAGATGG - Intergenic
1010141550 6:72620433-72620455 GGGGAAGGAGGGAGGGAAGCAGG + Intergenic
1010686527 6:78859937-78859959 GTGTGTGGAGGTAGGGAAGGCGG - Intergenic
1012273656 6:97245038-97245060 GGCTGTTGAGGGAGCATAGCGGG - Intronic
1012833619 6:104237638-104237660 GGATGGTGGGGGGGGGAAGCAGG - Intergenic
1013580390 6:111528589-111528611 GGGGGTTCAGGGAGGGAATATGG - Intergenic
1013605824 6:111746812-111746834 GAGGGTAGAGGGAGGGAGGCAGG + Intronic
1014088416 6:117373655-117373677 AGGTGTGGAGGGAGAGACGCAGG - Intronic
1014330365 6:120056197-120056219 GGGGGTTGAGGGATGGGGGCGGG - Intergenic
1015645204 6:135379920-135379942 GGGAGTTGGGGGAGGGAGGGAGG - Intronic
1016427045 6:143945864-143945886 GGGGGCTGAGGCAGGGAAGGCGG + Intronic
1017121460 6:151028100-151028122 CTGGGTTGAGGCAGGGAAGCAGG + Intronic
1017694420 6:157000195-157000217 GGCTGGAGAGGGAGGGAACCAGG + Intronic
1017759369 6:157556254-157556276 GGGGGTGGAGGGTGGGAAGGGGG + Intronic
1017835499 6:158173794-158173816 GAGTGGGGAGGGTGGGAAGCAGG + Intronic
1017963922 6:159247219-159247241 GGGTGGGGAGGGAGGGAACGGGG - Intronic
1018212268 6:161493647-161493669 GGCCGATGAGGGAGGGACGCTGG + Intronic
1018242736 6:161794439-161794461 GGGGGTCCAGGGAGGGAAGAGGG - Intronic
1018333032 6:162753240-162753262 GGGTGGAGAGGGAGGGAATGAGG - Intronic
1018570433 6:165204137-165204159 ATGTGTTGAGGGAGGGAGGGAGG - Intergenic
1018769343 6:166957416-166957438 GGGTGTTGGGGGAGGAGACCGGG - Intergenic
1018946313 6:168348759-168348781 GGGTCTGGAGAGAGGGATGCAGG + Intergenic
1018987693 6:168650018-168650040 TGGTGTTGAGGGAAGGATGGAGG + Intronic
1019224276 6:170497296-170497318 AGATGTTGAGGCAGGAAAGCAGG + Intergenic
1019269780 7:140372-140394 GGGTGCTGAGCATGGGAAGCAGG + Intergenic
1019618612 7:1978597-1978619 GGGTGTGGGGTGGGGGAAGCTGG - Intronic
1019626552 7:2018809-2018831 GGGGGCGGAGGGAGGGAGGCAGG - Intronic
1019796027 7:3049376-3049398 GAGGGTTGGGGGAGGGAAGTGGG - Intergenic
1020156778 7:5732035-5732057 GGCTGTGGTGGTAGGGAAGCGGG - Intronic
1020283511 7:6663708-6663730 GGGAGGTGAAGGAGGGGAGCAGG + Intergenic
1020906492 7:14070071-14070093 AGGTGTTGTGGGAAGGAACCAGG + Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021133839 7:16942980-16943002 AGGTGTGGAGGGAGAGGAGCTGG + Intergenic
1021513481 7:21458780-21458802 GTGTGTGGGGGGAGGGGAGCGGG - Intronic
1021783544 7:24130247-24130269 GGGTGATCAGGGAGGCAAGAAGG - Intergenic
1021857606 7:24872486-24872508 TGGTGTTGGGGGAAGGAAGTTGG + Intronic
1022327782 7:29347630-29347652 ACGTGTTGAGGGAGGGACCCCGG - Intronic
1023362736 7:39432610-39432632 GGATGTTGGTGGAGGGAAGGAGG + Intronic
1023505874 7:40899228-40899250 TGGTGAGGAGGGAGGGAAGGAGG - Intergenic
1023607476 7:41943351-41943373 GAGTGTGGAGGGAGGGAAGGAGG + Intergenic
1023732629 7:43206629-43206651 GGGAGGTGGGGGAGGGAAGCTGG - Intronic
1023789048 7:43737531-43737553 GGGGGTTGGGGGAGGAAAGGGGG - Intergenic
1023847953 7:44133572-44133594 GGGTGTTGGGGCAGGGATGGAGG + Intergenic
1024036358 7:45510429-45510451 GGGTGCTGTGGGAGAAAAGCAGG + Intergenic
1024368569 7:48552947-48552969 GGGTGTGTAGGGAGGGAAGTGGG - Intronic
1024518865 7:50285154-50285176 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1024593242 7:50908375-50908397 GAGGGTTGAGGGTGGGAAGAGGG + Intergenic
1024973149 7:55088832-55088854 GGGAGATGAGGCAGGGAGGCTGG - Intronic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1026204679 7:68246509-68246531 TGGTGTTGTGGGAGGAAGGCAGG + Intergenic
1026562837 7:71464551-71464573 TTGTGCTGAGGGAGGGAAGATGG - Intronic
1027443477 7:78245698-78245720 AGGTGTTGATGGGGGGATGCTGG - Intronic
1028011070 7:85645184-85645206 ACGTGTTGTGGGAGGGAACCAGG + Intergenic
1028793813 7:94881879-94881901 TAGTGTTGAGAGACGGAAGCTGG - Intergenic
1029372055 7:100156554-100156576 GAGTGGTGAGAGAGGGATGCTGG + Intronic
1029412820 7:100426791-100426813 GGGGGAGGAGGGAGGGAAGAGGG - Intronic
1029415924 7:100443198-100443220 GGGTGTGGAGGCACGGAAGATGG + Intergenic
1029449528 7:100633154-100633176 GGGTCTCGAAGGAGGGACGCGGG - Intronic
1029536392 7:101160200-101160222 GGGGGTAAAGGGAGTGAAGCCGG - Intronic
1029610784 7:101625519-101625541 AGGCGTTGGGGGAGGGGAGCAGG - Intronic
1029792590 7:102860506-102860528 GGGAGTAGTGGGAGGGAAGATGG + Intronic
1030523902 7:110630559-110630581 GGGTGTTGGGTTAGGGCAGCTGG + Intergenic
1031893715 7:127324222-127324244 TGGTGTCCAGGGAGGGAATCTGG + Intergenic
1033220610 7:139524291-139524313 GGGTGGGGTGGGAGGGAACCGGG + Intronic
1033400613 7:141020310-141020332 GGGGGTGGAGGGAGGGAGGAAGG + Intergenic
1033735298 7:144215697-144215719 AGGTGTTGTGGGAGGGACCCAGG + Intergenic
1033747757 7:144335272-144335294 AGGTGTTGTGGGAGGGACCCAGG - Intergenic
1034204948 7:149307255-149307277 GAGGGTGGAGGGAGGGAAGAGGG + Intergenic
1034258017 7:149735019-149735041 GGGTGTTTAGAGAGGTAATCAGG - Intergenic
1034341847 7:150362193-150362215 GGGGGATAAGGGTGGGAAGCAGG + Intergenic
1035028986 7:155845053-155845075 GGGAGGTGAGGAAGGGAAGCAGG - Intergenic
1035178914 7:157075242-157075264 GGGGGTACAGGGAGGGAAGGAGG - Intergenic
1035295642 7:157865551-157865573 GGGGGTTGGGGGAAGGAAGGCGG + Intronic
1035309299 7:157955006-157955028 GGGTAGTGTGGGAGTGAAGCGGG + Intronic
1036827195 8:11986707-11986729 GGGTATTGGGGGATGGGAGCGGG - Intergenic
1037320179 8:17634077-17634099 GGTTGTTGAGGGAGGGCCACTGG - Exonic
1037943830 8:22974159-22974181 GGGTATGGAGGGAGGAAAGCCGG + Intronic
1038196657 8:25374240-25374262 GGGGGGTCAGGCAGGGAAGCAGG + Intronic
1038746918 8:30262691-30262713 GGGTGATGAGGGATGTGAGCTGG + Intergenic
1039953691 8:42191324-42191346 GGGTCATCAGGGAGGGAGGCAGG - Intronic
1040295115 8:46145050-46145072 GGGTGGAGTGGGAGGGACGCAGG - Intergenic
1040299234 8:46179417-46179439 GGGTGTCGTGGGCAGGAAGCAGG - Intergenic
1040299991 8:46183021-46183043 GGGTGGTGTGGGAGGGCGGCAGG - Intergenic
1040300615 8:46186154-46186176 GGATGTTGAGGGAGGCAAAGGGG - Intergenic
1040312649 8:46244667-46244689 GGGTGTGGTGAGCGGGAAGCAGG + Intergenic
1040335618 8:46414514-46414536 GGATGTTGAGGCAGGGAAAGAGG + Intergenic
1040335986 8:46416230-46416252 GGATGTTGAGGCAGGGAAAGTGG + Intergenic
1040340320 8:46437278-46437300 GGATGTTGAGGCAGGGAAAAGGG - Intergenic
1040342232 8:46446876-46446898 GGGTGATGAGGGCGGGCTGCAGG - Intergenic
1040434950 8:47381169-47381191 GGGTACAGAGGGAGGGAAGGAGG - Intronic
1040866336 8:52052298-52052320 GGGTGGGGAGGGAAGGAAGGGGG - Intergenic
1041668911 8:60473344-60473366 AGGTGGTGAGGAATGGAAGCAGG - Intergenic
1041775140 8:61514961-61514983 GGGTGGACAGGGAGGGAAGGAGG + Intronic
1042040349 8:64582131-64582153 GGGTGGGGAGGGAGGGAGGAGGG + Exonic
1042208550 8:66353508-66353530 GGGAGTGGAGGGATGGAATCGGG + Intergenic
1042432672 8:68726854-68726876 GTGTGTTGTGGGAGGGACCCGGG - Intronic
1042529713 8:69802634-69802656 GGGAGTTGAGGGAGGGAGAGTGG - Intronic
1042854050 8:73247184-73247206 GGGTGTGGAGGGTGGGAGGTGGG - Intronic
1043102262 8:76060775-76060797 AGGTGTGGAGGGAGGGGCGCGGG - Intergenic
1043520736 8:81042650-81042672 GGGGGGTGAGGAAGGGAAGGAGG + Intronic
1043693397 8:83186501-83186523 GGGGGTGGAGGGTGGGAAGAAGG + Intergenic
1044441609 8:92230780-92230802 GGGTGTGGAGGGAGAGGGGCGGG + Intergenic
1044591769 8:93919482-93919504 GGGGGGGGAGGGAGGGCAGCGGG - Intronic
1045175639 8:99721740-99721762 GGGTTTTGACGCAGGGAAGTAGG - Intronic
1045491319 8:102671393-102671415 GGGTGGGGTGGGAGGGAACCTGG - Intergenic
1045758865 8:105579460-105579482 GGGAGTTGAGAGGTGGAAGCAGG + Intronic
1045998884 8:108395951-108395973 GGGGGGTGAGGGATGGAAGTGGG + Intronic
1046816653 8:118591882-118591904 GGGTATTTTGGGAGGGAAGAAGG + Intronic
1047072220 8:121357906-121357928 GGGTGCTTAGGGATGGAAGTTGG - Intergenic
1048027095 8:130597025-130597047 GGCAGTTGTGGGCGGGAAGCTGG - Intergenic
1048216424 8:132499684-132499706 GGGAGTTAAGGCAGGGAAGGGGG - Intergenic
1048332483 8:133480104-133480126 GGATGGGGAAGGAGGGAAGCTGG + Intronic
1048380418 8:133860486-133860508 GGGTGGTGAGGGAGAGAGGGAGG - Intergenic
1048860735 8:138722890-138722912 GGGTGTGGAGGGAGGTGTGCAGG + Intronic
1049021334 8:139959564-139959586 GGGTGTTGGTGGTGGGAAGGTGG - Intronic
1049245976 8:141562700-141562722 GGGTGAAGAGGGTGGCAAGCAGG + Intergenic
1049509636 8:143021034-143021056 GGGTGGAGAGGGAGTGGAGCAGG - Intronic
1049533842 8:143169038-143169060 TGGGGTTGGGGGAGGGAAGAGGG - Intergenic
1050091075 9:2016679-2016701 GGGTGGCGAGGGCGGGAGGCGGG + Intronic
1050503964 9:6328318-6328340 GGGTGGTGGGGGTGGGGAGCCGG - Intergenic
1050891972 9:10835958-10835980 AGGTGTTGGGGGAGTGATGCGGG + Intergenic
1051170942 9:14317007-14317029 TGGTGAGGAGGGAGGGAAGAAGG - Intronic
1051214587 9:14782473-14782495 GGGCATTGACGGAGGGAAGCAGG + Intronic
1051449444 9:17178754-17178776 AGGTGTGGAGGGAGAGACGCTGG - Intronic
1051534943 9:18146544-18146566 AGGTTTTGAGGGAGGGAACAGGG + Intergenic
1051847982 9:21474367-21474389 TGGTGGGGAGGGAGGGAAGGTGG - Intergenic
1052122754 9:24738518-24738540 AGGTGTGGAGGGAGAGACGCGGG + Intergenic
1052855565 9:33404221-33404243 GGTTGGTGAGGGAGGGAATTGGG + Intergenic
1053123937 9:35564469-35564491 GGGGGTTGAGGGAAGGAAACAGG + Intergenic
1053369462 9:37548609-37548631 GGGTAGAGAGGGAGGGAAGGAGG - Intronic
1053447894 9:38166996-38167018 AGGTGTTGAAGAAGGGAAGGAGG - Intergenic
1055023249 9:71692436-71692458 GGGAGTTGCATGAGGGAAGCAGG - Intronic
1056262018 9:84858421-84858443 GGGGGTTGGGGGAGGGAAATGGG - Intronic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1056714719 9:89019915-89019937 CGGTTTTCAGGGAGAGAAGCTGG + Intronic
1057273861 9:93665878-93665900 GGGTGTTGGGGGAGGGGTGTGGG + Intronic
1057279367 9:93698877-93698899 AGGTGTGGAGGGAGGGAGGGAGG + Intergenic
1058140006 9:101347584-101347606 GGGAGTAGGGGGAGGTAAGCTGG - Intergenic
1058790140 9:108436272-108436294 GGGTGTTGAGGGTGGGAAATTGG - Intergenic
1059082881 9:111268722-111268744 TGGTCTAGAGGGAGAGAAGCAGG - Intergenic
1059379738 9:113913722-113913744 TGGTCTTGAGGGAGGGAGGGTGG + Intronic
1060124060 9:121024338-121024360 GGGAGGGGAGGGAGGGGAGCGGG + Intronic
1060176260 9:121499550-121499572 GGGTGGTGAGGGAGTGGAGGCGG - Intergenic
1060308305 9:122435848-122435870 ACGTGTTGTGGGAGGGAACCAGG + Intergenic
1060731422 9:126039434-126039456 GGGTGTTCAGGGTAGGGAGCGGG - Intergenic
1060949086 9:127589367-127589389 GGGGGGTGAAGGAGGGCAGCTGG + Intergenic
1061187182 9:129061353-129061375 AGGTGTGGAGGGAGGGAGGGAGG + Intronic
1061238188 9:129354014-129354036 GGGTCTTGAAGGAGGGGAGTTGG + Intergenic
1061246077 9:129401825-129401847 GGGAGATGAGGGAGGGAAGGTGG - Intergenic
1061294100 9:129667609-129667631 GGGTGAGGAGGGAAGGAAGGGGG + Intronic
1061754775 9:132804723-132804745 GGACATAGAGGGAGGGAAGCGGG - Intronic
1062269037 9:135700356-135700378 GGGGGATGACGGAGGGAAGGGGG + Intergenic
1062339266 9:136086721-136086743 GGGGGTCGTGGGAGGGAAACGGG - Intronic
1062613688 9:137386772-137386794 GGGTGCTGAGGGAGGCAGGCAGG - Intronic
1062613706 9:137386830-137386852 GGGTGCTGAGGGAGGCAGGCAGG - Intronic
1062613737 9:137386917-137386939 GGGTGCTGAGGGAGGCAGGCAGG - Intronic
1062613746 9:137386946-137386968 GGGTGCTGAGGGAGGCAGGCAGG - Intronic
1062613755 9:137386975-137386997 GGGTGCTGAGGGAGGCAGGCAGG - Intronic
1062613776 9:137387033-137387055 GGGTGCTGAGGGAGGCAGGCAGG - Intronic
1062623966 9:137434710-137434732 GGAGGTTGGGGGAGGGACGCCGG + Exonic
1062708775 9:137960320-137960342 GGGTGGCGAGGTAGGGGAGCGGG + Intronic
1185778378 X:2824418-2824440 GGGTGTTGGGGAGGGGTAGCTGG - Intergenic
1185852367 X:3501004-3501026 GGAGGTTGAGGTAGGGGAGCAGG + Intergenic
1186020644 X:5251309-5251331 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297990 X:8169860-8169882 GTGTGGTGAGGGAGGGAGGGAGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186612313 X:11149457-11149479 GTGTGTTGGGGGAGGGGGGCAGG + Intronic
1186974749 X:14889591-14889613 GGGGGTTGGGGGAGAGAGGCAGG - Intronic
1187882876 X:23862855-23862877 GGGAGGGGAGGGAGGGATGCAGG + Intronic
1187988548 X:24842980-24843002 GTGTATTGGGGGAGGGAGGCAGG - Intronic
1188807983 X:34614871-34614893 AGGTGTTGAGGGAGGGTGGGAGG - Intergenic
1188870390 X:35364669-35364691 TGGTGTTGGGGGATGGGAGCAGG - Intergenic
1189036183 X:37495709-37495731 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1189037691 X:37509251-37509273 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1189249861 X:39592335-39592357 GGGTGAGGAGAGAGGGATGCTGG + Intergenic
1189467156 X:41286078-41286100 AGGTGTGGAGGGAGAGACGCGGG - Intergenic
1190055066 X:47176493-47176515 GGATGTTGAGGGAGTGCTGCGGG - Exonic
1190448115 X:50551202-50551224 TGATGTTGAGGGTGGGAGGCAGG - Intergenic
1190580932 X:51892974-51892996 GTGTGTTGGGGGAGGAAAGGAGG - Intronic
1190984773 X:55490184-55490206 GGGAGTTGACGGAGGGAGGGAGG + Intergenic
1191704212 X:64076535-64076557 GGGTGTTGAGGGTGGGGAGGTGG + Intergenic
1192656014 X:72995674-72995696 GGGTGTTGGGGGAGTGAGGTGGG + Intergenic
1193203057 X:78714999-78715021 GGCTGTTGAGGGAGCACAGCGGG + Intergenic
1193549403 X:82872033-82872055 GGGTGTTGGAGGATGGAAGCAGG + Intergenic
1193570442 X:83134963-83134985 GAGTGTGGAGGGAGGGAGGAGGG + Intergenic
1193998985 X:88403496-88403518 GGGTGTGGAGGGTGGGAGGTGGG - Intergenic
1194433182 X:93837140-93837162 GGGTGTGGAGGGTGGGAGGAGGG - Intergenic
1194548779 X:95271697-95271719 GCCTGTTGAGGGAGGGAACCTGG - Intergenic
1194598700 X:95892569-95892591 GTGTGTTGGGGGAGGAAGGCGGG + Intergenic
1194758405 X:97765014-97765036 GTATGTTTAAGGAGGGAAGCTGG + Intergenic
1195325118 X:103752182-103752204 GTGGGATGAGGGAGGGAGGCAGG + Intergenic
1196645850 X:118116816-118116838 GGCTGCTGAGGGAGGGGGGCGGG + Intronic
1196829274 X:119763527-119763549 GGGTGCTGAGGGAGCGCAGGAGG + Intergenic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1197731101 X:129810785-129810807 AGGTGTAGAGGCAGGGAAGCTGG + Intronic
1198631356 X:138642209-138642231 AGAGGGTGAGGGAGGGAAGCAGG + Intronic
1199298662 X:146187363-146187385 TGGGGTGGAGGGAGGGAAGGGGG - Intergenic
1199325613 X:146494457-146494479 AGGTGTTGTGGGAGGGACCCAGG + Intergenic
1199895817 X:152127290-152127312 GGGTATGGAGAGAGGGAAGAGGG - Intergenic
1200205404 X:154312000-154312022 TGGTGTGGAGGGAGGCCAGCTGG - Intronic
1200686212 Y:6262734-6262756 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1200831884 Y:7693362-7693384 GTGTGTCCAGGGAGGGAACCTGG + Intergenic
1200989094 Y:9333650-9333672 GTGTGTCCAGGGAGGGAACCCGG - Intergenic
1200991751 Y:9353980-9354002 GTGTGTCCAGGGAGGGAACCCGG - Intergenic
1200994405 Y:9374260-9374282 GTGTGTCCAGGGAGGGAACCCGG - Intronic
1200997068 Y:9394606-9394628 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1200999584 Y:9463144-9463166 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1201002242 Y:9483452-9483474 GTGTGTCCAGGGAGGGAACCCGG - Intronic
1201004901 Y:9503739-9503761 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1201007559 Y:9524066-9524088 GTGTGTCCAGGGAGGGAACCCGG - Intergenic
1201010190 Y:9544256-9544278 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1201018464 Y:9626973-9626995 GTGTGTCCAGGGAGGGAAACTGG + Intergenic
1201291560 Y:12425312-12425334 GGGTGTTGGGGAGGGGTAGCTGG + Intergenic
1201691804 Y:16775157-16775179 GGGGGTTGAGGGAAGGAGGTGGG - Intergenic
1202115011 Y:21464337-21464359 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1202119242 Y:21507662-21507684 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1202121694 Y:21531202-21531224 GTGTGTCCAGGGAGGGAACCTGG - Intronic
1202157311 Y:21898180-21898202 GTGTGTCCAGGGAGGGAACCTGG + Intronic
1202159758 Y:21921721-21921743 GTGTGTCCAGGGAGGGAACCTGG + Intergenic