ID: 1106094616

View in Genome Browser
Species Human (GRCh38)
Location 13:26632209-26632231
Sequence TTGAATAAGCATGGTGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20273
Summary {0: 1, 1: 32, 2: 741, 3: 11832, 4: 7667}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106094612_1106094616 3 Left 1106094612 13:26632183-26632205 CCCTGGCCAGAACTTCGAATACT 0: 11
1: 2123
2: 10971
3: 3761
4: 1313
Right 1106094616 13:26632209-26632231 TTGAATAAGCATGGTGAGAGAGG 0: 1
1: 32
2: 741
3: 11832
4: 7667
1106094614_1106094616 -3 Left 1106094614 13:26632189-26632211 CCAGAACTTCGAATACTATGTTG 0: 12
1: 2075
2: 11111
3: 4346
4: 1714
Right 1106094616 13:26632209-26632231 TTGAATAAGCATGGTGAGAGAGG 0: 1
1: 32
2: 741
3: 11832
4: 7667
1106094609_1106094616 30 Left 1106094609 13:26632156-26632178 CCTTTATTTGTTTCTCTTGCCTG 0: 32
1: 2560
2: 4702
3: 6111
4: 6617
Right 1106094616 13:26632209-26632231 TTGAATAAGCATGGTGAGAGAGG 0: 1
1: 32
2: 741
3: 11832
4: 7667
1106094613_1106094616 2 Left 1106094613 13:26632184-26632206 CCTGGCCAGAACTTCGAATACTA 0: 9
1: 1995
2: 10830
3: 4160
4: 1474
Right 1106094616 13:26632209-26632231 TTGAATAAGCATGGTGAGAGAGG 0: 1
1: 32
2: 741
3: 11832
4: 7667
1106094611_1106094616 11 Left 1106094611 13:26632175-26632197 CCTGATTGCCCTGGCCAGAACTT 0: 6624
1: 7821
2: 3183
3: 2190
4: 2951
Right 1106094616 13:26632209-26632231 TTGAATAAGCATGGTGAGAGAGG 0: 1
1: 32
2: 741
3: 11832
4: 7667

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106094616 Original CRISPR TTGAATAAGCATGGTGAGAG AGG Intronic
Too many off-targets to display for this crispr