ID: 1106095398

View in Genome Browser
Species Human (GRCh38)
Location 13:26638981-26639003
Sequence GTGGAAAATAGGAGGACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 299}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106095398_1106095406 10 Left 1106095398 13:26638981-26639003 CCCACTGTCCTCCTATTTTCCAC 0: 1
1: 0
2: 1
3: 22
4: 299
Right 1106095406 13:26639014-26639036 AGCAGCCTGAGGCCCTTACCAGG 0: 1
1: 5
2: 26
3: 124
4: 287
1106095398_1106095405 -1 Left 1106095398 13:26638981-26639003 CCCACTGTCCTCCTATTTTCCAC 0: 1
1: 0
2: 1
3: 22
4: 299
Right 1106095405 13:26639003-26639025 CCATGAGTGGAAGCAGCCTGAGG 0: 158
1: 289
2: 500
3: 1083
4: 2885
1106095398_1106095408 16 Left 1106095398 13:26638981-26639003 CCCACTGTCCTCCTATTTTCCAC 0: 1
1: 0
2: 1
3: 22
4: 299
Right 1106095408 13:26639020-26639042 CTGAGGCCCTTACCAGGTGCAGG 0: 1
1: 0
2: 9
3: 51
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106095398 Original CRISPR GTGGAAAATAGGAGGACAGT GGG (reversed) Intronic
900333383 1:2148361-2148383 GTGGACAATAGGTGGATAGATGG - Intronic
900894940 1:5476822-5476844 ATGGAAAATAGGAGGCCAGAGGG + Intergenic
902458274 1:16552302-16552324 GTGGGGAAGAGGAGGACAGGAGG - Intergenic
902475806 1:16686526-16686548 GTGGGGAAGAGGAGGACAGGAGG - Intergenic
902493887 1:16855614-16855636 GTGGGGAAGAGGAGGACAGGAGG + Intronic
902949793 1:19873388-19873410 GTGGAAAAAATGAGAGCAGTTGG - Intergenic
903151460 1:21413062-21413084 GTGGGGAAGAGGAGGACAGGAGG - Intergenic
903169748 1:21545006-21545028 CTGGGAAACAGTAGGACAGTGGG - Intronic
903809454 1:26027097-26027119 GTGGAGAATGGGAGCTCAGTGGG - Intronic
905036963 1:34924925-34924947 GTGGAAAGGCGGAGGGCAGTGGG - Intronic
906295017 1:44644386-44644408 CTGGAAGATAGGTGGACAGCAGG + Intronic
906667188 1:47630316-47630338 GGGGAAAACAGGAGCATAGTGGG + Intergenic
907942173 1:59098857-59098879 ATGGAAAGTAGAATGACAGTGGG + Intergenic
908795709 1:67829091-67829113 GTGGAAAATAGGGGAAAAGCAGG + Intronic
910163059 1:84294445-84294467 GAGGAAAAAGGGAGGACAGCAGG - Intergenic
912157643 1:106941875-106941897 GTGGGAAAGAGGAAGAAAGTGGG + Intergenic
912299431 1:108499204-108499226 ATAGAAAATAGGAGGGCAGCAGG + Intergenic
914394718 1:147254370-147254392 ATGGAAGAAAGGAAGACAGTAGG + Intronic
917591488 1:176480871-176480893 GTGGAGAATATGTGCACAGTCGG - Intronic
918401948 1:184172389-184172411 GTGTAAAATAGGGAGGCAGTGGG - Intergenic
918429265 1:184441511-184441533 TTCCAAAATAGGAGGGCAGTAGG + Intronic
920162930 1:204013547-204013569 GTGCAAAGTAGTAGGAGAGTTGG + Intergenic
921536018 1:216350080-216350102 GTGGAAAGCAGGAGCAAAGTGGG + Intronic
922610154 1:226920560-226920582 CTGGACAAGAGGAGAACAGTGGG - Intronic
924581939 1:245330654-245330676 GGGGGTAATAGGGGGACAGTCGG + Intronic
1063153881 10:3360498-3360520 GTGGAAAATATTAAAACAGTGGG - Intergenic
1065992873 10:31030255-31030277 AAGGAAGAAAGGAGGACAGTGGG - Intronic
1067974436 10:51008079-51008101 GGGGAAAATTGGAGGAAATTGGG + Intronic
1068177714 10:53483639-53483661 CTGGAAAATAGCAAAACAGTGGG + Intergenic
1068219981 10:54031514-54031536 GTGGAAAGTTGGAGCACAGATGG + Intronic
1068546055 10:58346804-58346826 TAGAAAAATAGGAGGACAGTAGG + Intronic
1069550103 10:69358160-69358182 GTGGTAGATATTAGGACAGTGGG + Intronic
1070374510 10:75816458-75816480 GTGGGAGATAGGATGACTGTGGG + Intronic
1075484967 10:122814486-122814508 GTGGAAAACAGAAGGGCAGATGG - Intergenic
1075523266 10:123157990-123158012 GGGGAAAAAAGGTTGACAGTTGG + Intronic
1077801778 11:5546474-5546496 GGGGAAGATGGGAGGACAGGGGG - Intronic
1078088453 11:8248827-8248849 GAGGCAGGTAGGAGGACAGTAGG - Intronic
1078711787 11:13799493-13799515 GTGAAAGATAAGAGGCCAGTGGG + Intergenic
1079094370 11:17501348-17501370 GTGGGAGAGGGGAGGACAGTGGG + Intronic
1079327409 11:19506091-19506113 GTGGAAAATAGGAGTTGAGAGGG - Intronic
1080043017 11:27779111-27779133 GTGGAAAAGAGGACACCAGTGGG - Intergenic
1080043179 11:27780719-27780741 GTGGAAAAAAGGACACCAGTGGG + Intergenic
1081236806 11:40656303-40656325 GTGAAAAAGAGGAGGAAATTAGG - Intronic
1081797142 11:45828442-45828464 CTGGAAAACTGGAGGCCAGTGGG - Intergenic
1083187566 11:61026529-61026551 GAGGAAAAGAGGAAGACAGAGGG + Intergenic
1083434154 11:62631214-62631236 TTGGAAAATGGGAGGGCAGGAGG - Intronic
1083652199 11:64210269-64210291 GTGGATTATGGGAGGACAGAGGG + Intronic
1084068221 11:66717739-66717761 GTGGCAACTAGGAGGAAAATGGG + Intronic
1085053611 11:73392037-73392059 AGGGAAAACAGGAGGGCAGTGGG + Intronic
1085165014 11:74391172-74391194 GAGGAAAACAGGAAGAAAGTAGG - Intronic
1085531146 11:77192770-77192792 GTGGAAATGAAGAGGATAGTTGG + Intronic
1088794251 11:113254193-113254215 GTGGAAAATAGGTAGAAATTTGG - Intronic
1089358658 11:117872361-117872383 GTGGACATGAGGTGGACAGTAGG + Intronic
1090269042 11:125372987-125373009 GAGGAACAGAGCAGGACAGTAGG + Intronic
1090624938 11:128598514-128598536 GTGTAAAATAGGAGGGGAGTGGG + Intergenic
1091241203 11:134053623-134053645 GTGGAAGGAAGGAGGACAGGCGG + Intergenic
1092563548 12:9641694-9641716 GTGGACAGTAGGAGGGCAGTGGG - Intergenic
1093228337 12:16513368-16513390 GTGGACGGTAGGAGGGCAGTGGG - Intronic
1094110486 12:26856598-26856620 GTGGAAAACAGGAGGGAAATAGG + Intergenic
1094460882 12:30695816-30695838 GGGGAAAAAGGGAGGACAGGGGG - Exonic
1094475657 12:30838852-30838874 ATGGGATATAGGAGGTCAGTGGG + Intergenic
1094805778 12:34089822-34089844 GTGTAAAATAAAAGGAGAGTGGG + Intergenic
1095124450 12:38459800-38459822 GTGTAAAATAAAAGGAGAGTGGG + Intergenic
1095916138 12:47480959-47480981 GTGGAAAGAAGGAGGACAGCAGG + Intergenic
1097347649 12:58512224-58512246 GTGAAAAAGAAGAGGAAAGTCGG + Intergenic
1098450525 12:70613288-70613310 GTGGAGAATAGGAGGCAAGCAGG - Intronic
1098590618 12:72207212-72207234 ATAGAAAATGGGAGGACAGCAGG + Intronic
1099679703 12:85809967-85809989 GCAGAAAATAGAAGGACATTCGG - Intronic
1099799124 12:87434901-87434923 CTGGAAAATAGCAGAACAGTGGG - Intergenic
1099915110 12:88883168-88883190 ATGGAAAATAGATGGTCAGTGGG + Intergenic
1100651247 12:96591402-96591424 GTGGTAAAGAGGAGGAGAGCAGG + Intronic
1102217717 12:111173343-111173365 ATGGAAAATAGGATGCCAGGGGG + Intronic
1102421554 12:112807344-112807366 CTGGAAATGAAGAGGACAGTAGG + Intronic
1103273343 12:119691227-119691249 CTGGGAAATAGTAGGTCAGTAGG - Intronic
1104225841 12:126832179-126832201 GAGGAGAATACGAGGACAGAAGG - Intergenic
1104402950 12:128491799-128491821 GTGGTCCATAAGAGGACAGTGGG - Intronic
1105242147 13:18618621-18618643 ATGGAAAATAGGTTGATAGTGGG - Intergenic
1106095398 13:26638981-26639003 GTGGAAAATAGGAGGACAGTGGG - Intronic
1106412448 13:29520034-29520056 ATGGAAGATAGGTGGACAGATGG - Intronic
1106588581 13:31078739-31078761 GTTGAAGATGGGAGGAGAGTGGG + Intergenic
1109452541 13:62536723-62536745 ATGGAAAATAGGAGAAAAGCAGG - Intergenic
1110139926 13:72115882-72115904 TTGGAAAAGAGGAAGACAGTGGG - Intergenic
1110790840 13:79584918-79584940 GAGGAAAAAATGAGGACATTAGG + Intergenic
1110804565 13:79739096-79739118 GTAGAAAAAAGTAGGAAAGTGGG - Intergenic
1111695548 13:91619000-91619022 GTAGAAAATAAGAGGAAATTTGG + Intronic
1112020033 13:95363572-95363594 TTGGAAACTTGGAGGACAGAGGG + Intergenic
1112086265 13:96034931-96034953 GTGGACAAAAGGAGCACAGCAGG + Intronic
1112591902 13:100771242-100771264 GTGGAAAATAGTAGGAGATGAGG - Intergenic
1112868289 13:103936087-103936109 GTGTAAAATAAGATCACAGTGGG + Intergenic
1114065742 14:19058830-19058852 ATGGAAAATAGGTTGATAGTGGG - Intergenic
1114096520 14:19341170-19341192 ATGGAAAATAGGTTGATAGTGGG + Intergenic
1114696662 14:24632558-24632580 GGGGAAATTAAGGGGACAGTCGG + Intronic
1114985371 14:28220549-28220571 GTGGGAACCAGGAGGACAGATGG - Intergenic
1115443266 14:33460638-33460660 GTGGAAAGTAGGAGGGTAGGAGG - Intronic
1115907793 14:38220469-38220491 CTGGAAAATAGTAGGAAATTAGG + Intergenic
1117551693 14:56843338-56843360 GTTAAAAATCGGAAGACAGTAGG + Intergenic
1118296345 14:64573487-64573509 TAGGAAAATAGCAGGAAAGTAGG + Intronic
1120528461 14:85604868-85604890 AAGGAAAATAGGAAGACATTTGG + Intronic
1120649927 14:87119716-87119738 CTGGAAAATAGCAGAACAGTGGG - Intergenic
1122770944 14:104097420-104097442 GTGGGAAAGAGAAGGACAGGCGG - Intronic
1125897251 15:43312914-43312936 TTGGAAAAAGGGAGGACAGGAGG + Intergenic
1128404615 15:67322973-67322995 ATGTAAAATAGGTGAACAGTGGG + Intronic
1131148687 15:90033397-90033419 GTGGAAAGCAGGAGAAGAGTTGG + Intronic
1133664371 16:7951583-7951605 TTGGAGAAAAGGAGGACTGTAGG - Intergenic
1133676730 16:8080195-8080217 CTGGTAAAGATGAGGACAGTGGG - Intergenic
1133893303 16:9902231-9902253 CTGGATAATAGGAAGACAGAAGG + Intronic
1136114503 16:28086362-28086384 GAAGAAAAAGGGAGGACAGTTGG + Intergenic
1136606500 16:31337849-31337871 TTGAAAAATTGGAGGCCAGTGGG + Intergenic
1137467127 16:48720063-48720085 GTGCAAGATAGCAGGGCAGTAGG - Intergenic
1137814183 16:51382747-51382769 GTGGAGAATAGGATAACAGATGG - Intergenic
1137907775 16:52341794-52341816 GTGGAAAAGAGGAGGTCCTTTGG + Intergenic
1138095292 16:54206651-54206673 GGGGGAAGGAGGAGGACAGTGGG + Intergenic
1138686974 16:58734230-58734252 GTGGACCGTAGGAGGGCAGTGGG + Exonic
1138725956 16:59139434-59139456 GAGGAAAATAGGTGTAGAGTGGG - Intergenic
1138778054 16:59748974-59748996 GTGGAAAATGGGAGGAATTTTGG + Intronic
1139274251 16:65712652-65712674 GTAGAAAATGGTAGGTCAGTGGG - Intergenic
1142809598 17:2389138-2389160 GTGGCAGACAGAAGGACAGTGGG - Intronic
1144426764 17:15150421-15150443 CTGGGAAATAGCAGAACAGTGGG - Intergenic
1145267214 17:21385639-21385661 GAGGAAAAGAGGAGGGCAGCGGG - Intronic
1145267272 17:21385844-21385866 GAGGAGACTGGGAGGACAGTGGG + Intronic
1145891157 17:28416704-28416726 GTGGAAAAACGGAGAACACTGGG + Intergenic
1146090793 17:29875449-29875471 ATGGAAAGAAGGAGGCCAGTAGG - Intronic
1146448133 17:32949601-32949623 TTGGAAAATGGGAGGAAAGGTGG - Intergenic
1147463950 17:40596072-40596094 TTGGGAAATAGCAGAACAGTGGG - Intergenic
1148964975 17:51427558-51427580 GGGCATAATAGGAGCACAGTGGG - Intergenic
1151324417 17:73370039-73370061 GTGCAAAATTGGAGGTCATTTGG + Intronic
1151705172 17:75763597-75763619 GTGGGAAAATGGAGGGCAGTGGG - Intronic
1152462743 17:80449949-80449971 GTGGAGAGAAGGAGGACAGGGGG - Intergenic
1152973943 18:195004-195026 ATGGACAATACTAGGACAGTTGG - Intronic
1153004636 18:486749-486771 GGCTAAAATAGGAGGACTGTTGG + Intronic
1153134478 18:1898664-1898686 GTGGAAAATAGAATGAAAGAAGG + Intergenic
1154446803 18:14441259-14441281 ATGGAAAATAGGTTGATAGTGGG + Intergenic
1156605350 18:38659940-38659962 ATATAAAATAGGAAGACAGTGGG + Intergenic
1158167495 18:54556980-54557002 GTGGAAATAGGGAAGACAGTTGG + Intergenic
1158811311 18:61039540-61039562 GTGGAAAACATGAGCTCAGTGGG - Intergenic
1164061697 19:21681006-21681028 GTGCAAAAAGGGAGGAGAGTTGG - Intergenic
1164290577 19:23865389-23865411 GTGGAAAATTGGGACACAGTAGG + Intergenic
1168561433 19:57387075-57387097 TTGCAAGAGAGGAGGACAGTGGG - Intronic
1202709818 1_KI270714v1_random:12380-12402 GTGGGGAAGAGGAGGACAGGAGG - Intergenic
926138723 2:10355876-10355898 GTGCCAAATAAGAGGAAAGTAGG - Intronic
926256972 2:11212587-11212609 GTAGAAAATAGGAGGAGTATTGG - Intronic
926911683 2:17857566-17857588 GGGGAAAAACGGAGGACAGAAGG - Intergenic
927249739 2:20986928-20986950 GTTGAAATTTGGAGGACACTGGG + Intergenic
927684276 2:25160022-25160044 CTGGAAACTAGGAGACCAGTTGG + Intergenic
927751569 2:25674218-25674240 GAGGAAAAAGGGAGGACATTAGG + Intergenic
928672093 2:33612204-33612226 ATGGAGAATAGGAGGATAGTTGG + Intergenic
928695218 2:33842125-33842147 ATGCAAAGTAGGAGGAGAGTTGG - Intergenic
929547195 2:42863383-42863405 GGGGAAAAGAGTAGGAGAGTGGG + Intergenic
932652623 2:73575386-73575408 GTGGAAAAAAGGAGGAGGGTTGG - Intronic
932796449 2:74700030-74700052 GTGGAAGATATGAGGAGAGTGGG + Intergenic
934665306 2:96165191-96165213 CTGGAAAATAGGATGGAAGTTGG - Intergenic
934934460 2:98454605-98454627 GTGAAAAATAAGAGTACTGTGGG - Intronic
938483142 2:131678959-131678981 ATGGAAAATAGGTTGATAGTGGG - Intergenic
940800184 2:158124407-158124429 GTGGAGAATGGGAGGAGAGAGGG + Intronic
943483712 2:188454440-188454462 ATGTAAAATAGGTGAACAGTGGG + Intronic
943694868 2:190915661-190915683 TTGGAAAATAGGAGGACACCTGG - Intronic
1170083810 20:12506887-12506909 GAGGACATTAGGAGGAGAGTGGG + Intergenic
1170593760 20:17790525-17790547 CTGGCAAAAAGGAAGACAGTAGG + Intergenic
1170791987 20:19516164-19516186 GTGGAAAGTAAGAGGCCAGATGG - Intronic
1171153417 20:22847751-22847773 ATGGACAAGAGGAGGACACTGGG + Intergenic
1171728363 20:28650085-28650107 GTGGATAATAGGAGTACTTTGGG + Intergenic
1171729015 20:28662004-28662026 GTGGATAATAGGAGCGCTGTGGG + Intergenic
1171729422 20:28669495-28669517 GTGGATAATAGGAGCGCTGTGGG + Intergenic
1171730450 20:28688454-28688476 GTGGATAATAGGAGCGCTGTGGG + Intergenic
1171730678 20:28692464-28692486 GTGGATAATAGGAGCGCTGTGGG + Intergenic
1171731694 20:28711071-28711093 GTGGATAATAGGAGCGCTGTGGG + Intergenic
1175563694 20:59955112-59955134 GGGGAACTTAGGTGGACAGTGGG - Intergenic
1176449171 21:6848581-6848603 ATGGAAAATAGGTTGATAGTGGG - Intergenic
1176475712 21:7203010-7203032 GTGGATAATAGGAGTACTTTGGG - Intergenic
1176827339 21:13713605-13713627 ATGGAAAATAGGTTGATAGTGGG - Intergenic
1180484223 22:15781422-15781444 ATGGAAAATAGGTTGATAGTGGG - Intergenic
1181328252 22:22068227-22068249 GTTGAAAATAGGATTTCAGTGGG - Intergenic
1184261345 22:43318676-43318698 TTGGAAAAAAGGAGAAGAGTAGG - Intronic
1184735263 22:46394267-46394289 GGGGAAAATAAGAGGGCAGCTGG + Intronic
949219992 3:1620529-1620551 GTGGAAACTTGGGGGACAGGTGG - Intergenic
951279488 3:20731275-20731297 GTGGAAAAGTGAAGGAGAGTGGG - Intergenic
951593396 3:24291043-24291065 AAGGAAAATGGGAGGGCAGTTGG - Intronic
952088042 3:29850450-29850472 GTGGAAGAAGGGATGACAGTAGG - Intronic
953030887 3:39179004-39179026 TTGGAAAATAGGAAGACGGGAGG + Intergenic
953083257 3:39641381-39641403 GTGGGAAAGAAGAGGACAGCAGG - Intergenic
955458492 3:59152190-59152212 GTGGAAAATAGGTGAGCAGGAGG - Intergenic
957934097 3:86920330-86920352 TGGGAAAAGAGGAGCACAGTGGG + Intergenic
959456779 3:106572505-106572527 GGAGAAAATACGAGGACACTGGG + Intergenic
960200002 3:114821606-114821628 GTGGGAAGCAGGAGGACAGATGG - Intronic
961201042 3:125045650-125045672 GTGGAAAATTGGAGAGGAGTTGG - Intronic
961500392 3:127328464-127328486 CTGGAAAATTGGAGGAAAGAGGG + Intergenic
962718774 3:138152588-138152610 GAGGAATATAGGTGGACATTTGG - Intergenic
962757418 3:138476278-138476300 GTGAAAAATAGTAGGCCACTTGG + Exonic
963640235 3:147852365-147852387 GTGGAAAGTAGGAACACAGAGGG + Intergenic
963705318 3:148679768-148679790 GTGGAAGTTAGGAGGACATAGGG - Intergenic
963727331 3:148937187-148937209 ATAGAAAATAAGAGAACAGTGGG - Intergenic
967496725 3:190150208-190150230 ATGAAAATTTGGAGGACAGTGGG - Intergenic
967603311 3:191414907-191414929 GAGGGTAATAGGATGACAGTAGG - Intergenic
971650835 4:29271329-29271351 ATGGGAAATAGCAGAACAGTGGG - Intergenic
971962934 4:33512280-33512302 CTGGAAAATAGCAGAACAGTGGG - Intergenic
974078932 4:57193460-57193482 TTGGAAAATAATAAGACAGTTGG + Intergenic
975406102 4:73992274-73992296 GGTGAAAATGGGAGGACAGTGGG + Intergenic
975902085 4:79165187-79165209 TAGGAAATTAGGAGGACAGAAGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
977392148 4:96425657-96425679 TTGAGAAAGAGGAGGACAGTAGG - Intergenic
980264831 4:130501855-130501877 GTGAAAATGAGGAGGACATTAGG - Intergenic
981460038 4:145003002-145003024 GTGGAAGATGGGAGGAGGGTGGG - Intronic
981477817 4:145206265-145206287 GTGGAAAATTGAAGTACAGGAGG - Intergenic
983096870 4:163573025-163573047 GAGAAAAATAGGAGGTCAGAAGG + Intronic
985224814 4:187748523-187748545 GTGTAAAAAAGAATGACAGTTGG + Intergenic
986176988 5:5360784-5360806 CTGGAGAATATGAGGACAGGAGG + Intergenic
987149644 5:15025801-15025823 ATGAAAAATAGGAGCAAAGTTGG - Intergenic
987500773 5:18707140-18707162 GTGGGTAAAAGGAGGAGAGTTGG + Intergenic
988307966 5:29518306-29518328 GTGGAATGAATGAGGACAGTAGG - Intergenic
988529925 5:32018391-32018413 GCAGAAAATAGGGAGACAGTTGG - Intronic
988721565 5:33884215-33884237 GTAGAAGATAGGAAGGCAGTGGG - Intronic
990800648 5:59598953-59598975 GTGGAAAACAGCAGGTCACTGGG - Intronic
992958289 5:81932907-81932929 ATGGAAAATATGAGAAGAGTAGG - Intergenic
993274310 5:85836548-85836570 GTTGAAAATAGGAGGAATGTGGG + Intergenic
994080023 5:95698254-95698276 GAGGAAAATAAGCAGACAGTGGG + Intronic
994699083 5:103110953-103110975 GTGGCAGATTGGAGGGCAGTAGG - Intronic
995418278 5:111934416-111934438 GTGGAAAATAGGGGAAGAGGAGG + Intronic
996797965 5:127371315-127371337 TTGGAAATCAGGAGGAGAGTGGG + Intronic
997706470 5:135958350-135958372 AGGGAAAATAGGAGGAAAGCAGG - Intergenic
997786768 5:136720700-136720722 ATGGAAACTAGGAGGAAAGAAGG + Intergenic
998413933 5:141931655-141931677 GTGGGAAAGAGGAGGATGGTGGG + Intronic
998588625 5:143454155-143454177 GTGGAAAATTGGAAGGCAGGAGG + Intergenic
999505670 5:152193365-152193387 GTGGAAAATGGGATGCCATTGGG - Intergenic
1001287269 5:170433010-170433032 GTGTTAAATAGGAGGAGACTGGG + Intronic
1001562802 5:172680396-172680418 GGGGACAAGAGGAGGAGAGTTGG + Intronic
1001606238 5:172961955-172961977 GTGGAAGATGGGAGTAGAGTTGG - Intronic
1002943491 6:1738942-1738964 GCGGAAATCAGGATGACAGTGGG + Intronic
1003484219 6:6561797-6561819 ATGGAAAATAGGAAAACAATGGG - Intergenic
1003578691 6:7320017-7320039 GTTAAAAATAAGAGCACAGTTGG - Intronic
1005882795 6:30073720-30073742 GTGGAAAGGGGGAGGACAGTGGG - Intronic
1006125764 6:31836880-31836902 CTGCAAAATAGGAGTACACTGGG + Intronic
1006797036 6:36738496-36738518 GTGGACAAGAGGAGGACAGAGGG + Intergenic
1007229441 6:40338156-40338178 GTGGAAATGGAGAGGACAGTAGG + Intergenic
1010631577 6:78204995-78205017 GTGGAAAATATGAGGAAGGGTGG + Intergenic
1010704297 6:79089634-79089656 GAGGAAAACAGGAGGAAAGAAGG - Intergenic
1011645944 6:89458225-89458247 GTGGAAATTATGAGGAAAATTGG + Intronic
1012836825 6:104280119-104280141 GAGGAAAAGTGGAGGACATTAGG - Intergenic
1013228832 6:108142727-108142749 GTGCAAAATAGGAGGAAGGAGGG - Intronic
1013546317 6:111161261-111161283 GTGTAAAATAGGTGGAGGGTGGG + Intronic
1014069675 6:117167008-117167030 GTGGAAAAAGGGAGTACAATAGG - Intergenic
1014937674 6:127403077-127403099 GTAGAAAATAGCAGTTCAGTTGG + Intergenic
1015831247 6:137371282-137371304 CTGGGAAATAGCAGAACAGTAGG + Intergenic
1016255582 6:142101451-142101473 TTGGGAAATAGCAGAACAGTGGG + Intergenic
1016984353 6:149884026-149884048 ATGGAAAATAAGAGGAAATTGGG - Intronic
1017487989 6:154920611-154920633 GTGGAAAGTGGGACGAGAGTAGG + Intronic
1017882849 6:158573595-158573617 GTGGAAGATAGGGGCACAGCTGG - Intronic
1019063790 6:169278047-169278069 CTGGGAAATAGCAGAACAGTGGG - Intergenic
1019713003 7:2525885-2525907 GTGGAATATAGGAAGTAAGTGGG - Intronic
1019855090 7:3597428-3597450 CTGGGAAATAGCAGAACAGTGGG + Intronic
1020419818 7:7989439-7989461 GAGGAAAATAGAATGACAATTGG + Intronic
1020463185 7:8446604-8446626 GTGGAAAACAGGAAGAGATTTGG - Intronic
1021246890 7:18274325-18274347 GTGGAAAATAGAAGGTAAGCAGG + Intronic
1022677238 7:32511563-32511585 GGGAAAGATAGGAGGACACTTGG + Intronic
1023761777 7:43470908-43470930 GAGGAACAAAGGAGGATAGTGGG + Intronic
1024934115 7:54695584-54695606 GAGGAAAACAGGAAAACAGTAGG + Intergenic
1026002726 7:66574587-66574609 CTGGAAAATAGGAGTACAAAAGG + Intergenic
1026029131 7:66774218-66774240 CTGGAAAATAGGAGTACAAAAGG - Intronic
1027426779 7:78069075-78069097 ATGGAAAATGGGAAGACAATGGG + Intronic
1028978979 7:96945882-96945904 GGGGACAATCGAAGGACAGTGGG - Intergenic
1031453872 7:121955954-121955976 GTGAAAGATAGGAGGACTTTGGG + Intronic
1032391508 7:131557892-131557914 GTGGAAAAAAGGAGGGGAGCGGG - Intronic
1033430783 7:141287785-141287807 AAGGATAATAGGAGAACAGTTGG - Intronic
1033962958 7:146936419-146936441 CTGGAAAACAGTAGAACAGTGGG - Intronic
1034341073 7:150355714-150355736 CTGGGAAATAGTAGAACAGTGGG + Intergenic
1036089666 8:5651913-5651935 GTCGAAAATGGGAGGGCATTTGG - Intergenic
1036970415 8:13348804-13348826 CTGGAAAGTAGGTGGACTGTTGG + Intronic
1038426286 8:27466037-27466059 GTGGAAACTAGAAGGACCCTGGG + Intronic
1039931001 8:41989032-41989054 ATAGAAAACAGGAGGAAAGTGGG + Intronic
1041699014 8:60767027-60767049 CTGGAAGATAGGAGGAGAGAGGG + Intronic
1041709995 8:60885801-60885823 GTGGACAATAGGAGCATAGATGG - Intergenic
1044923916 8:97193638-97193660 GTGGAAAGTAGAAGGGCAGTGGG - Intergenic
1045148491 8:99375110-99375132 GTGGAAAATAGATGGCAAGTGGG + Intronic
1045463484 8:102447410-102447432 ATAGAAAAATGGAGGACAGTTGG - Intergenic
1045596834 8:103666478-103666500 CTAGAAAATAGCAGAACAGTGGG + Intronic
1045850906 8:106697184-106697206 GGGGAAAAGAAGAGGCCAGTTGG + Intronic
1046657838 8:116914230-116914252 GTAGAAAGTAAGAGGATAGTGGG + Intergenic
1046853349 8:119000874-119000896 GTGGTAGAGAGGAAGACAGTGGG + Intronic
1046960207 8:120103607-120103629 GTGAGAAATAGGAGAACAATTGG + Intronic
1046978174 8:120306985-120307007 GTGTAAACTATGAGGACAATAGG + Intronic
1047048289 8:121079716-121079738 TTGGAAACTAGGGGGACAGGAGG - Intergenic
1047690760 8:127352138-127352160 GTGGAAACTAGGCTGAAAGTTGG + Intergenic
1047861453 8:128971678-128971700 TTGGAAAAAATGAGGACAGAGGG + Intergenic
1048008364 8:130437437-130437459 GTGCAAAAGAGAAGGACAGGTGG + Intronic
1048704992 8:137143677-137143699 GTGGAAAGTGGAAGGAGAGTTGG - Intergenic
1048746399 8:137619265-137619287 GTGGAAGAAAGGAGGAACGTAGG + Intergenic
1050994064 9:12191409-12191431 ATGTAAAATAGGGGAACAGTGGG - Intergenic
1051977193 9:22965287-22965309 CTGGAAAATAGCAGGACGATAGG + Intergenic
1052454120 9:28672191-28672213 GTGCAGAATAGTAGGACACTAGG + Intergenic
1053280087 9:36814820-36814842 GTGTAAAATAGGCGGACAGAAGG + Intergenic
1055715938 9:79117983-79118005 GTGGAAAACAGAAGGAGAATTGG + Intergenic
1055919118 9:81438843-81438865 GTGGAAAACAGGAGGAGAGTAGG - Intergenic
1056493306 9:87129597-87129619 GTAGAAAATAGGAGGAGAATGGG - Intergenic
1058218147 9:102260680-102260702 CTGGAAAATAGCAAAACAGTGGG - Intergenic
1058226489 9:102371116-102371138 ATTGAAAATAGAAAGACAGTAGG + Intergenic
1059391462 9:114002116-114002138 GTGGGAAACAGGCAGACAGTGGG - Intronic
1060957826 9:127656568-127656590 ATGGGAGATAGGAGGACAGGAGG - Intronic
1061589832 9:131591219-131591241 GGGGAGAATAGGAGGCCAGGAGG + Intronic
1062222891 9:135428161-135428183 GTGGAAATTTGGAGGAAAATAGG + Intergenic
1203520017 Un_GL000213v1:35935-35957 ATGGAAAATAGGTTGATAGTGGG + Intergenic
1186252357 X:7681949-7681971 GTGCAAAATGGGAGGTCACTTGG - Intergenic
1186903933 X:14090674-14090696 GTGGAAGATAGGGGGAGAGAAGG + Intergenic
1188157051 X:26753059-26753081 CTGGGAAATAGCAGAACAGTGGG + Intergenic
1188532861 X:31161888-31161910 GAGGAGAATAAGAGGGCAGTGGG - Intronic
1188694506 X:33173894-33173916 TTGGAAAATAAGAGGGCAGAGGG + Intronic
1188842456 X:35032951-35032973 GTGGAAACAAGGAGAACAGCAGG + Intergenic
1188852280 X:35146363-35146385 GTGGCAACTAGGAACACAGTTGG - Intergenic
1191030153 X:55961184-55961206 CTGGACAGTAGGAGGGCAGTGGG - Intergenic
1191789728 X:64956861-64956883 CTGGAAAACAGTAGAACAGTGGG - Intronic
1192272015 X:69589691-69589713 GTGCAAGATAGGTGGACAGTTGG - Intergenic
1192699291 X:73450491-73450513 GTGGAAAAGAGGGGGAGAGCAGG + Intronic
1193695628 X:84704273-84704295 CTGGGAAATAGCAGAACAGTGGG + Intergenic
1194115372 X:89889743-89889765 ATGGAATATAGGAAGACATTAGG - Intergenic
1194138039 X:90172492-90172514 CTGGAAAATAGCAGAACAGCAGG + Intergenic
1194241209 X:91451632-91451654 TTGGAAAATAGCAAAACAGTGGG + Intergenic
1194485841 X:94485171-94485193 GTGTAAAATAAGAGGAAAATAGG + Intergenic
1195471770 X:105238443-105238465 CTGAAAAATAGCAGAACAGTGGG + Intronic
1198511128 X:137352895-137352917 GTGGAAAATAGGAGAGCGCTTGG + Intergenic
1198706159 X:139450705-139450727 GCGGAAGATGGGAGAACAGTGGG + Intergenic
1199650877 X:149945259-149945281 GAGGAAGAAAGGAGGACAGAAGG + Intergenic
1199986428 X:152955356-152955378 CTGGGAAACAGGAGGACAGTGGG + Intronic
1200008534 X:153104199-153104221 GTGGAAAATAGGATTAGTGTGGG + Intergenic
1200468164 Y:3546882-3546904 ATGGAATATAGGAAGACATTAGG - Intergenic
1200483832 Y:3742746-3742768 CTGGAAAATAGCAGAACAGCAGG + Intergenic