ID: 1106098823

View in Genome Browser
Species Human (GRCh38)
Location 13:26676208-26676230
Sequence TATTACATGGGTGAACAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106098823_1106098826 1 Left 1106098823 13:26676208-26676230 CCAGGTTGTTCACCCATGTAATA 0: 1
1: 0
2: 0
3: 7
4: 265
Right 1106098826 13:26676232-26676254 AGATCTGAAAGACCTTGTTTAGG 0: 1
1: 0
2: 0
3: 18
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106098823 Original CRISPR TATTACATGGGTGAACAACC TGG (reversed) Intronic
900223485 1:1521999-1522021 GATTACACGGGTGAGCCACCGGG + Intronic
900508465 1:3043361-3043383 GATTACAGGTGTGAACCACCGGG - Intergenic
902892736 1:19456182-19456204 AATTACAGGTGTGAACCACCAGG + Intronic
903205279 1:21777393-21777415 GATTACAGGTGTGAACCACCTGG - Intronic
905152211 1:35938921-35938943 TACTAGATGAGTGAACAACATGG + Intronic
905476152 1:38229604-38229626 TCCTACATGGGTGGACACCCAGG - Intergenic
906056395 1:42921410-42921432 GATTACAGGTGTGAACCACCAGG + Intergenic
906929841 1:50158766-50158788 GATTACAGGGGTGAGCCACCAGG - Intronic
907992902 1:59600115-59600137 TATTACAAGGGTGATGAAACTGG - Intronic
908195977 1:61745874-61745896 GATTACAGGCGTGAACCACCGGG + Intronic
908296184 1:62715669-62715691 TATTACAGGCGTGAGCCACCAGG + Intergenic
909622031 1:77679556-77679578 TATTACAGGCGTGAGCCACCAGG + Intronic
911478015 1:98397818-98397840 AATTACAGGCGTGAACCACCAGG + Intergenic
911609853 1:99948609-99948631 GATTACATGCGTGAGCCACCGGG + Intergenic
912577368 1:110685645-110685667 GATTACAGGGGTGAGCCACCAGG + Intergenic
913991634 1:143618415-143618437 GATTACAGGCGTGAACCACCAGG - Intergenic
914697327 1:150096896-150096918 TATTACTTCAGTGAACATCCTGG - Intronic
914731015 1:150370182-150370204 GATTACAGGCGTGAACCACCAGG + Intronic
920173454 1:204085700-204085722 GATTACAGGGGTGAGCCACCAGG - Intronic
923880498 1:238099065-238099087 TTTTACATGGTTGAACAAACAGG - Intergenic
924115197 1:240738457-240738479 GATTACAGGCGTGAACCACCAGG - Intergenic
924628705 1:245716808-245716830 GATTACAAGTGTGAACCACCAGG - Intergenic
924927024 1:248693057-248693079 TCTTACTTCTGTGAACAACCAGG - Intergenic
1066089968 10:32007784-32007806 GATTACAGGTGTGAACCACCGGG - Intergenic
1066316988 10:34258002-34258024 TAATACATGGGTGAATTACGTGG - Intronic
1066530582 10:36333908-36333930 TATTACATAAGTAAACAACATGG + Intergenic
1067392131 10:45873574-45873596 GATTACAGGCGTGAACCACCAGG - Intergenic
1069475057 10:68724560-68724582 GATTACAGGTGTGAACCACCAGG + Intronic
1070717076 10:78730415-78730437 TACAACATGGATGAACAACATGG - Intergenic
1070791709 10:79193526-79193548 CATTAGATGGGTGAACAGGCAGG - Intronic
1071307131 10:84309410-84309432 GATTACAGGGGTGAGCCACCGGG - Intergenic
1071388540 10:85146505-85146527 GATTACAGGTGTGAACCACCAGG - Intergenic
1073468341 10:103707618-103707640 AATTACAGGTGTGAACCACCCGG + Intronic
1073562943 10:104512332-104512354 CAGTACATGGGTGAACAGTCAGG - Intergenic
1074414443 10:113254968-113254990 TATTATATCTGTGAAGAACCAGG - Intergenic
1075931418 10:126299914-126299936 GATTACAGGGGTGAGCCACCTGG + Intronic
1078598415 11:12709748-12709770 GATTACTTGGGTTAACGACCAGG - Intronic
1083576798 11:63797744-63797766 GATTACAGGCGTGAACAACCAGG - Intergenic
1083877869 11:65533955-65533977 GATTACAGGTGTGAGCAACCGGG - Intronic
1086402727 11:86473769-86473791 TATACCATGGGTGAAAAAACTGG + Intronic
1087837797 11:102892179-102892201 GATTACAGGTGTGAACCACCTGG - Intergenic
1088670894 11:112139502-112139524 TATTACAAGTGTGAGCCACCGGG - Intronic
1090477630 11:127037876-127037898 TATTAAATGGGTAAAACACCAGG + Intergenic
1092816153 12:12313942-12313964 GATTACAGGTGTGAACCACCTGG + Intergenic
1095287318 12:40429665-40429687 TATTACATACGTGAACGGCCAGG - Exonic
1096122776 12:49099085-49099107 GATTACAGGCGTGAACCACCAGG + Intronic
1096723361 12:53541000-53541022 GATTACAGGTGTGAACCACCAGG + Intronic
1104404714 12:128507934-128507956 TAGTACCTGGGTGAAAAAACCGG - Intronic
1104536943 12:129626726-129626748 AATTACATGCGTGAGCCACCAGG + Intronic
1106098823 13:26676208-26676230 TATTACATGGGTGAACAACCTGG - Intronic
1107233113 13:38135701-38135723 TATTATATGTGTGAATCACCTGG + Intergenic
1109441923 13:62385741-62385763 GATTACAGGTGTGAACCACCAGG - Intergenic
1112243786 13:97709119-97709141 GATTACATGTGTGAGCCACCAGG - Intergenic
1112737681 13:102439643-102439665 GATTACAGGGGTGAGCCACCGGG - Intergenic
1117686738 14:58261449-58261471 TATTACAGGTGTGAGCCACCAGG + Intronic
1118870235 14:69735266-69735288 GATTACAGGTGTGAACCACCAGG + Intronic
1119597514 14:75949576-75949598 GATTACAGGCGTGAACCACCAGG - Intronic
1119707997 14:76798673-76798695 GATTACAGGTGTGAACCACCAGG - Intronic
1120202561 14:81553750-81553772 TATTACAGGTGTGCACCACCAGG + Intergenic
1120483353 14:85080489-85080511 TATTAAATGGCTGCACAGCCAGG + Intergenic
1120998706 14:90436161-90436183 GATTACAGGTGTGAACCACCCGG - Intergenic
1121901150 14:97694515-97694537 GATTACAGGGGTGAGCCACCTGG - Intergenic
1122946936 14:105015800-105015822 GATTACAAGGGTGTACCACCAGG + Intronic
1123005530 14:105320878-105320900 GATTACAGGTGTGAACCACCAGG - Intronic
1123479878 15:20621232-20621254 TATTACATGCGTGAGTCACCAGG - Intergenic
1123638129 15:22379132-22379154 TATTACATGCGTGAGTCACCAGG + Intergenic
1125897396 15:43314203-43314225 TATTACAGGCGTGAGCCACCAGG + Intergenic
1126584777 15:50273039-50273061 GATTACAGGCGTGAACCACCGGG + Intergenic
1127016140 15:54690541-54690563 GATTACAGGCGTGCACAACCAGG - Intergenic
1127143658 15:56002649-56002671 TCTTAAAGGGGTGTACAACCAGG + Intergenic
1127560339 15:60129955-60129977 GATTACAGGGGTGAGCCACCAGG + Intergenic
1130707620 15:86248043-86248065 GATTACAGGAGTGAACCACCGGG - Intronic
1130780886 15:87039156-87039178 TATTAGATGAGTGAAGAGCCAGG + Intergenic
1131704534 15:94978802-94978824 GATTACAGGGGTGAGCCACCAGG - Intergenic
1132668380 16:1092040-1092062 GAGTACCTGGGTGAGCAACCGGG + Intronic
1133541251 16:6756697-6756719 GATTACAGGCGTGAACCACCAGG - Intronic
1133786484 16:8977753-8977775 GATTACAAGTGTGAACCACCAGG + Intergenic
1134303785 16:13013999-13014021 GATTACAGGCGTGAACCACCGGG + Intronic
1134350502 16:13433504-13433526 TATTTCATGGGTGAAGAAAGAGG + Intergenic
1135587928 16:23684928-23684950 GATTACAGGCGTGAACCACCAGG + Intronic
1135813314 16:25609343-25609365 GATTACAGGGGTGAGCCACCAGG + Intergenic
1136039684 16:27568427-27568449 GATTACAGGTGTGAGCAACCGGG + Intronic
1136362371 16:29789283-29789305 GATTACAGGTGTGAACCACCAGG - Intergenic
1139108172 16:63854438-63854460 AATTACATGGGTAAACAAAAAGG - Intergenic
1139603966 16:68004733-68004755 GATTACAGGAGTGAACCACCGGG + Intronic
1140389600 16:74573758-74573780 GATTACATGTGTGAGCCACCTGG + Intronic
1140803912 16:78515084-78515106 AATTACAGGCGTGAACCACCAGG - Intronic
1140935380 16:79665063-79665085 TATTACAGGTGTGAGCCACCAGG + Intergenic
1142338711 16:89507343-89507365 TATTACATGGGTGTTCGACACGG + Intronic
1144268057 17:13590752-13590774 TAGTACTTGGGATAACAACCAGG + Intronic
1144809678 17:17990717-17990739 GATTACAGGTGTGAACCACCGGG - Intronic
1144969923 17:19101924-19101946 GATTACAGGTGTGAACCACCAGG + Intergenic
1144977993 17:19150140-19150162 GATTACAGGTGTGAACCACCAGG - Intronic
1144990228 17:19228092-19228114 GATTACAGGTGTGAACCACCAGG + Intronic
1146236631 17:31172074-31172096 GATTACATGTGTGAGCCACCAGG - Intronic
1147017653 17:37505252-37505274 GATTACAGGGGTGAGCCACCAGG - Intronic
1148634424 17:49136817-49136839 GATTACAGGCGTGAACCACCGGG + Intronic
1148883964 17:50757813-50757835 GATTACAGGGGTGAGCCACCAGG - Intergenic
1148933773 17:51148531-51148553 GATTACAGGCGTGAACCACCTGG + Intergenic
1150122239 17:62613851-62613873 GATTACAGGCGTGAACCACCAGG - Intronic
1150338254 17:64345438-64345460 GATTACAGGTGTGAACCACCAGG - Intronic
1150386643 17:64766950-64766972 GATTACAGGGGTGAGCCACCAGG + Intergenic
1150459018 17:65331477-65331499 CATGACATGGGTGTACAACTGGG + Intergenic
1150910549 17:69382783-69382805 GATTACAGGCGTGAACCACCAGG + Intergenic
1153466284 18:5391269-5391291 TATTACATGAGTCAGAAACCTGG - Intergenic
1155958138 18:31971449-31971471 GATTACAGGGGTGAGCCACCGGG - Intergenic
1156236727 18:35212563-35212585 TACTACATGGATGAACCATCAGG - Intergenic
1156441342 18:37191484-37191506 TATTCCTTGGGAGAACATCCTGG + Intronic
1158473659 18:57760648-57760670 TATTACCTTGGTGAACAAAGAGG - Intronic
1158993550 18:62894331-62894353 GATTACAGGGGTGCACCACCAGG + Intronic
1161018224 19:1994042-1994064 GATTACAGGCGTGAACCACCAGG - Intronic
1161224117 19:3135008-3135030 GATTACATGCGTGAGCCACCAGG + Intergenic
1161504796 19:4638271-4638293 GATTACAGGGGTGAGCCACCGGG + Intergenic
1162209400 19:9079622-9079644 GATTACAGGCGTGAACCACCAGG + Intergenic
1163643463 19:18474848-18474870 GATTACAGGCGTGAACCACCTGG - Intronic
1163723991 19:18912117-18912139 GATTACAGGCGTGAACCACCGGG + Intronic
1164266717 19:23625752-23625774 GATTACAGGCGTGAACCACCGGG - Intronic
1164435000 19:28221426-28221448 TCTTACAAGGGAGAAAAACCTGG - Intergenic
1166514144 19:43433150-43433172 GATTACAGGGGTGAGCCACCTGG - Intergenic
1167274868 19:48531220-48531242 GATTACAAGTGTGAACCACCAGG - Intergenic
1167891741 19:52545505-52545527 GATTACAGGTGTGAGCAACCGGG - Intronic
1168712070 19:58507013-58507035 GATTACAGGCGTGAACCACCGGG + Intronic
927631972 2:24782139-24782161 GATTACAGGCGTGAACCACCGGG + Intergenic
928613224 2:33010988-33011010 AATTACAGGGGTGAGCCACCAGG + Intronic
928788677 2:34923678-34923700 GATTACAGGCGTGAGCAACCTGG - Intergenic
930725600 2:54678358-54678380 TATTACAGGCGTGCACCACCAGG - Intergenic
931499864 2:62854575-62854597 TGGTAGATGGGGGAACAACCGGG + Intronic
935043344 2:99455938-99455960 TAGTACATGGGTAAAAGACCAGG - Intronic
935502547 2:103858857-103858879 AATTACAGGTGTGAACCACCGGG + Intergenic
936765169 2:115838697-115838719 TATTAGATGGGTGAAGCGCCAGG - Intronic
937415848 2:121713880-121713902 GATTACAGGGGTGAGCCACCAGG + Intergenic
938044543 2:128105933-128105955 TATTATAGGTGTGTACAACCAGG + Intronic
938300546 2:130208249-130208271 GATTACAGGGGTGAGCCACCGGG - Intergenic
938456180 2:131466222-131466244 GATTACAGGGGTGAGCCACCGGG + Intronic
941565996 2:167108960-167108982 TATTACATGGGTAACAAACTTGG + Intronic
945823341 2:214691149-214691171 GATTACAGGGGTGAGCCACCGGG - Intergenic
948201425 2:236132305-236132327 AATTACAGGTGTGAACCACCAGG - Intergenic
948495908 2:238349795-238349817 GATTACAGGCGTGAACCACCAGG - Intronic
1171978821 20:31612669-31612691 GATTACAGGCGTGAACCACCGGG + Intergenic
1173594397 20:44249308-44249330 TATTACAGGTGTGAGCCACCAGG + Intronic
1174323727 20:49762477-49762499 GATGACATGGGCGCACAACCAGG - Intergenic
1177431999 21:21001668-21001690 TCTTACATATGTGAACATCCAGG - Intronic
1178315355 21:31562282-31562304 CATTAAATGGTTGAAAAACCTGG + Intergenic
1178991516 21:37360671-37360693 GATTACAGGCGTGAACCACCAGG + Intergenic
1179003541 21:37486605-37486627 TACTACATAGGTAAACAAACAGG + Exonic
1181446501 22:22979527-22979549 TTTTACATTGGTGAAAAACCTGG - Intergenic
1181614328 22:24042223-24042245 GATTACAGGTGTGAACCACCAGG + Intronic
1181670393 22:24423262-24423284 GATTACAGGCGTGAACCACCGGG - Intronic
1182176704 22:28297462-28297484 GATTACAGGTGTGAGCAACCAGG + Intronic
1182378306 22:29865090-29865112 GATTACAGGCGTGAACCACCTGG + Intergenic
1182595169 22:31413884-31413906 GATTACAGGGGTGAGCCACCGGG + Intronic
1182601984 22:31472539-31472561 GATTACAGGTGTGAGCAACCGGG + Intronic
1183317558 22:37145291-37145313 TATAATCTGGGTGACCAACCTGG - Intronic
950283438 3:11726025-11726047 TATGACATGGGAGGACAAACTGG - Intergenic
951518974 3:23593612-23593634 TATTAGATGGGAGACCAAACAGG + Intergenic
952870362 3:37894377-37894399 GATTACAGGCGTGAACCACCAGG + Intronic
953035106 3:39204191-39204213 GATTACAGGGGTGAGCCACCTGG - Intergenic
954203658 3:49041463-49041485 TATTACAGGTGTGAGCTACCAGG + Intronic
954925604 3:54231644-54231666 AAATATATGGGTGAACAAACTGG - Intronic
956429250 3:69167825-69167847 GATTACATGTGTGAGCCACCAGG - Intergenic
958429801 3:94025118-94025140 TATTACATGGATAAAAATCCAGG - Intronic
958577926 3:95975972-95975994 GATTACAGGCGTGAACCACCAGG + Intergenic
960287311 3:115844290-115844312 TATTCCATGGCTTAAGAACCAGG + Intronic
964865449 3:161254604-161254626 TTTTACTTGGGTAAATAACCAGG + Intergenic
968256449 3:197277611-197277633 GATTACAGGTGTGAACCACCAGG + Intronic
969667675 4:8571111-8571133 TATTCTATGGGTGAATATCCTGG + Intronic
970788148 4:19824840-19824862 TATTACAGGCGTGAGCCACCAGG + Intergenic
972650955 4:41017167-41017189 GATTACAGGCGTGAACCACCAGG + Intronic
973767979 4:54181035-54181057 GATTACACGTGTGAACCACCAGG + Intronic
975631696 4:76410455-76410477 GATTACAGGCGTGAACCACCAGG + Intronic
976748661 4:88431647-88431669 AATTACAGGTGTGAACCACCAGG - Intronic
976883825 4:89962466-89962488 TATTACAGGCGTGAGCAACCGGG - Intergenic
977504300 4:97882342-97882364 TATCACATGGGAGAATGACCTGG - Intronic
977876166 4:102152907-102152929 TGTTACATGTGTTAACAACATGG + Intergenic
979274855 4:118803610-118803632 TTTTAAATGAGTGAACAATCTGG - Intronic
981463455 4:145038060-145038082 GATTACAGGCGTGAACCACCAGG - Intronic
981986491 4:150863387-150863409 GATTACAGGGGTGAGCCACCGGG - Intronic
984178640 4:176452837-176452859 GATTACAAGTGTGCACAACCAGG - Intergenic
984720116 4:182963527-182963549 GATTACAGGTGTGAACAACCGGG + Intergenic
986291735 5:6405376-6405398 GATTACAGGCGTGAACCACCAGG + Intergenic
992478198 5:77124315-77124337 TATTACAGGTGTGAACCACCAGG - Intergenic
992574212 5:78094951-78094973 TATTACAAGTGTGAGCCACCAGG + Intronic
995421559 5:111973016-111973038 AGTTTCATGGGTGCACAACCTGG - Intronic
996380578 5:122859018-122859040 AATTACAGGTGTGAGCAACCAGG + Intronic
996716299 5:126590610-126590632 GATTACAGGCGTGAACCACCAGG - Intronic
996974476 5:129414181-129414203 TATTCGATGTGTGAACAACATGG - Intergenic
997318859 5:132961495-132961517 GATTACAGGCGTGAACCACCAGG + Intronic
997324495 5:133008737-133008759 GATTACAAGCGTGAACCACCAGG - Intronic
997686718 5:135793893-135793915 TACAACATGTGTGTACAACCTGG + Intergenic
998255721 5:140585951-140585973 GATTACAGGGGTGAACCACTGGG - Intronic
998566650 5:143221793-143221815 CATTACAGGCGTGAACCACCAGG + Intronic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
999996747 5:157099522-157099544 GATTACAGGTGTGAACGACCAGG + Intronic
1000619121 5:163462552-163462574 GATTACACGTGTGAACCACCAGG - Intronic
1002150569 5:177226305-177226327 GATTACATGCGTGAGCCACCGGG + Intronic
1002602051 5:180359473-180359495 GATTACAGGTGTGAACCACCGGG - Intergenic
1003797299 6:9619108-9619130 GATTACAGGCGTGAGCAACCAGG - Intronic
1006112153 6:31753996-31754018 GATTACAGGTGTGAACCACCAGG + Intronic
1006250548 6:32779752-32779774 TAATAAATGGGTGAAAAACTTGG - Intergenic
1010241516 6:73620193-73620215 TATTACAGGTGTGAACCACTGGG + Intronic
1010737720 6:79461464-79461486 GAACACATGGGTGATCAACCAGG - Intergenic
1014122625 6:117743242-117743264 GATTACATGTGTGAGCCACCAGG - Intergenic
1015307012 6:131720717-131720739 GATTACAGGTGTGAACCACCAGG + Intronic
1018388080 6:163322605-163322627 GATTACAAGCGTGAACCACCGGG - Intergenic
1018957259 6:168418598-168418620 GATTGCATGGGTGAAGACCCAGG - Intergenic
1019675406 7:2309059-2309081 GATTACAGGCGTGAACCACCAGG + Intronic
1019965326 7:4494118-4494140 GATTACAGGCGTGAACCACCGGG + Intergenic
1020285223 7:6673828-6673850 TAATACAGGGGTGAAAACCCAGG + Intergenic
1020938641 7:14502054-14502076 TATGACATGTGTGAACAAGTAGG - Intronic
1024899557 7:54303216-54303238 GATTACAAGCGTGAACCACCAGG - Intergenic
1025943911 7:66092177-66092199 GATTACAGGGGTGAGCCACCAGG - Intronic
1026596692 7:71739011-71739033 GATTACAGGAGTGAACCACCGGG - Intergenic
1026856207 7:73756796-73756818 TATTACAGGCATGAACCACCAGG + Intergenic
1027156911 7:75774945-75774967 CATTACAGGGGTGAGCCACCGGG - Intronic
1027686740 7:81287764-81287786 TATTACAAGCGTGAGCTACCAGG + Intergenic
1028147626 7:87335861-87335883 TGTTGAATGGGTGAACAAACAGG + Intergenic
1030100827 7:105943891-105943913 GATTACATGTGTGAGCCACCGGG - Intronic
1030349001 7:108462494-108462516 TATTACAGGCGTGAGCCACCAGG - Intergenic
1032725010 7:134582595-134582617 GATTACAGGTGTGAACCACCAGG - Intergenic
1032894388 7:136234674-136234696 TTTTAAATGTGGGAACAACCTGG + Intergenic
1033214080 7:139481649-139481671 GATTACAGGTGTGAACCACCGGG - Intronic
1034325441 7:150226708-150226730 GATTACAGGCGTGAACCACCAGG + Intergenic
1034767761 7:153742542-153742564 GATTACAGGCGTGAACCACCAGG - Intergenic
1035881354 8:3246743-3246765 GATTACAGGTGTGAACCACCGGG + Intronic
1036836939 8:12079616-12079638 GATTACAGGCGTGAGCAACCGGG - Intergenic
1036858732 8:12325862-12325884 GATTACAGGCGTGAGCAACCGGG - Intergenic
1038491101 8:27972042-27972064 GATTACAGGGGTGAGCCACCGGG - Intronic
1038932381 8:32208528-32208550 GATTACAGGCGTGAACCACCGGG + Intronic
1039046848 8:33458440-33458462 TATTACAGGCGTGAGCCACCAGG - Intronic
1039424561 8:37475422-37475444 AATTACAGGTGTGAACAGCCAGG + Intergenic
1039703377 8:39983589-39983611 GATTACAGGGGTGAGCCACCGGG - Intronic
1042947434 8:74169260-74169282 GATTACAGGTGTGAACCACCAGG + Intergenic
1043847953 8:85182977-85182999 GATTACAGGCGTGAACCACCGGG - Intronic
1044781267 8:95745714-95745736 GATTACAGGTGTGAACAGCCAGG - Intergenic
1047348960 8:124055164-124055186 GATTACAGGCGTGAACCACCAGG - Intronic
1047718316 8:127616154-127616176 AATTACATGGGTGAACTATAGGG + Intergenic
1047810874 8:128407664-128407686 TATTACATGGTTGAATAAAAAGG + Intergenic
1048396800 8:134021674-134021696 TATGACATGGATGAACCACGAGG - Intergenic
1052145928 9:25049440-25049462 TATAACATAGGTGAAGAACATGG + Intergenic
1052579239 9:30332718-30332740 TATTAGATGTGTGAAGAAACAGG - Intergenic
1053079644 9:35164152-35164174 AATTACAGGAGTGAACCACCAGG + Intronic
1053192868 9:36088341-36088363 TATTATATTGGTGGATAACCTGG + Intronic
1053890911 9:42691964-42691986 GATTACAGGCGTGAGCAACCTGG + Intergenic
1054220786 9:62409790-62409812 GATTACAGGCGTGAGCAACCTGG - Intergenic
1054229928 9:62499382-62499404 GATTACAGGCGTGAGCAACCTGG + Intergenic
1055381134 9:75707617-75707639 GATTACAGGGGTGAGCCACCGGG - Intergenic
1056143159 9:83704552-83704574 GATTACAGGTGTGAACCACCGGG - Intronic
1056151088 9:83789456-83789478 CATGACATGGGTAAACATCCTGG + Intronic
1058586687 9:106514656-106514678 TAGTAAATGGGTAAACAAACTGG + Intergenic
1059289065 9:113205865-113205887 TATAACATGGGTGAACCTTCAGG + Intronic
1059618228 9:115974419-115974441 GATTACAAGTGTGAACCACCAGG - Intergenic
1060398770 9:123335171-123335193 GATTACAGGCGTGAACCACCGGG + Intergenic
1061309759 9:129754527-129754549 GATTACATGTGTGAGCCACCTGG - Intergenic
1061333562 9:129913496-129913518 GATTACATGCGTGAGCCACCAGG - Intronic
1061713317 9:132502620-132502642 TATAACATGGATGAACCACGAGG - Intronic
1185802209 X:3022012-3022034 GATTACATGTGTGAGCCACCAGG + Intronic
1187359184 X:18609118-18609140 GATTACATGTGTGAGCCACCTGG - Intronic
1187538388 X:20165341-20165363 TATTAAATGAGTGATCAACCTGG - Intronic
1188199885 X:27284621-27284643 TTGTAAATGGGGGAACAACCTGG + Intergenic
1188219352 X:27522163-27522185 GATTACAGGCGTGAACCACCAGG + Intergenic
1189726658 X:43974035-43974057 CATTTAATGGATGAACAACCCGG - Intergenic
1189796858 X:44653623-44653645 TATTACAGGTGTGAACCACAGGG + Intergenic
1192217581 X:69173814-69173836 AATTACAGGAGTGAGCAACCAGG + Intergenic
1192345246 X:70297996-70298018 GATTACAGGCGTGAACCACCGGG - Intronic
1193906595 X:87252824-87252846 TATTGGATGGGGGTACAACCAGG + Intergenic
1197111696 X:122782519-122782541 TACAACATGGGTGAACCACAAGG + Intergenic
1197211243 X:123829945-123829967 GATTACAGGTGTGAACCACCAGG - Intergenic
1197747484 X:129941679-129941701 GATTACAGGCGTGAGCAACCGGG - Intergenic
1197929706 X:131681716-131681738 GATTACAGGGGTGAGCCACCGGG + Intergenic
1199933006 X:152544186-152544208 TATTTCTTGGGTAAACAGCCAGG + Intergenic
1200799213 Y:7370492-7370514 GATTACAAGCGTGAACCACCGGG + Intergenic
1201562767 Y:15335041-15335063 AATTACAGGTGTGCACAACCAGG + Intergenic
1201906959 Y:19095450-19095472 AATTACATGTGTGAACCACTGGG - Intergenic