ID: 1106099837

View in Genome Browser
Species Human (GRCh38)
Location 13:26684612-26684634
Sequence TGTGATTTTGATATTTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 819
Summary {0: 1, 1: 0, 2: 3, 3: 68, 4: 747}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106099837 Original CRISPR TGTGATTTTGATATTTTGGG TGG Intronic
900170403 1:1265353-1265375 TGGTATTTTGGTATTTTGGCAGG + Intronic
900661343 1:3785833-3785855 TGATTTTTTGATATTTTGGTGGG - Intronic
901523733 1:9806031-9806053 TGTAATCTTAACATTTTGGGAGG + Intronic
902266458 1:15270290-15270312 TTTTATTTTAATATTTTGGGTGG + Intronic
902341760 1:15788032-15788054 TGTAATTTTAACACTTTGGGAGG + Intergenic
903545747 1:24122362-24122384 TTTTATTTTTATTTTTTGGGTGG + Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
904547987 1:31291645-31291667 TGTGATTTTTATATGTAGGCTGG - Intronic
905596434 1:39211624-39211646 TGTAATCCTGACATTTTGGGAGG + Intronic
905819330 1:40977841-40977863 TGTGATCCTGACACTTTGGGAGG - Intergenic
906422756 1:45684679-45684701 TGAGATATTGATTTTTTGGGGGG - Intronic
907875687 1:58485106-58485128 TGGGATTTTGATGGTATGGGAGG + Intronic
908190405 1:61697459-61697481 TGTAATTTCAACATTTTGGGAGG - Intronic
909099858 1:71336849-71336871 TGTGATCTTGGTCTCTTGGGTGG - Intergenic
909239766 1:73197403-73197425 TTTGCTTTTGATAATTAGGGTGG - Intergenic
909460230 1:75903750-75903772 ACTGATTTTTATATTTTTGGTGG + Intronic
909961389 1:81848304-81848326 TTTTATTTTGATTTTTTTGGTGG + Intronic
910298635 1:85679947-85679969 TGTAATTCCGACATTTTGGGAGG + Intronic
910313930 1:85860323-85860345 TATGATAATGAGATTTTGGGGGG - Intronic
911254639 1:95619940-95619962 TGTTATATTGTTATTTTGGAAGG + Intergenic
911588715 1:99721483-99721505 TTAGATTTTGAGATTTTTGGGGG - Intronic
912616472 1:111105273-111105295 TGTAATCTCAATATTTTGGGAGG - Intergenic
912892237 1:113546631-113546653 TGTAAGTGTGATATTTTGGCTGG - Intronic
912992874 1:114506715-114506737 TGTTTTTGTGATTTTTTGGGGGG - Intronic
913357915 1:117944484-117944506 TATGAATTTGATGTTTAGGGAGG - Intronic
914714795 1:150245693-150245715 TATGATTTAGAGATTTTGGCTGG + Intergenic
914864337 1:151413799-151413821 TGTAATTCTGGTACTTTGGGAGG - Intronic
914920403 1:151843281-151843303 TGTAATTTTAACACTTTGGGAGG + Intergenic
915101590 1:153504694-153504716 AGTGTTTTAGATATTTTGAGGGG + Intergenic
915182356 1:154073332-154073354 TGTGGGTTTCATACTTTGGGAGG - Intronic
915411695 1:155705955-155705977 TGTGATCCTAGTATTTTGGGAGG - Intronic
916030052 1:160868424-160868446 TGTAATCTTAACATTTTGGGCGG + Intergenic
916398153 1:164414230-164414252 TTTGATTTTTACATTTTAGGGGG + Intergenic
916782060 1:168044311-168044333 TGTCATATTGTTATTTTGGGAGG - Intronic
917148066 1:171914044-171914066 TGTAATTTTAATACTTTGGGAGG - Intronic
917428488 1:174940532-174940554 TGTGATTCTAGTATTTTGGGAGG - Intronic
917722900 1:177802915-177802937 TCTGATTTTGGTATTTGAGGAGG + Intergenic
917753812 1:178079232-178079254 TGTAATCTTAGTATTTTGGGAGG - Intergenic
918468405 1:184845502-184845524 TGTAATTTTAATACTTTGGGAGG + Intronic
918485778 1:185027048-185027070 TGTAATCTTGGCATTTTGGGAGG - Intergenic
918569963 1:185978677-185978699 TTTTATTTTTATATTTTGGGTGG + Intronic
918573032 1:186021328-186021350 TTTGAGTTTTAGATTTTGGGGGG + Intronic
918783496 1:188732765-188732787 TGAGATTTTGAGATTTGGGTGGG + Intergenic
918811306 1:189124476-189124498 TGAGATATTGTAATTTTGGGGGG + Intergenic
919088216 1:192946880-192946902 TGTAATTTCAACATTTTGGGAGG - Intergenic
919102233 1:193108925-193108947 ATTGAATTTGATATTTTGGAAGG + Intergenic
919628212 1:199933375-199933397 TGTAATCTTGACACTTTGGGAGG + Intergenic
919632339 1:199971523-199971545 TGTGATCCTGGTACTTTGGGAGG + Intergenic
920277313 1:204816114-204816136 TAAGATTTTCATTTTTTGGGGGG - Intergenic
920595965 1:207270365-207270387 TCTGATTTAGATATTTTGCAGGG - Intergenic
921312765 1:213861063-213861085 TGTAATCTCGACATTTTGGGAGG - Intergenic
921788978 1:219267932-219267954 TGTGATTTTGATATGTAGCTTGG + Intergenic
921837915 1:219796550-219796572 TGTAATTTTAACATTTTGGGAGG + Intronic
922050245 1:221982471-221982493 TATGATTTTCACATTTTGAGAGG + Intergenic
922249192 1:223831857-223831879 TGTGACTTTGAATTTTTGGAAGG - Intronic
922918015 1:229274319-229274341 TGTGATCTCAACATTTTGGGAGG - Intronic
923644344 1:235801419-235801441 TGTGATTTAGGTATTTGAGGGGG - Intronic
923807596 1:237275891-237275913 TGTGGTTTTTATTTTTTAGGGGG - Intronic
924361265 1:243243780-243243802 TGTGATCTCAATACTTTGGGAGG - Intronic
924590111 1:245395721-245395743 CGTGATTATGACACTTTGGGGGG - Intronic
1063305210 10:4892307-4892329 TGTGATCTCAATATTTAGGGAGG - Intergenic
1063668199 10:8078851-8078873 TGTAATTCTAACATTTTGGGAGG + Intergenic
1064427905 10:15246078-15246100 TGTGAGCCTGATAATTTGGGGGG - Intronic
1064532270 10:16322566-16322588 TGTAATCCTGATACTTTGGGAGG - Intergenic
1064553917 10:16529288-16529310 TGTAATTGTGGCATTTTGGGAGG - Intergenic
1064774649 10:18762802-18762824 TGTATTTTTTATATTTTGGCTGG - Intergenic
1065036827 10:21647876-21647898 TGTTTTTTTTATTTTTTGGGGGG + Intronic
1065709905 10:28505990-28506012 TATGATTTTGAAAGTTTTGGAGG - Intergenic
1065746985 10:28851295-28851317 TGTAATCTTGGCATTTTGGGAGG + Intronic
1065747313 10:28854278-28854300 TGCGATTCCAATATTTTGGGAGG - Intronic
1066351857 10:34643090-34643112 TGTGATTTTTATGTTGTGGGGGG - Intronic
1066500534 10:35989367-35989389 TGTGATTTTCATAATTTTGTAGG - Intergenic
1066646256 10:37612937-37612959 TTTGATTTTCATATATTTGGGGG + Intergenic
1068357510 10:55928738-55928760 TGTAATTTCGACAATTTGGGAGG - Intergenic
1068456026 10:57255228-57255250 TGTGAAACTGATGTTTTGGGGGG + Intergenic
1068531678 10:58195661-58195683 TGTGCTTTCGAGATTTTGGTAGG + Exonic
1069073252 10:64011948-64011970 TATGGTTTTGAAATTTTGAGAGG + Intergenic
1069396457 10:67994686-67994708 TGTAATTCTGACACTTTGGGAGG - Intronic
1070209280 10:74298751-74298773 TTTGTTTTTGTTTTTTTGGGGGG - Intronic
1071253995 10:83850341-83850363 TGTAATCCTGATATTTTGGGAGG - Intergenic
1071441226 10:85698114-85698136 TGTAAATTTGATATTTTCGGTGG - Intronic
1071560242 10:86640725-86640747 TGTGATCCTAATACTTTGGGAGG + Intergenic
1071667135 10:87569740-87569762 TTTGTTTTTGTTTTTTTGGGGGG - Intergenic
1072147685 10:92656991-92657013 TGTAATTTCAGTATTTTGGGAGG + Intergenic
1072339411 10:94432087-94432109 AGAAATTTTAATATTTTGGGGGG + Intronic
1072604748 10:96970873-96970895 TGTAATTCTAATACTTTGGGAGG - Intronic
1072794127 10:98341378-98341400 CGTGATGTTGATATATTGAGTGG + Intergenic
1073223631 10:101897366-101897388 TTTTATTTTCATACTTTGGGAGG - Intronic
1073329031 10:102658923-102658945 TGTAATCCTGACATTTTGGGAGG + Intergenic
1073750515 10:106521345-106521367 TGCAGTTTTTATATTTTGGGAGG + Intergenic
1073765535 10:106678372-106678394 TGGGATTCTGATATTTTGAGCGG - Intronic
1073886431 10:108044678-108044700 TGTGATTCTAGCATTTTGGGAGG + Intergenic
1074009948 10:109468176-109468198 TGTAATTTTAGTACTTTGGGAGG - Intergenic
1074940140 10:118228162-118228184 TATAATCTTGACATTTTGGGAGG + Intergenic
1075771498 10:124941346-124941368 TATGAATTGGATTTTTTGGGGGG + Intergenic
1076178328 10:128385882-128385904 TGTGATTTTGTTTTTTTGCTAGG - Intergenic
1077774465 11:5255926-5255948 TGGGATTTTTATTTTTTGGTAGG + Intronic
1078137768 11:8666078-8666100 TGTAATTCTGGTACTTTGGGAGG + Intronic
1078192619 11:9104377-9104399 TGTAATCCTGATACTTTGGGAGG - Intronic
1078760439 11:14247149-14247171 TGTAATCTTAACATTTTGGGAGG + Intronic
1080116325 11:28625012-28625034 TAAGAATTTGATATTTTGGATGG + Intergenic
1081410374 11:42750669-42750691 TTTGATGTTGCAATTTTGGGGGG + Intergenic
1081624211 11:44637968-44637990 TGTGGTTTTTTTTTTTTGGGGGG - Intergenic
1082044325 11:47712781-47712803 TGTAATCTTGGCATTTTGGGAGG + Intronic
1082105931 11:48221757-48221779 TGTAATTCTAACATTTTGGGAGG - Intergenic
1082874908 11:57978156-57978178 TCTGATTGTCATATCTTGGGAGG + Intergenic
1083094416 11:60234783-60234805 TGCCATTTTGTTATTTTGGGGGG - Intronic
1083099368 11:60286903-60286925 TGACATTTTATTATTTTGGGGGG + Intronic
1083565227 11:63709299-63709321 TTTGATTTTGATTTTGTTGGAGG - Intronic
1084025803 11:66448541-66448563 TGTAATTCCAATATTTTGGGAGG - Intronic
1084852499 11:71953795-71953817 AGGGTTTATGATATTTTGGGGGG + Intronic
1085595997 11:77810552-77810574 TTTTATTTTTATTTTTTGGGGGG + Intronic
1085990131 11:81831401-81831423 TGTGATTTTTTTTTTTTTGGTGG - Intergenic
1086874936 11:92084200-92084222 TCAGATTTTGATAGTGTGGGAGG - Intergenic
1086931818 11:92701864-92701886 TGTTTTTTTGTTGTTTTGGGTGG + Intronic
1087233941 11:95697380-95697402 TGTACTTTTCAAATTTTGGGTGG - Intergenic
1087935797 11:104033471-104033493 TGTAATTTTTTTACTTTGGGTGG - Intronic
1088009114 11:104977613-104977635 TGTAGTCTTAATATTTTGGGAGG + Intergenic
1088262451 11:107957018-107957040 TGAGGTTTTGATATTTTTAGTGG + Intronic
1088482652 11:110309964-110309986 TTTGTTTTTGTTTTTTTGGGTGG - Intergenic
1088487228 11:110352491-110352513 TGTAATTTCAAAATTTTGGGAGG + Intergenic
1088643767 11:111899012-111899034 GTTGATTCTGATTTTTTGGGGGG + Intergenic
1089074139 11:115724238-115724260 TGTCATTCTGATACTTTGGGAGG - Intergenic
1089517670 11:119044103-119044125 TGTCATCTTAACATTTTGGGAGG - Intergenic
1089854410 11:121529937-121529959 TTTTATTTAGATTTTTTGGGGGG + Intronic
1090374039 11:126276617-126276639 TGTAATCTTGGCATTTTGGGAGG + Intronic
1090498925 11:127242729-127242751 TCTGATTGTTATATTTTGGATGG - Intergenic
1091204974 11:133814486-133814508 AGTGATCATGATATTTTGGGTGG - Intergenic
1091336487 11:134772288-134772310 TGTAATTCTAATACTTTGGGAGG + Intergenic
1091418075 12:308050-308072 TGAGGATTTGGTATTTTGGGGGG - Intronic
1091577019 12:1747055-1747077 TGTTTTTTTTATTTTTTGGGGGG - Intronic
1092111622 12:5968603-5968625 TGTGGTTTTGCTATGTTGGCTGG - Intronic
1092660709 12:10735032-10735054 TGTAATTTCAATACTTTGGGAGG + Intergenic
1092667047 12:10813409-10813431 TGTAATCTTAACATTTTGGGAGG - Intergenic
1092864824 12:12751043-12751065 TGTGATCCTGACAATTTGGGAGG - Intronic
1092950267 12:13496459-13496481 TGTAATTTTTTTTTTTTGGGGGG + Intergenic
1093138915 12:15484327-15484349 AGTGATTTTGCCATTCTGGGTGG - Intronic
1093495323 12:19750364-19750386 TGTTATTCTTATATTTTTGGAGG + Intergenic
1093535850 12:20221733-20221755 ATTGATTATTATATTTTGGGGGG - Intergenic
1094565737 12:31597051-31597073 TGTGATTTTCTTTTTTTGGAAGG + Intergenic
1094601809 12:31915536-31915558 TGTAATTTCAATACTTTGGGAGG - Intergenic
1094620779 12:32078445-32078467 TGTGAGAAGGATATTTTGGGAGG - Intergenic
1095129642 12:38524323-38524345 TGTTGTTTTTATTTTTTGGGGGG - Intergenic
1095419195 12:42007716-42007738 TGTAATCCTAATATTTTGGGAGG + Intergenic
1096039972 12:48506732-48506754 TGGGATATTGATAGTTGGGGAGG + Intergenic
1096200968 12:49682601-49682623 TGTGATTTCAATGTTTTGGGAGG - Intronic
1096268162 12:50141306-50141328 TGTAATTTTAACACTTTGGGAGG - Intronic
1096361331 12:50990278-50990300 TGTGATTTAGAGATTCGGGGTGG - Intronic
1097313948 12:58152235-58152257 TGTTATTTTGAGACTTTGGAAGG - Intergenic
1097424992 12:59433212-59433234 TGTGACTTTGATGCCTTGGGGGG + Intergenic
1098387054 12:69930560-69930582 TGTAATCTTAATACTTTGGGAGG + Intronic
1098579273 12:72079708-72079730 TGTAATCTCAATATTTTGGGAGG + Intronic
1098985366 12:77006369-77006391 TTTGCTTTTGATATTTTTCGAGG + Intergenic
1099085301 12:78239126-78239148 TGTAGTTTTGAAATTTTGGGTGG + Intergenic
1099335489 12:81351639-81351661 TGTAATTTCAGTATTTTGGGAGG + Intronic
1099501931 12:83424070-83424092 TGGGATGTTGATAGTTGGGGAGG - Intergenic
1100512048 12:95285185-95285207 TGTAATCCTGATACTTTGGGAGG + Intronic
1100614070 12:96217318-96217340 TGTGATTCTGATTTTTTGGAAGG + Intronic
1100641518 12:96485984-96486006 TGTGATCTCAATACTTTGGGAGG - Intergenic
1100802617 12:98249386-98249408 TGTATTTGTGGTATTTTGGGGGG - Intergenic
1100876828 12:98970979-98971001 TGTGGTTCTGAAATTTGGGGTGG - Intronic
1101913562 12:108879262-108879284 TGTAATTCTGACACTTTGGGAGG - Intronic
1101977662 12:109375407-109375429 TGTAATCTTAACATTTTGGGAGG - Intronic
1103113392 12:118303002-118303024 TGATATTTTGATTGTTTGGGTGG - Intronic
1103251977 12:119507909-119507931 TGTCATTCCAATATTTTGGGAGG + Intronic
1103296076 12:119888367-119888389 TGTGATTTCAGTATTTTGGGAGG + Intergenic
1103352916 12:120297871-120297893 TATAATTTTTAAATTTTGGGGGG + Intergenic
1103504807 12:121435075-121435097 TGTAATTCTAACATTTTGGGAGG + Intronic
1103974552 12:124693938-124693960 TGTAATCCTAATATTTTGGGAGG + Intergenic
1104158767 12:126158688-126158710 TGTAATTTTGGCACTTTGGGAGG - Intergenic
1104389621 12:128380651-128380673 TGTGATCCTGGTATTTTGGGAGG + Intronic
1104563984 12:129863776-129863798 TCTGTTTTTGTTTTTTTGGGGGG + Intronic
1104795693 12:131515813-131515835 TGTAATTCTGGTACTTTGGGAGG - Intergenic
1106099837 13:26684612-26684634 TGTGATTTTGATATTTTGGGTGG + Intronic
1106270334 13:28146719-28146741 TGTAATCCTGATACTTTGGGAGG + Intronic
1106328084 13:28714036-28714058 TGTAATCCTCATATTTTGGGAGG + Intronic
1106357901 13:29001656-29001678 TGGGATATGGACATTTTGGGGGG - Intronic
1106799163 13:33238529-33238551 AGTGATTTTGAAATTTTGGTTGG + Intronic
1107364708 13:39657635-39657657 TGTTATTTTGAAATATTGGCTGG - Intronic
1107605728 13:42054152-42054174 TGTGTTTTTGAAATTGTAGGTGG + Intronic
1107724423 13:43283705-43283727 TGTAATTTTAACACTTTGGGAGG - Intronic
1108017889 13:46095302-46095324 TTTAATTTTGATATCTTGGCTGG - Intronic
1109402628 13:61855362-61855384 TGTAATTTTTAAATTTTTGGAGG - Intergenic
1109858077 13:68159683-68159705 TGTGTTTTTGACATTTTTAGTGG - Intergenic
1110045835 13:70829314-70829336 TGTAATTTCAACATTTTGGGAGG + Intergenic
1110087394 13:71398325-71398347 TTAAATTTTCATATTTTGGGTGG - Intergenic
1110623214 13:77622603-77622625 TGTAATTCTGGTACTTTGGGAGG + Intronic
1110785310 13:79517521-79517543 TGTAATTTTGATATCTTTGCCGG - Intronic
1111341323 13:86890421-86890443 TGTAATTCTGGTACTTTGGGAGG + Intergenic
1111516273 13:89335779-89335801 TGGGATGTTGATAGTTGGGGAGG + Intergenic
1111616036 13:90663102-90663124 TGTGATTTTTTTTTTTTGGATGG + Intergenic
1111817146 13:93168160-93168182 TGGAATTATGAGATTTTGGGAGG - Intergenic
1111944021 13:94644755-94644777 TTGGATTTTAATATTTTGAGAGG + Intergenic
1111984636 13:95053718-95053740 TGTAATCTTAGTATTTTGGGAGG + Intronic
1112140783 13:96639591-96639613 TGTTATTTGGATATATTGTGTGG + Intronic
1112338104 13:98531242-98531264 CTTGATTTTCAGATTTTGGGAGG - Intronic
1112492021 13:99875415-99875437 TGGGCTTTCAATATTTTGGGAGG - Intronic
1112514024 13:100036508-100036530 TGTAATTTTAGCATTTTGGGAGG + Intergenic
1112514037 13:100036635-100036657 TGTAATTTTAGCATTTTGGGAGG + Intergenic
1112831426 13:103457224-103457246 TGTAATCCCGATATTTTGGGAGG - Intergenic
1113195647 13:107802407-107802429 TATGATTTTGGTATTTTTAGTGG - Intronic
1113664127 13:112129093-112129115 TCAGTTTTTGATATTTTGAGGGG - Intergenic
1114042039 14:18688019-18688041 TGAGATGTTAATATTTGGGGAGG + Intergenic
1115068196 14:29291484-29291506 TGGGATTATGAGATTTTAGGAGG - Intergenic
1115092742 14:29598017-29598039 TGTAATTCTAACATTTTGGGAGG + Intronic
1115467188 14:33728287-33728309 TATTATTTTCATATTTTAGGTGG + Intronic
1116683008 14:47999654-47999676 TGCTATTTTGAGATTGTGGGAGG + Intergenic
1116916266 14:50529124-50529146 TGTAATTTCAATACTTTGGGAGG + Intronic
1116970288 14:51057605-51057627 TATGTATTTCATATTTTGGGTGG - Intronic
1117317657 14:54589386-54589408 TGTGGTATAGATATTTTGGTTGG + Intronic
1117680009 14:58194221-58194243 CATGATTTTGATAATTTGGCTGG - Intronic
1117753595 14:58949642-58949664 ATTGATTTTGGTATTTTGGGGGG + Intergenic
1117826227 14:59706394-59706416 TTTGAGTTTCATATTTTGTGTGG + Intronic
1118019051 14:61692252-61692274 TGTGATTCCAACATTTTGGGAGG - Intergenic
1118212522 14:63778769-63778791 TGTAATTTTGGCACTTTGGGAGG - Intergenic
1119203307 14:72775228-72775250 TTTCATTTTGTTTTTTTGGGGGG - Intronic
1119243643 14:73084554-73084576 TGTGTTTTTTATTTTTTTGGAGG + Intronic
1119610475 14:76057485-76057507 TGTAATTCTAATACTTTGGGAGG - Intronic
1120416569 14:84226415-84226437 TGTACTTTTTATAGTTTGGGAGG + Intergenic
1120765073 14:88321539-88321561 TGTGCCTTTGCTTTTTTGGGGGG - Intronic
1120767915 14:88347655-88347677 GCTGATTTTTGTATTTTGGGGGG - Intergenic
1121771391 14:96545485-96545507 TCTGATTTTGATATGCTTGGTGG + Intronic
1121785237 14:96653809-96653831 TGTAATTCGAATATTTTGGGAGG - Intergenic
1122041832 14:98993254-98993276 TGTAATTTCAACATTTTGGGAGG + Intergenic
1122949048 14:105030655-105030677 TGTAATCCTGACATTTTGGGAGG + Intergenic
1124162037 15:27280154-27280176 TGTGATTTTTATATTTTCTTTGG + Intronic
1124264734 15:28222482-28222504 AGTTATTTTGCTTTTTTGGGGGG - Intronic
1124420595 15:29517978-29518000 TGTAATTCTAACATTTTGGGAGG + Intronic
1125126362 15:36226883-36226905 TGTGATTTTGTTCTTTTTTGTGG - Intergenic
1125268483 15:37912106-37912128 TCTTAATTTGATATTTTGGCAGG + Intergenic
1125958503 15:43808448-43808470 TGTAATCTTAACATTTTGGGAGG - Intronic
1126114314 15:45195086-45195108 TATAATTTCGATACTTTGGGAGG - Intronic
1126394997 15:48205470-48205492 TGTAATCTTGACACTTTGGGAGG + Intronic
1126616867 15:50591752-50591774 TGTGATTCTGGTACTTTGGGAGG - Intronic
1127071789 15:55294329-55294351 TGTAATTTCAATACTTTGGGAGG + Intronic
1127160482 15:56178880-56178902 TGTGTTTTTCATGTTTTGGTTGG - Intronic
1127309642 15:57740739-57740761 TGTGATTTTTTTCTTTTTGGAGG - Intronic
1127370923 15:58339749-58339771 TGTGGTTTTGGTATTTTGGTAGG + Intronic
1127431368 15:58912521-58912543 TATGAATTCGATATTGTGGGTGG - Intronic
1127729346 15:61784237-61784259 TTTTATTTTGATAGTTTTGGGGG - Intergenic
1128019468 15:64377926-64377948 TTTGTTTTTGTTTTTTTGGGGGG + Intronic
1129222586 15:74140252-74140274 TGTTATTTTGATGTCATGGGTGG - Intergenic
1129387820 15:75205563-75205585 TGTGATTTCAGCATTTTGGGAGG + Intronic
1129511869 15:76129965-76129987 CGTGATTTTAACACTTTGGGAGG + Intronic
1130065028 15:80595969-80595991 TGTGAGTTTGGAAGTTTGGGGGG + Exonic
1130412409 15:83657948-83657970 TGTGATTTTGGTGTTTGGGTGGG + Intronic
1130556474 15:84926457-84926479 TGTAATCCTAATATTTTGGGAGG - Intronic
1130687225 15:86049162-86049184 TGTGTTGGTGACATTTTGGGAGG - Intergenic
1131170219 15:90173073-90173095 TGTGGTCCTGATACTTTGGGAGG - Intronic
1131262509 15:90894808-90894830 TGTAATTTCAACATTTTGGGAGG + Intronic
1131459043 15:92605637-92605659 TTTGATTTTTCTTTTTTGGGGGG + Intergenic
1131637539 15:94252807-94252829 GGTAATTTTGAAATTTTTGGAGG + Intronic
1132994544 16:2816365-2816387 TTTGTTTTTGGTTTTTTGGGGGG - Intergenic
1133236823 16:4391297-4391319 TGTAATCTTGGCATTTTGGGAGG + Intronic
1133321526 16:4916759-4916781 TGTAATCCTAATATTTTGGGAGG - Intronic
1133526220 16:6608530-6608552 TGTAATTCTAATATTTTGGAAGG + Intronic
1133880056 16:9773127-9773149 TATGGTTTTGATATTTTTCGTGG + Intronic
1133925540 16:10189210-10189232 TGTAATTTCAATACTTTGGGAGG - Intergenic
1133971767 16:10573306-10573328 TGTAATTTTAGAATTTTGGGAGG - Intronic
1134616659 16:15656795-15656817 TGTAATCCTGATACTTTGGGAGG - Intronic
1135026161 16:19000760-19000782 TGTAATTTCAATACTTTGGGAGG + Intronic
1135225759 16:20655915-20655937 TGTAATACTGACATTTTGGGAGG - Intronic
1135357100 16:21778432-21778454 TGTAATCTTGGTACTTTGGGAGG + Intergenic
1135455604 16:22594548-22594570 TGTAATCTTGGTACTTTGGGAGG + Intergenic
1135621871 16:23962754-23962776 TTTAATTTTGATAGTTTTGGGGG + Intronic
1136035551 16:27537056-27537078 TGTGATATTGCTATTTTAGCAGG - Intronic
1136088033 16:27899458-27899480 TGTAATCCTGGTATTTTGGGAGG + Intronic
1136279958 16:29202540-29202562 TGTGATTGTGATCTTGTGTGGGG + Intergenic
1136605792 16:31332419-31332441 TGTGACTTTAATTTTTTGGATGG + Exonic
1136987912 16:35128555-35128577 AGTGATTTTAATATTATGGAAGG - Intergenic
1137026658 16:35482991-35483013 TGTGATTTTGCAGTTTTGGAAGG - Intergenic
1137225642 16:46504964-46504986 TGTAATCTTAGTATTTTGGGAGG - Intergenic
1138099164 16:54238034-54238056 TGAGATTTTTATTTTTGGGGTGG - Intergenic
1138545150 16:57714362-57714384 TGTAATCCTGATACTTTGGGAGG + Intronic
1138785419 16:59840033-59840055 TCTGCTTTTGATGTTTTGGAGGG + Intergenic
1139578833 16:67859750-67859772 TGTAATTTCAACATTTTGGGAGG - Intronic
1140292450 16:73673388-73673410 TGTGATTTTATGATTTTGGGGGG - Intergenic
1140499485 16:75421414-75421436 TTTGATATTGAGGTTTTGGGGGG - Intronic
1142337366 16:89498332-89498354 TGTGATCTTAATACTTTGGGAGG - Intronic
1143194543 17:5065690-5065712 TGTAATCTTGGAATTTTGGGAGG + Intergenic
1144043578 17:11434426-11434448 TGTTATTTTCATATTTGGAGTGG + Intronic
1144111035 17:12033090-12033112 TGTAATCTTGGCATTTTGGGAGG - Intronic
1144190524 17:12841340-12841362 TGTAATTCTAACATTTTGGGAGG + Intronic
1144200394 17:12936131-12936153 TGTGATGTTGACATTGGGGGAGG - Intronic
1144436030 17:15241993-15242015 TTTGATTAAGACATTTTGGGAGG + Intronic
1145103349 17:20094854-20094876 TGTAATTCCAATATTTTGGGAGG - Intronic
1145287884 17:21520124-21520146 TGTAATTTCAATACTTTGGGAGG - Intergenic
1146804176 17:35852022-35852044 TGGGATTTTGTTATGTTGGCTGG + Intronic
1147026061 17:37584817-37584839 TGTGCTTTTCTTAATTTGGGAGG - Intronic
1147383215 17:40067759-40067781 TGTAATCTCAATATTTTGGGAGG + Intronic
1147604466 17:41766462-41766484 TGTAATCCTGATACTTTGGGAGG + Intronic
1148485217 17:47986556-47986578 TGTGGATTTGATGTCTTGGGTGG - Intergenic
1148572384 17:48680534-48680556 TGTGATCTTGGCACTTTGGGAGG + Intergenic
1148572848 17:48684396-48684418 TGTAATTCTAACATTTTGGGAGG - Intergenic
1148580610 17:48740847-48740869 TCTGAATTTGATTTTATGGGTGG + Intergenic
1148631750 17:49115878-49115900 TGTAATTCCAATATTTTGGGAGG - Intergenic
1148788487 17:50158868-50158890 TGTAATCTTGGCATTTTGGGAGG + Intergenic
1148951327 17:51315170-51315192 TGTAATCTCAATATTTTGGGAGG + Intergenic
1149158127 17:53658308-53658330 TGTAATCCTGACATTTTGGGAGG - Intergenic
1149631406 17:58127630-58127652 TGTAATTGCGACATTTTGGGAGG - Intergenic
1150166804 17:62951665-62951687 TGTAATTTTAACACTTTGGGAGG - Intergenic
1150524419 17:65907374-65907396 TGTTAGTTTGATATTTTGCCAGG + Intronic
1150826014 17:68475960-68475982 TGTGATGTTGATTTTTTGGGGGG + Intergenic
1150995365 17:70311115-70311137 TGTTATTTCAATAGTTTGGGGGG + Intergenic
1151004458 17:70417555-70417577 TTTAATTTTGATAGTTTTGGGGG - Intergenic
1151061311 17:71097632-71097654 TGTGATATTGATAGTGGGGGAGG + Intergenic
1151078161 17:71297881-71297903 TGTGATCATCCTATTTTGGGGGG - Intergenic
1151709147 17:75790672-75790694 TGTAATCTTGACACTTTGGGAGG + Intronic
1151914561 17:77107998-77108020 TGTAATTTTAACACTTTGGGAGG - Intronic
1152173426 17:78769758-78769780 TGTAATTCTGACACTTTGGGAGG + Intronic
1152393549 17:80017423-80017445 TGTAATCTTGGTACTTTGGGAGG + Intronic
1152994929 18:397619-397641 TGTCAGTTTGGTTTTTTGGGTGG + Intronic
1153073360 18:1132352-1132374 TGAGATTTTGAGATTTTGAAAGG - Intergenic
1153276859 18:3376157-3376179 TGAAATCTCGATATTTTGGGAGG + Intergenic
1153294190 18:3530147-3530169 TGTAATTCTGGCATTTTGGGAGG + Intronic
1153762803 18:8348092-8348114 TGTCATTTTGATTTCTTGGGTGG - Intronic
1154151176 18:11907857-11907879 TATTTTTTTCATATTTTGGGGGG - Intronic
1154978237 18:21479995-21480017 TGTAATCCTGATACTTTGGGAGG - Intronic
1155369477 18:25082512-25082534 TTTGAGTTTTATATTTTGTGTGG + Intronic
1155406135 18:25489466-25489488 TGTGGTTGTGATTTTTTGCGGGG + Intergenic
1155482640 18:26305870-26305892 TGTGATTAGGTTAATTTGGGTGG + Intronic
1155881221 18:31150742-31150764 TGTCATTTTGATATTTTAGCTGG + Intronic
1155940963 18:31801752-31801774 TGGGATTTTGGTGTTTTGGGTGG - Intergenic
1155993308 18:32303659-32303681 TGTAATCTTGGTATTTTGGGAGG + Intronic
1156357225 18:36352153-36352175 TGTAATCTTCACATTTTGGGAGG + Intronic
1158093692 18:53745921-53745943 TGATATGTTAATATTTTGGGGGG - Intergenic
1158151738 18:54381780-54381802 TTTCATTTTAATGTTTTGGGTGG + Exonic
1159050019 18:63412781-63412803 TGTGATCCTGCTATTTGGGGAGG - Intronic
1159273548 18:66186630-66186652 TGATGTTTTCATATTTTGGGGGG - Intergenic
1159597637 18:70398004-70398026 TGTGTTTTTGATTTTTGGGGAGG - Intergenic
1159788258 18:72741582-72741604 TGTAATTCTGACATTTTGGGAGG + Intergenic
1160288634 18:77570120-77570142 TGATATTTTGGTATTTTGGCAGG - Intergenic
1161883575 19:6975317-6975339 TGGGATTTTGCCATGTTGGGCGG - Intergenic
1162014286 19:7835978-7836000 TGTGATCTCGGTACTTTGGGAGG + Intronic
1162550131 19:11354119-11354141 TGTAATCCTAATATTTTGGGAGG + Intronic
1162581129 19:11531143-11531165 TGTAATTCTGACACTTTGGGAGG - Intergenic
1162950546 19:14069744-14069766 TGTAATTTTAACACTTTGGGAGG - Intergenic
1163038235 19:14583972-14583994 TGTAGTCTTGATACTTTGGGAGG + Intronic
1163038924 19:14588229-14588251 TGTAGTCTTGATACTTTGGGAGG + Intronic
1163219747 19:15909865-15909887 TGTGCTTTTGAGATTTTGGTAGG + Intergenic
1164251823 19:23483763-23483785 TGTGATTTTTTTTTTTTGTGGGG - Intergenic
1164961792 19:32437928-32437950 TGTAATCTTGATACTTTGGGAGG - Intronic
1164993690 19:32703603-32703625 TGTGATCTCAACATTTTGGGAGG - Intronic
1165666785 19:37637443-37637465 TGTAATTCTGACACTTTGGGAGG - Intronic
1165750102 19:38254209-38254231 TGTAATCCTGACATTTTGGGAGG + Intronic
1165802003 19:38558050-38558072 TGTAATCTCGATACTTTGGGAGG + Intronic
1166262850 19:41653543-41653565 TGTGATTTTTTTTTTTTGGAGGG - Intronic
1166285953 19:41828586-41828608 TGTAATTTTAGTACTTTGGGAGG - Intergenic
1166708132 19:44919981-44920003 TGTAATTCTAATACTTTGGGAGG - Intergenic
1166740465 19:45111756-45111778 TGTGTTTTTTATTTTTTGCGGGG + Intronic
1166879042 19:45915800-45915822 TGTAATCCTAATATTTTGGGAGG + Intergenic
1166992573 19:46701362-46701384 TGTAATCTCGGTATTTTGGGAGG + Intronic
1167925070 19:52814628-52814650 TGTGATTTCAAAACTTTGGGAGG + Intronic
1167932259 19:52875483-52875505 TGTGATTTTTACATTTTTGGAGG + Intronic
1168504626 19:56922875-56922897 TGTAATTCTGGCATTTTGGGAGG + Intergenic
1168626222 19:57920291-57920313 TTTGCTTTTTATATTTTTGGGGG - Intergenic
925210060 2:2037783-2037805 TGTTTTTTTGTTTTTTTGGGGGG - Intronic
925395030 2:3527177-3527199 TGTGATTTTTCTCTTTTGAGGGG - Intergenic
925849988 2:8071099-8071121 AGTCATTTTCATATTTTAGGAGG - Intergenic
926192284 2:10737945-10737967 TGTAATTTCGGCATTTTGGGAGG - Intronic
927130756 2:20057370-20057392 TGAGATATGTATATTTTGGGAGG + Intergenic
928000684 2:27520678-27520700 TGTAACTTTAATATTTTGGTAGG + Intronic
928028497 2:27759007-27759029 TGTAATTTTAACACTTTGGGAGG + Intergenic
928045674 2:27928955-27928977 TGTGATCCTGACACTTTGGGAGG + Intronic
928063384 2:28137532-28137554 TGAGCTCTTGATCTTTTGGGAGG - Intronic
928154851 2:28867349-28867371 TGTAATCTCAATATTTTGGGAGG - Intronic
928828121 2:35444918-35444940 TGTCACTTTGTTACTTTGGGAGG + Intergenic
930902537 2:56525221-56525243 TGTGATTTTTTTCTTTTGTGTGG + Intergenic
931234732 2:60403651-60403673 TGCACTATTGATATTTTGGGCGG + Intergenic
931306070 2:61029688-61029710 TGTTATCCTGACATTTTGGGAGG + Intronic
931666581 2:64613503-64613525 TGGGATTTTCAGAATTTGGGAGG + Intergenic
931957330 2:67441862-67441884 TGTGTCTTTGATATTTTTAGGGG - Intergenic
932029968 2:68173367-68173389 TGCCATCTTGATATTTTGGAAGG - Exonic
932139272 2:69261248-69261270 TGTGATTTTGTTTATTGGGGTGG - Intergenic
932428552 2:71659290-71659312 TGAGATTTTGATAGGCTGGGAGG + Intronic
932473617 2:71983245-71983267 TGTAATTTTGATAGCTTTGGGGG - Intergenic
932971285 2:76546075-76546097 TGTGATTTTTACATTTTGAAAGG - Intergenic
933176673 2:79181290-79181312 GTGGATTTTCATATTTTGGGGGG + Intergenic
933251400 2:80033181-80033203 TGTGTTGTTGTTTTTTTGGGGGG - Intronic
933312930 2:80683367-80683389 GTAGATTTTGGTATTTTGGGAGG - Intergenic
933762866 2:85685278-85685300 ACTGATGTTTATATTTTGGGTGG + Intronic
933887279 2:86730246-86730268 TTTGTTTTTGTTTTTTTGGGGGG + Intronic
933922896 2:87066467-87066489 TTTGTTTTTGTTTTTTTGGGGGG - Intergenic
937171842 2:119880006-119880028 TTTAATTTTGAAATTATGGGGGG + Intronic
937424290 2:121785412-121785434 TGTGATCTTGGCACTTTGGGAGG + Intergenic
937875683 2:126823629-126823651 TTTGTTTTTGATAAATTGGGGGG + Intergenic
938268177 2:129944513-129944535 TGAGATGTTAATATTTGGGGAGG - Intergenic
939169196 2:138674408-138674430 TGTAATCCTGACATTTTGGGAGG - Intronic
939857850 2:147382033-147382055 TGGGATGTTGATAATTGGGGAGG + Intergenic
940358847 2:152775664-152775686 TGTAATTTTGGCACTTTGGGAGG + Intergenic
941627540 2:167845710-167845732 TGTGATTTTGTTGTTGCGGGGGG - Intergenic
941910499 2:170760026-170760048 TGTAATTTTAATGCTTTGGGAGG - Intergenic
942239149 2:173943025-173943047 GGGGATTTTGATATTCTAGGGGG + Intronic
942936827 2:181567492-181567514 TCTTTTTTTGATATTGTGGGTGG + Intronic
943341222 2:186684445-186684467 TGTAATCTTGACATTTTGGGAGG + Intergenic
943986219 2:194622561-194622583 TGTCAATTAGATATTTTGGCTGG + Intergenic
944289816 2:197992518-197992540 TGTAATTTCGACACTTTGGGAGG - Intronic
944324358 2:198386385-198386407 TGTAATTTTTATCTTTTGGAAGG + Intronic
944433433 2:199660693-199660715 TGTGGGATTCATATTTTGGGTGG - Intergenic
944574625 2:201079697-201079719 TGTAATTTTAACACTTTGGGAGG - Intronic
945465250 2:210161966-210161988 TGTGATCCTAGTATTTTGGGAGG + Intronic
945536039 2:211019130-211019152 TTTCATTTTCATAGTTTGGGGGG + Intergenic
946002971 2:216498495-216498517 TGTGATTCTAACACTTTGGGAGG - Exonic
946150223 2:217760477-217760499 TGTGTTTTTGTTTTTTGGGGGGG - Intergenic
946319099 2:218938771-218938793 TGTAATTTCAATACTTTGGGAGG - Intergenic
946407512 2:219499585-219499607 TGTGAATTTCAGAATTTGGGAGG + Intronic
946749443 2:222879058-222879080 TGTAATTTCGACACTTTGGGAGG + Intronic
947114772 2:226757356-226757378 TGTGATCTTGGCACTTTGGGAGG + Intronic
947152403 2:227129021-227129043 TATGATTATAATATTTTTGGAGG - Intronic
948006005 2:234607984-234608006 TGTAATCTTGAAACTTTGGGAGG + Intergenic
948068506 2:235100909-235100931 TGTAATTCTGGCATTTTGGGAGG + Intergenic
948410198 2:237753537-237753559 TGTAATTCTGGTACTTTGGGAGG + Intronic
948490681 2:238310620-238310642 TGTAATTTTGGTATTTTAGGAGG + Intergenic
948494810 2:238340471-238340493 TACCATTTTGATTTTTTGGGTGG + Intronic
948687830 2:239680917-239680939 TTTTATTTTGATTCTTTGGGTGG + Intergenic
1169133394 20:3180182-3180204 TAGGATTTGGACATTTTGGGTGG - Intergenic
1169666642 20:8044406-8044428 TATTATATTAATATTTTGGGGGG - Intergenic
1170027163 20:11901661-11901683 ACTGATTCTGACATTTTGGGGGG - Intronic
1170029698 20:11931922-11931944 TTTAATTTTGACATTCTGGGTGG - Intergenic
1170377903 20:15721715-15721737 TATGATTTGTGTATTTTGGGTGG + Intronic
1171804925 20:29668492-29668514 TGTAATTTCAATACTTTGGGAGG - Intergenic
1171956057 20:31464684-31464706 TGTGATGGGGAAATTTTGGGAGG - Intergenic
1171959192 20:31481671-31481693 AGTGCTTTTGATATTTTGGATGG - Intronic
1172137524 20:32697309-32697331 TGTAATCTTGATGCTTTGGGAGG + Intergenic
1172383300 20:34514917-34514939 CATGACTTTGAGATTTTGGGGGG + Intergenic
1173172049 20:40734701-40734723 TTTTATTTTGAAATTTTGGAGGG + Intergenic
1173351137 20:42246603-42246625 TGTGAGTGTGACTTTTTGGGAGG - Intronic
1174330996 20:49817322-49817344 TTTGTTTTTGTTTTTTTGGGGGG - Intronic
1174394518 20:50238460-50238482 TGTGATTTTGATGGTTATGGAGG + Intergenic
1174907351 20:54565506-54565528 TGTGATCTCAGTATTTTGGGAGG + Intronic
1175274470 20:57758628-57758650 TGTGATTTGTCTATTTTGGGAGG + Intergenic
1175710969 20:61220669-61220691 TGGGATTTGGATATTTGGGAGGG - Intergenic
1176923485 21:14718174-14718196 AGTGAGTTTGCCATTTTGGGAGG - Intergenic
1177633483 21:23756329-23756351 TGTGATTATGAAATCTTGGCCGG - Intergenic
1178098305 21:29238865-29238887 TTTGATTTTTATATTTGGGAAGG + Intronic
1178288986 21:31350335-31350357 TGTCACTTTAAAATTTTGGGGGG + Intronic
1179365916 21:40758604-40758626 CATGATTTTCTTATTTTGGGGGG + Intronic
1179481449 21:41681358-41681380 TGCGATTTGCTTATTTTGGGGGG - Intergenic
1180938132 22:19639395-19639417 TGATGTTTTGATATCTTGGGAGG + Intergenic
1182453808 22:30436689-30436711 TGTGATTCTAACACTTTGGGAGG + Intergenic
1182999876 22:34846979-34847001 TGTTTTTTTCATATTTTGGTGGG - Intergenic
1183765609 22:39870914-39870936 TGTAATTCTAACATTTTGGGAGG + Intronic
1183886653 22:40889279-40889301 TGTGATCTTAGTGTTTTGGGAGG - Intronic
1184543149 22:45143312-45143334 TGTAATTCTGACACTTTGGGAGG + Intergenic
1184599913 22:45537360-45537382 TGTAATTCTGGTACTTTGGGAGG + Intronic
1184647254 22:45903125-45903147 TGTGATTCACACATTTTGGGAGG - Intergenic
1185234271 22:49702927-49702949 TGCTTTTTTGATTTTTTGGGGGG + Intergenic
949092411 3:44265-44287 TGTGTATTTGAGATTTTGGTAGG + Intergenic
949352349 3:3136905-3136927 TGTAATCCTGATACTTTGGGAGG - Intronic
950317168 3:12013223-12013245 TGTAATCTTGACACTTTGGGAGG - Intronic
950782049 3:15400346-15400368 TGGGAGTTTCATATTTTGTGAGG + Intronic
951234230 3:20216008-20216030 TGTAATTCTGACACTTTGGGAGG + Intergenic
951370274 3:21837615-21837637 TGTAATCTTGACACTTTGGGAGG + Intronic
951436649 3:22672986-22673008 TGGGATGTTGATAGTTGGGGAGG + Intergenic
952373789 3:32748112-32748134 TGTAATTTCGATGCTTTGGGGGG - Intronic
952651497 3:35732681-35732703 TGTTATTTTGATATTTTTCTTGG + Intronic
952959134 3:38578937-38578959 TGTAATTTTAATACTTTGGGAGG - Intronic
953076442 3:39574921-39574943 TGTGAGTTTCTTAATTTGGGGGG + Intergenic
953148183 3:40299011-40299033 TGTGATTTGGTTGTTTTAGGTGG - Intergenic
953302465 3:41792257-41792279 TATGATTTTAAAATTTTGAGAGG + Intronic
953361221 3:42298820-42298842 TGTAATTCTGGTATTTTGGGAGG + Intergenic
953451178 3:43007732-43007754 TGTTATTTTCATATTTCAGGAGG + Intronic
953453032 3:43019860-43019882 TGTGATTTTGTCTGTTTGGGTGG + Intronic
954076428 3:48185153-48185175 TGTGATTCCAATACTTTGGGAGG + Intronic
954174487 3:48833294-48833316 TATAATTTTGGTACTTTGGGAGG - Intronic
955170964 3:56565115-56565137 TCTGATTTTGATATTATAGCTGG + Intronic
955298830 3:57757540-57757562 TGTTAATTTAAAATTTTGGGTGG + Exonic
955790604 3:62585229-62585251 TTTGATTTTGAGATCTTGGTCGG + Exonic
955878356 3:63518097-63518119 TTTGATTTTGATATTGTGTATGG - Intronic
955888682 3:63627276-63627298 TGTGATACTAAAATTTTGGGGGG + Intergenic
955959367 3:64323500-64323522 TGTGTTATTTTTATTTTGGGAGG + Intronic
956234578 3:67054452-67054474 TATAATTCTGACATTTTGGGAGG - Intergenic
956511322 3:69996377-69996399 TATGTTTTTGATATTTTGGGTGG - Intergenic
956556443 3:70528510-70528532 TGTGATGATGTTATTTTCGGGGG - Intergenic
956857755 3:73292619-73292641 TGATATTTTGATATTTTGTCTGG + Intergenic
957189176 3:76984183-76984205 TGAGATTATGAGATTTTGGGTGG + Intronic
957295718 3:78330440-78330462 AGTGATATTGGTATTTTGGATGG + Intergenic
957503104 3:81082293-81082315 AGTGATTTTTAAATTTTGGGGGG + Intergenic
957544839 3:81623925-81623947 TGTAATTTTCGTACTTTGGGAGG - Intronic
957803554 3:85117840-85117862 TATATTTTTTATATTTTGGGAGG + Intronic
958047058 3:88298187-88298209 TGTGATATTGGTATTTAGTGAGG + Intergenic
958509260 3:95024095-95024117 GATGATTTTGAGATTTTGAGGGG + Intergenic
958510610 3:95042540-95042562 TGTGATTTTGATGTGTTTGGTGG + Intergenic
958806914 3:98822803-98822825 TGTGTCTGTGATATTTTTGGGGG - Intronic
959006048 3:101021120-101021142 TGAGATATTTATAGTTTGGGTGG + Intergenic
959142220 3:102500041-102500063 TGTGATTCTAGCATTTTGGGAGG - Intergenic
959193518 3:103146226-103146248 GGTCATGTTGATATTTCGGGAGG - Intergenic
959382737 3:105661057-105661079 TGTAATTTTAGCATTTTGGGAGG - Intronic
959395264 3:105829400-105829422 TGTGATCTTGACGCTTTGGGAGG + Intronic
960161588 3:114355939-114355961 TGTGCATTTTTTATTTTGGGTGG - Intronic
960359573 3:116695352-116695374 TGTGTTTTTGATATTTCTTGAGG + Intronic
960600255 3:119450071-119450093 TCTAATTTAGATATTTTAGGAGG + Intronic
960981352 3:123230024-123230046 TGTAATCTTAATACTTTGGGAGG + Intronic
962109761 3:132432199-132432221 TTTGTTTTTGTTTTTTTGGGGGG + Intronic
962263830 3:133931637-133931659 TGTGAATCTGATTTTTTGGATGG - Intergenic
962434199 3:135349373-135349395 TGAGATTTTGAAATTTTTGCTGG - Intergenic
962491122 3:135895111-135895133 TGTGATTTCTATATTTAAGGAGG + Intergenic
962644715 3:137425683-137425705 TGTCATTTTCATGTTTTGGGGGG - Intergenic
962681350 3:137803249-137803271 TGTGATCTGGATATCTTTGGGGG - Intergenic
963186749 3:142427071-142427093 TGTAATCTCAATATTTTGGGAGG + Intronic
963224924 3:142852846-142852868 TGTAATCTTAATACTTTGGGAGG + Intronic
963268072 3:143258848-143258870 TGTGATTTTCCACTTTTGGGTGG + Intergenic
963322065 3:143819656-143819678 TGTCATTATTATAATTTGGGTGG + Intronic
963483565 3:145906190-145906212 TGTGATTTTGCTGTTTTTGTGGG + Intergenic
963637426 3:147816434-147816456 TGTGATCTCAGTATTTTGGGAGG - Intergenic
964155707 3:153582643-153582665 GGTGATGTTGATAATCTGGGAGG - Intergenic
964450932 3:156812568-156812590 TGTGGTTTTGAAATTCTGGGTGG - Intergenic
964508876 3:157427709-157427731 TGTAATTTCAACATTTTGGGAGG - Intronic
964573061 3:158132148-158132170 TATGATTTTTGTATTTTTGGCGG + Intronic
964937356 3:162107076-162107098 TATGATTTTGTTTTTTTGGAGGG + Intergenic
965270973 3:166617162-166617184 TGTAATTTCAACATTTTGGGAGG + Intergenic
965461299 3:168967653-168967675 TGTAATTGTAACATTTTGGGAGG + Intergenic
965984042 3:174729673-174729695 TTTGAATTTAATATTTTGAGTGG + Intronic
966028476 3:175315881-175315903 AGAAATTTTGATGTTTTGGGGGG + Intronic
966928687 3:184661898-184661920 TGTAATTTCAACATTTTGGGAGG - Intronic
969215072 4:5715068-5715090 TGTGATCTTGGCACTTTGGGAGG - Intronic
970037031 4:11748018-11748040 TGTTATTTTACTACTTTGGGAGG + Intergenic
970156957 4:13151441-13151463 TGTTATGATCATATTTTGGGGGG - Intergenic
970216565 4:13764966-13764988 TATGATTTTGATAGTAAGGGAGG + Intergenic
971050643 4:22858249-22858271 TTTATTTTTGATAATTTGGGAGG - Intergenic
971094239 4:23380770-23380792 TGTAATTTTGGTACTTTGAGAGG - Intergenic
971848537 4:31951591-31951613 TGTGCTTTTGATCTTTTCTGGGG - Intergenic
972172576 4:36364617-36364639 TGTGAGGTTGCTCTTTTGGGTGG + Intergenic
972284592 4:37636286-37636308 TCTGCTTTTTATATTTTGGATGG - Intronic
972539195 4:40024379-40024401 TGTAATCTCGACATTTTGGGAGG + Intergenic
973587182 4:52405226-52405248 TGTGATCTGAAGATTTTGGGGGG - Intergenic
973903698 4:55505156-55505178 TGTGATTTTTTTTTTTTGGTGGG - Intronic
973940919 4:55909838-55909860 TGTAATTTCCACATTTTGGGAGG + Intergenic
974065195 4:57071188-57071210 ACTGTTTTTGATATATTGGGGGG + Intronic
974183001 4:58407314-58407336 GGTGACCTTGATAATTTGGGTGG + Intergenic
974223970 4:59014585-59014607 TTTTGTTTTGTTATTTTGGGGGG + Intergenic
974232720 4:59137482-59137504 TAGGATGTGGATATTTTGGGGGG + Intergenic
974433409 4:61827750-61827772 TCTAATTTAGATAATTTGGGTGG + Intronic
975023357 4:69518522-69518544 TGTAAGTTTAATATTTTTGGAGG + Intronic
976434488 4:85001718-85001740 TGTCATTTGTATATTTTGTGAGG - Intergenic
976786287 4:88825211-88825233 TGTGAATTTTTTTTTTTGGGGGG + Intronic
976818696 4:89180235-89180257 TGGGATGTTGATAGTTGGGGAGG - Intergenic
976835110 4:89363018-89363040 TGTGTTTTTGAAATTTGTGGTGG + Intergenic
976853710 4:89578459-89578481 AGTCATTTAAATATTTTGGGAGG - Intergenic
977981443 4:103327711-103327733 TGTAATCCTGATACTTTGGGAGG + Intergenic
978389348 4:108208016-108208038 TGTAACTTTGATATATTGGATGG - Intergenic
979535294 4:121812745-121812767 TGTAATCCTAATATTTTGGGAGG - Intronic
979848564 4:125547458-125547480 TGTGTATTTTATATTTTTGGTGG + Intergenic
979958602 4:126988604-126988626 TGGGATTTTACCATTTTGGGAGG - Intergenic
980277004 4:130665860-130665882 TGTGATTTTGCTATTTTATTTGG + Intergenic
980928337 4:139160704-139160726 TGTAATTCTAGTATTTTGGGAGG + Intronic
981210982 4:142104706-142104728 TGTGATTTTGGTATCTTCTGGGG - Intronic
981224072 4:142270821-142270843 TGTGTTTTGGATATTTTTGGGGG - Intronic
981321008 4:143391282-143391304 TGTTATTTTTATTTTTTGGAAGG + Intronic
981425764 4:144601301-144601323 TGTGATTCCAACATTTTGGGAGG + Intergenic
982046461 4:151452075-151452097 TGTAATTCTAACATTTTGGGAGG - Intronic
982192458 4:152870948-152870970 TGTGATTCTGACTTTTTTGGTGG + Intronic
982228760 4:153189105-153189127 TGTGATTATAGCATTTTGGGAGG - Intronic
982257279 4:153463308-153463330 TGTAATTCCAATATTTTGGGAGG - Intergenic
982438614 4:155406861-155406883 GGTGATTTTGCTATTTTCTGTGG + Intergenic
982544876 4:156721848-156721870 AGTTTTTTTGATTTTTTGGGGGG + Intergenic
982545855 4:156732023-156732045 TGTAATCCTGGTATTTTGGGAGG + Intergenic
982865377 4:160504142-160504164 TATAATTTTTATATTTGGGGGGG + Intergenic
982917966 4:161237681-161237703 CTTGATTTTGATACTTTGGTTGG + Intergenic
983328727 4:166295473-166295495 TGTGATTTTTTTTTTTTTGGAGG - Intergenic
983593964 4:169445161-169445183 TGTAATTTCAATATTTTGGGAGG + Intronic
983801807 4:171940563-171940585 TGTGATTTCAACATTTTGAGAGG + Intronic
983921690 4:173352593-173352615 TCTGATTTTTATACTTTGGGGGG - Intergenic
983929743 4:173440380-173440402 TGGGAATTTGAAATTTTGGCAGG + Intergenic
984416330 4:179463721-179463743 TGTGTTTTTGCTACTTTGGTGGG - Intergenic
984427689 4:179608821-179608843 TGTAATTTTGGCACTTTGGGAGG + Intergenic
984887824 4:184466415-184466437 TGTGCTATTGAGATTGTGGGAGG - Intronic
985285198 4:188330148-188330170 TTTGTTTTTTATTTTTTGGGGGG + Intergenic
985943784 5:3161389-3161411 TGATATTTCTATATTTTGGGGGG - Intergenic
986434951 5:7720261-7720283 TGTGATTTGGATATTTGGAAGGG - Intronic
986637136 5:9834411-9834433 TGTGATTTTAATCTTTTGTGTGG + Intergenic
987137840 5:14916504-14916526 TGTGATTTTCATTTTTTCAGAGG + Intergenic
987895437 5:23940331-23940353 TCTGATTTTGATATTTTAGGAGG + Intergenic
987940098 5:24522671-24522693 TGTGTTTTTGATGTGTTGTGTGG - Intronic
989136232 5:38157874-38157896 TGTGTTTTTGTAATTCTGGGAGG - Intergenic
989823277 5:45821722-45821744 GGTGATTTTGTTATATTGTGAGG - Intergenic
990752146 5:59028400-59028422 TTTTATTTTATTATTTTGGGGGG - Intronic
991084044 5:62632130-62632152 TTTGATCTTGATATCTTGGTAGG + Intergenic
991966072 5:72092402-72092424 AGTGATTTTTCTCTTTTGGGTGG + Intergenic
992210690 5:74477026-74477048 TGTGATTTTTTTTTTTTGAGAGG - Intergenic
992732453 5:79686844-79686866 TGAGCTTTTCATATTTTGGGGGG + Intergenic
993518799 5:88872559-88872581 GGTGATTTAGAAATTTTTGGTGG - Intronic
994158440 5:96528814-96528836 TGTGGATGTGATATTTTGTGTGG - Intronic
994462900 5:100089647-100089669 TTTTATTTTGGTATTTTAGGTGG - Intergenic
995391406 5:111644267-111644289 TGTGATTTGGAGGCTTTGGGGGG - Intergenic
995931399 5:117450545-117450567 TGTGATTTTTATTTTATGGAAGG + Intergenic
996203744 5:120704614-120704636 AGTGATTCTGATGTTTAGGGAGG - Intergenic
996973367 5:129399658-129399680 TGTTAGATGGATATTTTGGGTGG + Intergenic
997001280 5:129765132-129765154 TGTTTTTTTGTTATTTTGGTGGG - Exonic
998020291 5:138764415-138764437 TGTGAGTTTGATCCCTTGGGAGG + Intronic
998817706 5:146030738-146030760 TGTGATTTTGAATTTATTGGGGG + Intronic
999695076 5:154181561-154181583 TTTGAGTTTCATATTTTGTGTGG + Intronic
999962980 5:156776721-156776743 TATGATTTTAAGAATTTGGGTGG - Intergenic
1000832161 5:166116302-166116324 AGGGATTTTCATATTTTTGGAGG + Intergenic
1000868428 5:166544079-166544101 TGTAATCTTGACACTTTGGGAGG - Intergenic
1000879010 5:166675117-166675139 TGTGATTTTGTTCATTTGGCTGG + Intergenic
1000879203 5:166677701-166677723 TGGGATTTTGAACTTGTGGGTGG - Intergenic
1000912777 5:167042512-167042534 GAAGAATTTGATATTTTGGGGGG + Intergenic
1001019632 5:168172209-168172231 GGTGTTATTGACATTTTGGGTGG - Intronic
1001799006 5:174527276-174527298 TGTGATTCTAGCATTTTGGGAGG + Intergenic
1002213836 5:177614067-177614089 TGTAATTTTAACACTTTGGGGGG - Intergenic
1002346626 5:178552377-178552399 TGTGTGTCTGATTTTTTGGGGGG - Intronic
1002495956 5:179611671-179611693 TGTGATTTCAACACTTTGGGAGG - Intergenic
1002721937 5:181266797-181266819 GGTGGTTTTGTTCTTTTGGGGGG - Intergenic
1005102845 6:22191883-22191905 TCACATTTTGAGATTTTGGGTGG + Intergenic
1005103073 6:22194679-22194701 TGTAATTTCAACATTTTGGGAGG + Intergenic
1005353028 6:24955092-24955114 TCTGGATTAGATATTTTGGGAGG + Intronic
1005702244 6:28413716-28413738 TGTGATCCTGGCATTTTGGGAGG - Intergenic
1006540841 6:34738519-34738541 TGTAATTTCAACATTTTGGGAGG - Intergenic
1006957464 6:37886736-37886758 TGTAATCCTGATACTTTGGGAGG + Intronic
1007089969 6:39177839-39177861 TGAGATCTTGCTATATTGGGAGG + Intergenic
1007301978 6:40874566-40874588 TCTGCTTCTGACATTTTGGGTGG + Intergenic
1008072497 6:47112090-47112112 TAATATTTTGAGATTTTGGGGGG - Intergenic
1008450644 6:51646684-51646706 TTTGATCTTGTTATATTGGGTGG - Intronic
1008606164 6:53141745-53141767 TGTGATCCTAGTATTTTGGGAGG + Intronic
1009524039 6:64720442-64720464 TAGGATTTAGACATTTTGGGAGG + Intronic
1009572044 6:65397544-65397566 CATGATTTTATTATTTTGGGTGG + Intronic
1009621773 6:66086661-66086683 GGCTATTTTGACATTTTGGGGGG + Intergenic
1010121227 6:72378124-72378146 TGTGATTTTGATTTTCAGTGTGG + Intronic
1010605061 6:77878753-77878775 TGTGAAATTGATATTTTTGTGGG + Intronic
1010919879 6:81668306-81668328 TGTAATTCTAACATTTTGGGAGG + Intronic
1011330129 6:86195390-86195412 TGTGTTTTTGTTTTTTTGAGGGG - Intergenic
1012154306 6:95797510-95797532 TGTGATGTTGAAATTATGGATGG + Intergenic
1012396761 6:98806973-98806995 TGTAATTCTAACATTTTGGGAGG - Intergenic
1012876085 6:104728732-104728754 TGGGTTTTTGAATTTTTGGGTGG - Exonic
1013026771 6:106282790-106282812 TGAGATTTTTTTATTTTGAGAGG + Intronic
1013087432 6:106868344-106868366 TGTAATTCCGACATTTTGGGAGG + Intergenic
1013557830 6:111274617-111274639 TGTGATTTTGTGATTTTCTGTGG + Intergenic
1014103458 6:117537245-117537267 TAAGAATTTGATATTTTCGGTGG + Intronic
1014367338 6:120561316-120561338 TGTGTTTCTGTTATTTTGGCTGG + Intergenic
1014537307 6:122629726-122629748 TGTGGCTATGAGATTTTGGGAGG - Intronic
1014538210 6:122642306-122642328 TTTGATTTTGAGATTTGGGCTGG - Intronic
1014874296 6:126637844-126637866 TGTAATCTTAGTATTTTGGGAGG - Intergenic
1015424216 6:133046810-133046832 TGAGATGTTGAGATTTTGTGGGG + Intergenic
1015959219 6:138630217-138630239 TGTGATTTTTTTTTTTTGGTGGG - Intronic
1016465735 6:144323076-144323098 TGTGATTCTGATCTTTTTAGAGG + Intronic
1016851447 6:148623472-148623494 TGTGTTGTTGGTATTTTTGGTGG + Intergenic
1017503720 6:155048347-155048369 TGTAATTTCAACATTTTGGGAGG - Intronic
1017796249 6:157847357-157847379 TGTGATTCTAGCATTTTGGGAGG - Intronic
1018442004 6:163822011-163822033 TGTGATTCTGAGATGTTGGTGGG + Intergenic
1018491562 6:164299063-164299085 TAAGATTTTAATATGTTGGGAGG - Intergenic
1019690778 7:2410389-2410411 TGTAATCCTGACATTTTGGGAGG + Intronic
1019743319 7:2686274-2686296 TGTGATCTCAACATTTTGGGAGG + Intronic
1019829850 7:3316921-3316943 TATAATTTTGGCATTTTGGGAGG + Intronic
1020666967 7:11057628-11057650 TGTGATCTTAGTACTTTGGGAGG - Intronic
1020863140 7:13520243-13520265 TGTAATTTTAGCATTTTGGGAGG - Intergenic
1020933409 7:14429174-14429196 TAGGATTTTAACATTTTGGGGGG - Intronic
1021453886 7:20808105-20808127 TGTTATTTTTATTTTTTGAGAGG - Intergenic
1023365282 7:39457729-39457751 TGTGATTTTCTTAATTTGGCAGG - Intronic
1023702782 7:42909458-42909480 TGTGCTTTTTCTACTTTGGGAGG + Exonic
1023920816 7:44628494-44628516 TGTAATCCTGATACTTTGGGAGG + Intronic
1024363506 7:48494275-48494297 TGTGATTTGGAGATTTTAGCAGG - Intronic
1024433959 7:49326972-49326994 TGTCAATTAGATATTTTGGCTGG - Intergenic
1024875386 7:54016615-54016637 TATAATTTTGACATTTTCGGAGG + Intergenic
1024907880 7:54409340-54409362 TTTCATTTGTATATTTTGGGGGG + Intergenic
1025864766 7:65371135-65371157 TGTAATTTTGGCAGTTTGGGAGG - Intergenic
1025974731 7:66360650-66360672 TGTAATTTTAGTACTTTGGGAGG - Intronic
1027454622 7:78373922-78373944 CATGATTTTGTTATTTTGTGTGG + Intronic
1027531763 7:79343235-79343257 TGTCACTTTGTAATTTTGGGGGG + Intronic
1027994017 7:85400414-85400436 TGTAATTCTGACACTTTGGGAGG - Intergenic
1028009597 7:85624437-85624459 TCTGACATTGATATTTTGAGAGG + Intergenic
1028110648 7:86936427-86936449 TGTGAATTTGAAATTTTTTGTGG - Intronic
1028124726 7:87099672-87099694 TGATATTTTGATATTTTGTTTGG + Intergenic
1028219463 7:88179547-88179569 TGTGATTTTGCCTTTTTTGGGGG + Intronic
1028226904 7:88262929-88262951 TGTAATTTTAATGCTTTGGGAGG - Intergenic
1028628999 7:92913072-92913094 TCAGAGTTTGATATTTTTGGTGG + Intergenic
1028832672 7:95344194-95344216 TCTGATATTCCTATTTTGGGGGG - Intergenic
1029674099 7:102054709-102054731 TGTGATTCTAACACTTTGGGAGG + Intronic
1030218696 7:107074540-107074562 TGTAATTTTGCCACTTTGGGAGG + Intronic
1030451444 7:109717785-109717807 TGTAATTTTGGCACTTTGGGAGG + Intergenic
1030518911 7:110572832-110572854 TGAGATTTTGAGATTCTGGTAGG - Intergenic
1030663273 7:112246125-112246147 TGTAATCTTACTATTTTGGGAGG + Intronic
1030679479 7:112419805-112419827 TGTAATTCTGACACTTTGGGAGG + Intergenic
1030724102 7:112904876-112904898 TCATATTTTGATATTTTGGGAGG + Intronic
1030814366 7:114016921-114016943 TGTAATCTTGGCATTTTGGGAGG + Intronic
1031053492 7:116969411-116969433 TGGGATTTTGAGTTTTTGGGAGG + Intronic
1031406975 7:121397165-121397187 TGTGTGTTTTATATTTTTGGAGG - Intergenic
1031641223 7:124166609-124166631 TTTGCTTTTGCTTTTTTGGGGGG - Intergenic
1031830513 7:126619945-126619967 TGTAATTCTGGCATTTTGGGAGG - Intronic
1031866710 7:127044897-127044919 TGTCATTTTTAAATTTTGGGTGG - Intronic
1032566562 7:132953213-132953235 TGTGAATTTAATATATTGGCAGG + Intronic
1032714573 7:134495329-134495351 TTTGATTTTAATAATTTAGGTGG - Intergenic
1033078499 7:138271796-138271818 TGTAATTTCAATACTTTGGGAGG + Intergenic
1033669293 7:143475613-143475635 TGTAATCTTGACATTTTGGGAGG + Intergenic
1033719501 7:144042959-144042981 TTTGTTGTTGATATTCTGGGTGG + Intergenic
1033729570 7:144162386-144162408 AGTATTTTTGATAATTTGGGGGG + Intergenic
1033733272 7:144198473-144198495 TGAGATTTTGATATTTTATTTGG + Intergenic
1033749779 7:144352500-144352522 TGAGATTTTGATATTTTATTTGG - Intergenic
1034093572 7:148386093-148386115 TGTAATTCTGATATTATGGTAGG + Intronic
1034641863 7:152610554-152610576 TGTAATTCTGACACTTTGGGAGG - Intergenic
1035056972 7:156042197-156042219 GGTGATGTTGTTGTTTTGGGAGG - Intergenic
1035827125 8:2656588-2656610 TTTAATTTTTATTTTTTGGGGGG + Intergenic
1035963375 8:4162678-4162700 TGGGATGTTGATAGTTGGGGAGG - Intronic
1036909168 8:12738824-12738846 AGGGATTCTGATATTTTTGGTGG + Intronic
1037259001 8:16986114-16986136 TGTAATCTCAATATTTTGGGAGG + Intergenic
1037847182 8:22294079-22294101 TGTAATCCTGACATTTTGGGAGG + Intronic
1038191204 8:25322872-25322894 TCTGGTTTTGAGGTTTTGGGAGG + Intronic
1038210739 8:25517186-25517208 TGTTCTTTTCATATTTGGGGTGG + Intergenic
1038275349 8:26116650-26116672 TGTAATCCTGACATTTTGGGAGG - Intergenic
1038285148 8:26199713-26199735 TGTAATCTCAATATTTTGGGAGG - Intergenic
1038371571 8:26998207-26998229 TCTTATTTTGATATTTTGGCTGG + Intergenic
1038529968 8:28310706-28310728 TGTAATCTTAACATTTTGGGAGG + Intergenic
1039449926 8:37664627-37664649 TGTAATTCTGATGCTTTGGGAGG - Intergenic
1040086848 8:43351978-43352000 TGTAATTTTAGTACTTTGGGAGG + Intergenic
1040481044 8:47827100-47827122 TGTGATCTTCATATTTTGATAGG - Intronic
1040497716 8:47981371-47981393 TGTAATCTTAGTATTTTGGGAGG - Intergenic
1040631187 8:49213672-49213694 TCTGTTTTTGTTTTTTTGGGGGG - Intergenic
1041023941 8:53665411-53665433 TGTGTTTGTGGCATTTTGGGAGG + Intergenic
1041682028 8:60603762-60603784 TGTAATCCTGGTATTTTGGGAGG + Intronic
1041875074 8:62678093-62678115 TGTGAATATGTTATTTTGAGTGG + Intronic
1042302732 8:67303100-67303122 TGTGATTTTTTTTTTTTGGTGGG - Intronic
1042315435 8:67421377-67421399 TGTGATCCCAATATTTTGGGAGG - Intergenic
1042622882 8:70725293-70725315 TGTGATGTTGCTCTTTTGGGTGG + Intronic
1042649073 8:71019946-71019968 TGTTATTTTGATCTTTAGGCAGG + Intergenic
1042708943 8:71693656-71693678 TGTGATTCTGAGATTTTGTGAGG + Intergenic
1042861433 8:73317926-73317948 TGTGGTTTTTTTTTTTTGGGCGG - Intronic
1043045435 8:75317072-75317094 TGTGATTATGATATTTATTGTGG + Intergenic
1043579778 8:81698868-81698890 TGTAATCCTGATACTTTGGGAGG - Intergenic
1043595037 8:81875358-81875380 TGTAATGCTGATACTTTGGGAGG - Intergenic
1044634496 8:94309185-94309207 TGGGATGTGGATATCTTGGGGGG - Intergenic
1045283808 8:100772699-100772721 TGTAATCCCGATATTTTGGGAGG - Intergenic
1045734328 8:105277357-105277379 TGTAATTCCAATATTTTGGGAGG + Intronic
1045809239 8:106201949-106201971 TAGGATTTAGATATTTTAGGGGG + Intergenic
1046316932 8:112515975-112515997 TTTGATTTTGTAATTTTGTGTGG + Intronic
1046721517 8:117624870-117624892 TATGATTTTGATATTTTATAAGG + Intergenic
1046811585 8:118538903-118538925 GGAGATAATGATATTTTGGGAGG - Intronic
1047172821 8:122510706-122510728 TGTGTTGTTTATAATTTGGGGGG - Intergenic
1048124689 8:131620865-131620887 TATGATTTTGTTCTTTTTGGGGG - Intergenic
1050004419 9:1114797-1114819 TGTAATTCTAATACTTTGGGAGG - Intergenic
1050746502 9:8882582-8882604 TGTGATTAAGATATTTTAGAGGG + Intronic
1051228459 9:14927918-14927940 TTTGGTCTTGAAATTTTGGGAGG - Intergenic
1051295611 9:15592339-15592361 TGTTTTTTTGCTTTTTTGGGGGG - Intronic
1051413717 9:16817073-16817095 TGTAATTTTGATATTTTAGATGG - Intronic
1051774719 9:20621610-20621632 TCTGAATTTCATTTTTTGGGGGG - Intronic
1051777390 9:20650819-20650841 TGTAATTCCAATATTTTGGGTGG - Intergenic
1052593480 9:30528882-30528904 TGTGATCTTAACATTTTGGGAGG - Intergenic
1053085978 9:35222388-35222410 TAAGAATTTAATATTTTGGGGGG + Intronic
1055312161 9:74993804-74993826 TGTGGTTTTGACATTTGGGCTGG - Intronic
1055932204 9:81571201-81571223 TGTGATTTCTTTATTTTGGTGGG - Intergenic
1055952662 9:81744655-81744677 TGTAATCCTAATATTTTGGGAGG - Intergenic
1056084345 9:83130347-83130369 TGGGATGTTGATAATTGGGGAGG - Intergenic
1056295284 9:85187040-85187062 TATGACTTTGATATTGTTGGAGG - Intergenic
1056333999 9:85548021-85548043 TGTTTATTTGATATTTTGTGTGG - Intronic
1056408216 9:86297569-86297591 TATCATTTTAGTATTTTGGGAGG + Intronic
1057387323 9:94615512-94615534 TGTGGATTTGATATTTTGCAAGG + Intronic
1058048076 9:100378729-100378751 TTTGATTTTTATTTTTTGGTGGG - Intergenic
1058464950 9:105217747-105217769 GCTAATTTTTATATTTTGGGGGG - Intergenic
1058746839 9:107999955-107999977 TGTAATTCAGATACTTTGGGAGG - Intergenic
1059871264 9:118580644-118580666 GGTGATTTTGAGATTATGGAAGG + Intergenic
1059924339 9:119192929-119192951 TCAGATTTTGGTATTTTTGGGGG - Intronic
1060359223 9:122939426-122939448 TGTAATTTTAACACTTTGGGAGG - Intergenic
1061471485 9:130829838-130829860 TGTGATTTTATTGTTTTGGGGGG + Intronic
1186031200 X:5371221-5371243 TGTAATCCTGATACTTTGGGAGG + Intergenic
1186150175 X:6666268-6666290 TGGGATGTAGACATTTTGGGGGG - Intergenic
1186569611 X:10700293-10700315 TGTAATTTCAACATTTTGGGAGG + Intronic
1186749303 X:12605382-12605404 TGTGCTTTTAATATATTTGGAGG - Intronic
1187046202 X:15649595-15649617 TGTGCTGTTGGCATTTTGGGTGG + Intronic
1187878636 X:23825582-23825604 TGTAATCTTAATACTTTGGGAGG - Intergenic
1187934174 X:24319790-24319812 TGGGATGTTGATAGTTGGGGAGG - Intergenic
1188590478 X:31828407-31828429 TGTGATTTTAGCACTTTGGGAGG + Intronic
1188911294 X:35851213-35851235 TTTGAGTTTCATATTTTGTGTGG - Intergenic
1189218263 X:39345657-39345679 TGTGATTTTTTTTTTTTGTGGGG - Intergenic
1189385787 X:40535917-40535939 TGTAATCTTAACATTTTGGGAGG + Intergenic
1189393195 X:40595295-40595317 TCTGATTTTTATGTTTTGTGGGG - Intronic
1189817996 X:44843654-44843676 TGTGATATTGCTATTTTGCAGGG + Intergenic
1190244540 X:48682636-48682658 TGTAATTCTAATACTTTGGGAGG + Intronic
1190377633 X:49805294-49805316 TTTGATTCTGAGGTTTTGGGGGG - Intergenic
1190798410 X:53766224-53766246 TGTGATATTAACATTTTAGGGGG + Intergenic
1191020328 X:55852231-55852253 TGTGGTTTTTGTTTTTTGGGTGG + Intergenic
1192404515 X:70870900-70870922 GGTGATTCTGATTTTTTGGGGGG + Intronic
1193023097 X:76813774-76813796 TGTCATTTTGAGATAGTGGGAGG - Intergenic
1193149923 X:78114169-78114191 TGTGATTTTGACATTATTGGGGG + Intronic
1193170924 X:78334473-78334495 CATAATCTTGATATTTTGGGGGG + Intergenic
1193629358 X:83863245-83863267 TTTGAATTTGAGATTTTGGAGGG - Intronic
1193916203 X:87367274-87367296 TGTGTTTTGGACTTTTTGGGGGG + Intergenic
1194532309 X:95066172-95066194 GTTTATTTTTATATTTTGGGGGG - Intergenic
1194620593 X:96165994-96166016 TGTGATTCTGATACTTTGATTGG - Intergenic
1194947419 X:100085533-100085555 TGTAATTTTGTTTTTTTTGGGGG - Intergenic
1195234844 X:102887256-102887278 TGTAATCTCGACATTTTGGGAGG - Intergenic
1195262942 X:103151734-103151756 TGTAATTCCAATATTTTGGGAGG - Intergenic
1195321216 X:103723574-103723596 TGTGTTTGTGCTGTTTTGGGGGG - Intronic
1195919193 X:109965835-109965857 TGAGATTTTAAGATTTTGGAAGG - Intergenic
1196029220 X:111077019-111077041 TGTTTTCTTGATTTTTTGGGGGG - Intronic
1196262515 X:113600348-113600370 TGTAATCTCCATATTTTGGGAGG - Intergenic
1196702578 X:118687611-118687633 TTTTATTTTTATTTTTTGGGGGG + Intergenic
1197342786 X:125293454-125293476 TGTAATTTGAATACTTTGGGAGG - Intergenic
1197426269 X:126300090-126300112 TGGGTATGTGATATTTTGGGGGG + Intergenic
1197574433 X:128192778-128192800 TTTGCTTGTGAAATTTTGGGAGG - Intergenic
1197687725 X:129459891-129459913 TGTGATCCTGATACTTTGGGAGG + Intronic
1197930321 X:131687935-131687957 TGTAATCTTAACATTTTGGGAGG - Intergenic
1197965853 X:132060871-132060893 TGTAATCCTGGTATTTTGGGAGG - Intergenic
1198152829 X:133927732-133927754 TGTAATTCTGACACTTTGGGAGG - Intronic
1198154448 X:133945132-133945154 TGTAATTTTAACACTTTGGGAGG + Intronic
1198459570 X:136850175-136850197 TGTAATCTCGATACTTTGGGAGG + Intronic
1198462344 X:136876054-136876076 TGTAATCTTGACACTTTGGGAGG - Intronic
1198511345 X:137354781-137354803 TGGGCTTTTGAAATTTGGGGAGG - Intergenic
1198730657 X:139724216-139724238 TGTGATTATGATATATTTTGGGG - Intergenic
1198859988 X:141058495-141058517 TGTCATTTTTTTTTTTTGGGGGG - Intergenic
1198861393 X:141074454-141074476 TGTGTTTTTGACATTTTGGATGG + Intergenic
1198901299 X:141512929-141512951 TGTGTTTTTGACATTTTGGATGG - Intergenic
1198902705 X:141528895-141528917 TGTCATTTTTTTTTTTTGGGGGG + Intergenic
1199444511 X:147906447-147906469 TGTAATTTTGGTACTTTGGGAGG - Intergenic
1200685793 Y:6257797-6257819 TGTAATTTCTACATTTTGGGAGG + Intergenic
1200991325 Y:9349042-9349064 TGTAATTTCTACATTTTGGGAGG + Intergenic
1200993982 Y:9369333-9369355 TGTAATTTCTACATTTTGGGAGG + Intronic
1200996646 Y:9389653-9389675 TGTAATTTCTACATTTTGGGAGG + Intergenic
1200999160 Y:9458206-9458228 TGTAATTTCTACATTTTGGGAGG + Intergenic
1201001813 Y:9478516-9478538 TGTAATTTCTACATTTTGGGAGG + Intronic
1201004480 Y:9498817-9498839 TGTAATTTCTACATTTTGGGAGG + Intergenic
1201007133 Y:9519130-9519152 TGTAATTTCTACATTTTGGGAGG + Intergenic
1201012345 Y:9560167-9560189 TGTAATTTCCACATTTTGGGAGG + Intergenic
1201381529 Y:13385099-13385121 TGTAATTTCAATATTTTGGGAGG - Intronic
1201486241 Y:14497568-14497590 TGTAATTATGGCATTTTGGGAGG + Intergenic
1201620546 Y:15952371-15952393 TCTCATTTTTATATTTTTGGTGG + Intergenic
1201644324 Y:16211378-16211400 TGTAATTTTAGTACTTTGGGAGG - Intergenic
1201658491 Y:16373943-16373965 TGTAATTTTAGTACTTTGGGAGG + Intergenic
1202068646 Y:20967690-20967712 TGGGATTTTCAAGTTTTGGGGGG + Intergenic
1202199078 Y:22327976-22327998 TGTAATTTCAATACTTTGGGAGG + Intronic
1202575950 Y:26324964-26324986 TGTCATCTTGACACTTTGGGAGG - Intergenic