ID: 1106100352

View in Genome Browser
Species Human (GRCh38)
Location 13:26689955-26689977
Sequence TTGTTGTTCATAGGGAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106100346_1106100352 14 Left 1106100346 13:26689918-26689940 CCTGGCACTTTCTAGGTTTCAAA 0: 1
1: 0
2: 2
3: 30
4: 253
Right 1106100352 13:26689955-26689977 TTGTTGTTCATAGGGAAAAAGGG 0: 1
1: 0
2: 1
3: 17
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106100352 Original CRISPR TTGTTGTTCATAGGGAAAAA GGG Intergenic
901713014 1:11130498-11130520 TGGTTGTTAATAAGGAAGAAGGG + Intronic
904305823 1:29588980-29589002 TGGATGTTCATATGCAAAAAAGG + Intergenic
904640239 1:31921317-31921339 TTGTGGTACATTGGAAAAAACGG - Intronic
904672060 1:32173425-32173447 TTGGAGTTCTTAGGGAAAACTGG - Exonic
906902576 1:49852121-49852143 TTGTTGTTGTTAGGGTAGAAGGG - Intronic
907754320 1:57295693-57295715 TTGTTTTTCATAGGGAGAACTGG + Intronic
908068096 1:60429506-60429528 TTGTTCTTGATAGAGAAAGAAGG + Intergenic
908180038 1:61594431-61594453 TTGTTTTTCATAGGCAATCAGGG + Intergenic
909051787 1:70775571-70775593 TTGTTTTTCATTTGGAAGAAAGG - Intergenic
909790243 1:79668252-79668274 TGGGTGTGCATAGGGAAGAAGGG - Intergenic
910236881 1:85046179-85046201 CTGTTGTACAAAGGGGAAAATGG + Intronic
911028084 1:93456411-93456433 TTGTTGTTTTTAGGGAGTAAAGG + Intronic
911166566 1:94729845-94729867 TTGTTTTTCAGATGGGAAAATGG + Intergenic
911611996 1:99968204-99968226 TTGCTGTTTATTGGGAAATAGGG + Intergenic
912033506 1:105281050-105281072 ATGTGGGTCATAGGGAAAAGGGG + Intergenic
915606688 1:156956421-156956443 TTCTTGGTCTTAGGGAAGAACGG + Exonic
915852623 1:159342222-159342244 TGGTTATTGATAGGAAAAAAAGG + Intergenic
916288319 1:163135414-163135436 TTTTTGTTCATCTGCAAAAATGG - Intronic
917104316 1:171477180-171477202 CTGTTGTTCATAAAGTAAAAGGG - Intergenic
917563475 1:176185434-176185456 TTATTCTTTATAGGGAAAGAGGG - Intronic
917707494 1:177649040-177649062 ATGATGTTCAAGGGGAAAAATGG + Intergenic
918395334 1:184108806-184108828 TGGTTCTTCATAAGGAAAGAAGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921718384 1:218443126-218443148 TTTTTGATCATAGGAAAAATTGG - Exonic
922345512 1:224693143-224693165 TTGTTAGTCAGAGGGAAAGAGGG + Intronic
922361352 1:224824743-224824765 TTGTTGTGGATATGGTAAAAGGG - Intergenic
923167073 1:231375873-231375895 TTGTTATTCATGGGAAAGAAGGG + Intronic
923839011 1:237647026-237647048 TAGCTGTGCCTAGGGAAAAAGGG - Intronic
924119101 1:240778459-240778481 TTTTTCTTAATTGGGAAAAAGGG + Intronic
924718675 1:246602800-246602822 AAGGTGTTCAGAGGGAAAAAAGG - Intronic
924865990 1:247980965-247980987 TTATTGATCACAGGGAAGAAGGG + Intronic
1064341251 10:14487595-14487617 TGGTTGTTTATAAGGAAACACGG + Intergenic
1064786525 10:18903230-18903252 TTGTTGTTTGTAGCAAAAAAGGG + Intergenic
1067377937 10:45745051-45745073 TTATTGTACATAAGGCAAAAAGG - Intronic
1067885637 10:50085727-50085749 TTATTGTACATAAGGCAAAAAGG - Intronic
1067976785 10:51035397-51035419 TTGTTGGTCATAAGAAACAAAGG + Intronic
1069218054 10:65846965-65846987 ATGTTGCTCAGAAGGAAAAAAGG + Intergenic
1072226520 10:93375151-93375173 TTGATGTTCATAAGGAATACAGG + Intronic
1073797664 10:107005558-107005580 TAGGTATTCATATGGAAAAAAGG - Intronic
1074278895 10:112032316-112032338 TTTTTGTTGAGATGGAAAAATGG - Intergenic
1074478066 10:113790827-113790849 TTATAGTTCATACAGAAAAAAGG + Intergenic
1075323787 10:121513553-121513575 TTTTTTCTAATAGGGAAAAATGG - Intronic
1075363228 10:121859216-121859238 TTTTCTTTCATAGGGAGAAATGG - Intronic
1075904356 10:126067559-126067581 TTGTTTTTGTTAGGAAAAAATGG - Intronic
1081019885 11:37932228-37932250 TGGTTGTTCAGAAGAAAAAAGGG - Intergenic
1082191130 11:49246619-49246641 TTGTTGTTGTTAGGGAATTAGGG + Intergenic
1082688561 11:56271200-56271222 TTGTTTTCCTTAGGGAAACAAGG - Intergenic
1082797059 11:57385848-57385870 TTGTTGTTAATATTGAAATAAGG + Intergenic
1084737237 11:71113413-71113435 GAGTTGTTCAGAGGGAAAACGGG + Intronic
1084933440 11:72574618-72574640 ATGTTGTTTATAGGCAAAAGGGG - Intergenic
1085061418 11:73450627-73450649 TTGTTTTTGGGAGGGAAAAAAGG - Intronic
1086164050 11:83757147-83757169 TTTTTCTTCATAGTGAAAATGGG - Intronic
1086238538 11:84661406-84661428 CTGTTGTTCAGAGGATAAAATGG - Intronic
1086674988 11:89594419-89594441 TTGTTGTTGTTAGGGAATTAGGG - Intergenic
1086775201 11:90822410-90822432 TTGCTTTTCCTAGGGAAAATCGG + Intergenic
1088189791 11:107215753-107215775 CAGTTGTTCATAGGAAAACAAGG + Intergenic
1088549201 11:110993628-110993650 TTGTTGGTAATACTGAAAAATGG - Intergenic
1088806855 11:113360395-113360417 TTTTTTTTCTTATGGAAAAAAGG - Intronic
1089064838 11:115654574-115654596 TGGTTGTTCATATGAAATAATGG + Intergenic
1089094283 11:115905928-115905950 CTGTCGTTTAGAGGGAAAAATGG - Intergenic
1090282391 11:125467348-125467370 TGGTTGTTCATAAGCATAAAAGG - Intronic
1090324214 11:125870814-125870836 TAGTTGTTTTTAAGGAAAAAAGG + Intergenic
1091538516 12:1436763-1436785 CAGTTGGTCACAGGGAAAAATGG - Intronic
1091595258 12:1874278-1874300 TTGTTGTTTATAATGAAAAGGGG - Intronic
1093276389 12:17133510-17133532 GTGTTCTTCATAGGGAATCAAGG + Intergenic
1093325232 12:17766317-17766339 TTGCTGTTTATTGGGACAAATGG + Intergenic
1093545635 12:20343024-20343046 ATGTTGTTAAAAGGGAAAAAAGG + Intergenic
1094147601 12:27246345-27246367 TTTTTGTTAAGAGGGAGAAAGGG + Intronic
1094226278 12:28049653-28049675 TTATTGTTGATTGGGAAAAAAGG - Intergenic
1095080324 12:37992155-37992177 TTTTTCTTCATAGGACAAAATGG - Intergenic
1097823177 12:64147982-64148004 TTCTTGTTCATTTGGAAATAGGG + Exonic
1097957140 12:65497535-65497557 TTGTAGACTATAGGGAAAAATGG - Intergenic
1097977246 12:65700087-65700109 CTCTTGTACATAGGTAAAAAGGG + Intergenic
1099543629 12:83947842-83947864 ATGTTGTTCTTAGGGGAAGAAGG + Intergenic
1100566846 12:95803824-95803846 TGGTTGTTTATATGGAAACATGG - Intronic
1100846820 12:98667682-98667704 TTGTAATACATATGGAAAAAGGG - Intronic
1101261679 12:103038384-103038406 TTGTTCTTCATTTGTAAAAAGGG + Intergenic
1103636576 12:122312267-122312289 TTTTGGATCTTAGGGAAAAAAGG - Intronic
1104061652 12:125273610-125273632 TTCTTTTACATAGGGTAAAAGGG + Intronic
1104831359 12:131754163-131754185 TTGTTGTCAAGAGTGAAAAATGG - Intronic
1105555113 13:21440106-21440128 TTCTTGTTCTTAGGAAATAAAGG + Intronic
1106100352 13:26689955-26689977 TTGTTGTTCATAGGGAAAAAGGG + Intergenic
1106492944 13:30245118-30245140 TTGATGTTCATCGGGAATATTGG - Intronic
1106955247 13:34931137-34931159 TTGCTAGTCATAGGGAAAGAAGG - Intergenic
1108845435 13:54673123-54673145 TTATTTTTCATATTGAAAAAAGG - Intergenic
1108860496 13:54852750-54852772 TGGTTGTTCATAGGCATGAAGGG - Intergenic
1108911701 13:55561060-55561082 TGGTTTCTCATAGGGAAAAAAGG - Intergenic
1109022081 13:57110229-57110251 TTCTTGTTCACAGGAAAATATGG + Intergenic
1109730675 13:66409401-66409423 TGTGTTTTCATAGGGAAAAAAGG - Intronic
1110316699 13:74116268-74116290 TCTTTGCTCCTAGGGAAAAAAGG + Intronic
1111456356 13:88488874-88488896 TTGTGGTTGAAAGGGAAAATTGG + Intergenic
1111640015 13:90956760-90956782 TTGTTGGTCAAAGGGTACAAAGG - Intergenic
1113109244 13:106804565-106804587 GTGTTAGTAATAGGGAAAAATGG - Intergenic
1113475386 13:110576900-110576922 CTGTTAGTCATAGGGAAAACCGG - Intergenic
1114264909 14:21068304-21068326 TTTTTTTTCATGGAGAAAAAGGG - Intronic
1114305004 14:21414800-21414822 CTGTTTTTAATGGGGAAAAATGG - Intronic
1115126206 14:29997556-29997578 TTGTTGTTAAAAAGAAAAAAAGG + Intronic
1115877881 14:37881056-37881078 TTGTTGCTCTGGGGGAAAAAGGG - Intronic
1116196030 14:41726246-41726268 TTGTTGTTCAGAGGGATCCAGGG + Intronic
1116278103 14:42862794-42862816 TTGTAGGTCATAGGGGAAAGAGG - Intergenic
1116569942 14:46503439-46503461 TTGTTTATAATAGTGAAAAATGG + Intergenic
1117556212 14:56887469-56887491 TTTTTTTTAAGAGGGAAAAAAGG - Intergenic
1118566033 14:67142124-67142146 TAGATGTCCATAGGGAAGAAAGG + Intronic
1120079570 14:80200457-80200479 TTATCGTACATAGAGAAAAAAGG + Intronic
1121116814 14:91349455-91349477 CTGCTGTTCAGAGGGAGAAACGG + Intronic
1122332020 14:100925913-100925935 ATGTTGTTCTAAGGGAATAAAGG + Intergenic
1202889509 14_KI270722v1_random:142572-142594 TTGCTGTGCAGAGGGTAAAAAGG - Intergenic
1124317945 15:28688419-28688441 TTGTTTTTCTTAGGTAATAAAGG - Intergenic
1124565490 15:30809065-30809087 TTGTTTTTCTTAGGTAATAAAGG + Intergenic
1124863410 15:33465448-33465470 TTGGTGAGCATATGGAAAAAAGG - Intronic
1125300286 15:38247577-38247599 TTGCCGTCCTTAGGGAAAAAAGG + Intergenic
1125457765 15:39878251-39878273 ATGTTGGTCAAAGGGTAAAAAGG - Intronic
1125510649 15:40290874-40290896 TTGTTGTTCAGAGGGAGTACGGG + Intronic
1128210384 15:65895795-65895817 TTTTTATGCATAGGAAAAAAGGG + Exonic
1129744746 15:78010245-78010267 TTGTTGTTCATAACGGAAACTGG + Intronic
1132445619 15:101915243-101915265 TTGTTTTTCATAGTAAAGAACGG - Intergenic
1133689616 16:8200665-8200687 TTTTGGTTCACAGGAAAAAAAGG - Intergenic
1135340743 16:21645712-21645734 ATGTTAGTCAAAGGGAAAAATGG - Intronic
1137299071 16:47129357-47129379 TTGTCCATCTTAGGGAAAAACGG + Exonic
1138413540 16:56858321-56858343 TTGATGTTCATGGGGAAGAGGGG - Intergenic
1140710021 16:77668992-77669014 TTGTTGTTCAGAAGGAGAAAGGG - Intergenic
1140716509 16:77730745-77730767 TTGTTGAGGATATGGAAAAAAGG - Intronic
1141778375 16:86139788-86139810 ATGTTGATCAAAGGGAACAAAGG - Intergenic
1144701454 17:17343586-17343608 TTGTCATACACAGGGAAAAACGG + Intronic
1146083059 17:29800245-29800267 TTGTAGGTCTTAGGGTAAAATGG + Intronic
1146600198 17:34207602-34207624 TTGTTGTTGAGAAGGTAAAATGG - Intergenic
1146782285 17:35685352-35685374 TTCTTGTTCATACGGGGAAAAGG - Intronic
1147729140 17:42586636-42586658 ATGATGTTCATAGAGACAAAAGG - Intronic
1147968356 17:44206361-44206383 TTGTTGTGAATCTGGAAAAAGGG - Exonic
1148506115 17:48128394-48128416 TAGTTTTTTATAGGGAAAAAGGG + Intergenic
1150173846 17:63028854-63028876 TTGTTGTTAAAAGAAAAAAAGGG + Intronic
1150233236 17:63570705-63570727 TTGTTTTTCATAGGGAAAATGGG + Intronic
1151587593 17:75019829-75019851 TTTGTGTTCATATGGAATAAAGG + Intronic
1154073310 18:11175562-11175584 TTCTTTCTCTTAGGGAAAAAGGG - Intergenic
1155843171 18:30671043-30671065 TTGTTGTTTATCTGGAAATATGG - Intergenic
1156566079 18:38192584-38192606 TTATTTTGCACAGGGAAAAAAGG + Intergenic
1156613130 18:38751060-38751082 TTTTTGATGATAGGGAAATAAGG + Intergenic
1156661710 18:39353759-39353781 TTGTTGTTCATAGGTTTAATGGG - Intergenic
1157387863 18:47274590-47274612 TTGTTGATGACAGAGAAAAATGG + Intergenic
1157457516 18:47847663-47847685 TTGTTTTTCATAGACAAAAATGG - Intronic
1158540776 18:58352337-58352359 TTGTTTTTCATGGGAAAAAGAGG - Intronic
1162387978 19:10371854-10371876 TTGTTTATCATATGGAAAAGGGG - Intronic
1164130774 19:22359271-22359293 CTGTTGTTCATACAGCAAAAAGG - Intergenic
1164706636 19:30324944-30324966 TTGTTGTACCTAGGGAAAGGAGG + Intronic
1165587189 19:36928707-36928729 GTGTGGTTTATAGAGAAAAATGG - Intronic
1166346008 19:42166333-42166355 TTGTTGTTCATTTTAAAAAACGG - Intronic
1166429612 19:42713267-42713289 TTATTGTTCATATGTAAAATTGG - Intronic
1202664912 1_KI270708v1_random:109341-109363 TTGCTGTGCAGAGGGTAAAAAGG - Intergenic
926495813 2:13586169-13586191 TTTTTGTTCTAAGGGAAAGATGG + Intergenic
927295349 2:21446850-21446872 TTGTGTTTCAATGGGAAAAATGG - Intergenic
927324978 2:21794293-21794315 CTGTTTTTGGTAGGGAAAAAAGG + Intergenic
928010097 2:27599338-27599360 TTATTATTCATAAGGAACAATGG + Intronic
928128180 2:28630336-28630358 TGATTGTTCATAGAGAAAGAGGG - Intronic
929661964 2:43795525-43795547 GTGTTTTTCATAGGAAATAATGG + Intronic
930058562 2:47270592-47270614 GTGTTCTTGATAGGGAAAAAGGG + Intergenic
930927803 2:56841252-56841274 TTGATATTAATATGGAAAAATGG - Intergenic
931412856 2:62050488-62050510 TTGCTTTTGTTAGGGAAAAAGGG + Intronic
932324583 2:70849428-70849450 TTGTTGTTAATAGAGAAACAGGG + Intergenic
933346083 2:81087455-81087477 TTGTTATTAATATGGAACAAGGG + Intergenic
933797572 2:85932352-85932374 TTGTTGATAATAGGGAAAGCTGG - Intergenic
933914610 2:86976590-86976612 TTCTTGTTCTTCAGGAAAAACGG - Exonic
934008383 2:87793309-87793331 TTCTTGTTCTTCAGGAAAAACGG + Exonic
934707730 2:96496551-96496573 TTGTTGTTTTTATGGAACAATGG + Intergenic
939075214 2:137593364-137593386 TTGTTGTAAATAGTGTAAAATGG - Intronic
939097672 2:137853148-137853170 TTCTTTATCATAGGGAATAATGG - Intergenic
939701194 2:145393264-145393286 TAGATGTTCATGGTGAAAAATGG - Intergenic
940068573 2:149657450-149657472 TTGGTGTGAAGAGGGAAAAAAGG - Intergenic
940846444 2:158647558-158647580 TTTATTTTCAGAGGGAAAAAAGG + Intronic
940970389 2:159890604-159890626 TTGTAATTGATAGGGATAAAAGG - Intronic
942258942 2:174138018-174138040 TTATTGCTGATAGGGAGAAAGGG - Intronic
943261337 2:185667274-185667296 TTGTAATTAATAGAGAAAAATGG - Intergenic
943910101 2:193553301-193553323 TTGTTGGTAATAGCCAAAAATGG + Intergenic
944451145 2:199843930-199843952 GAGTTGTGCACAGGGAAAAAAGG + Intronic
944664271 2:201946649-201946671 TTGTTGTTCGTAGTGGAGAAAGG + Intergenic
946636309 2:221731445-221731467 TTGTTGTTCTGAGTTAAAAATGG + Intergenic
948690530 2:239699839-239699861 TTGTTGTTCAGAACGCAAAATGG - Intergenic
1170770627 20:19329199-19329221 TAGTAGTTCATAGGGAAAATGGG + Intronic
1172921256 20:38484273-38484295 TGGTTGCTGTTAGGGAAAAAAGG - Intronic
1173106300 20:40138388-40138410 TTGTAGTTCATAGAAAAAAATGG - Intergenic
1174121285 20:48267646-48267668 TTGTTGTTACTAGGCAAAAGGGG + Intergenic
1174177516 20:48654317-48654339 TAGGTGTTCATAGGCAAAGACGG - Intronic
1177391470 21:20478980-20479002 TTGTGGTTCATCAAGAAAAATGG + Intergenic
1180501931 22:15937631-15937653 TTGTTGTTCACCTGAAAAAATGG + Intergenic
1183865430 22:40700610-40700632 TTGTTGTTAATATAGAGAAAGGG - Intergenic
1184980561 22:48092585-48092607 TTTTTGTTTAAATGGAAAAATGG + Intergenic
949192600 3:1267987-1268009 ATATTGTTCAAAGGCAAAAAGGG - Intronic
954521585 3:51231926-51231948 TTTTTGTTCATAGTGAAAGTAGG + Intronic
954824805 3:53363296-53363318 TTGTTTTATTTAGGGAAAAATGG + Intergenic
955243132 3:57198943-57198965 TTTTTGTTTTTAGGGAAAGATGG - Exonic
956260522 3:67335742-67335764 TTGTTGGTCGTAGGGACAGAGGG - Intergenic
956619679 3:71208985-71209007 TTGTTGTTTATAAGCAAACATGG - Intronic
957091029 3:75730391-75730413 TTGCTGTGCAAAGGGTAAAAAGG + Intronic
957799943 3:85064606-85064628 ATTTTGTTCATAGAGAAGAAGGG + Intronic
958150028 3:89679931-89679953 GTGTGTTTAATAGGGAAAAAAGG + Intergenic
958909645 3:99979490-99979512 AGGTTGTTCATAGGTAGAAATGG + Intronic
959132647 3:102376697-102376719 TTGTTGAGAATATGGAAAAAGGG + Intronic
959247449 3:103891519-103891541 TTGTTGATCATGGGGAGAATTGG - Intergenic
959681379 3:109100432-109100454 TTGAAGTTCATAGGGCAATACGG - Exonic
960504550 3:118477405-118477427 TGGTTGATCAGAGGGGAAAAAGG - Intergenic
960833554 3:121879557-121879579 TTTTTGTTTATAGTGAGAAATGG + Intronic
961689228 3:128656417-128656439 TGGGTGTTCATATGGAAGAAGGG + Intronic
961988504 3:131162395-131162417 TTGTTATTTATAGGCAAAAAAGG + Exonic
963619161 3:147583246-147583268 TTATTCATAATAGGGAAAAATGG - Intergenic
964466043 3:156994368-156994390 GTGTAGTTCATAGGGAAACAAGG + Intronic
964491571 3:157241853-157241875 ATGTTGTTGATGGGGAAAAAGGG + Intergenic
964733020 3:159887276-159887298 TTGTTGGTCTTTGGTAAAAAAGG - Intronic
965011142 3:163093620-163093642 CTTTTATTCATAGTGAAAAAGGG - Intergenic
966103089 3:176299356-176299378 TGATTTTTCATGGGGAAAAATGG + Intergenic
970497067 4:16637057-16637079 TTGTTTTTCCTAGAGCAAAATGG - Intronic
970781570 4:19744106-19744128 CTGCTGTTCAGAGAGAAAAATGG - Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972211656 4:36845736-36845758 GTGTTTTCCATAGAGAAAAATGG - Intergenic
973804436 4:54512197-54512219 TTGGTGTTCAGGAGGAAAAAAGG + Intergenic
973847858 4:54931421-54931443 TTGTTTCTAATAGTGAAAAATGG + Intergenic
973930362 4:55787064-55787086 TTCATGTGCATAGGAAAAAATGG + Intergenic
975358448 4:73436738-73436760 TTGTTTTTAATACAGAAAAATGG + Intronic
975438971 4:74388288-74388310 TTCTTGTTCATATGGGAGAAGGG + Exonic
975443381 4:74437250-74437272 TTTCTATTCAAAGGGAAAAAAGG + Intergenic
979108771 4:116723292-116723314 TTTTTGTTCCTAGGAGAAAAAGG - Intergenic
980184995 4:129449774-129449796 TTGATGTTCATCAGGAATAATGG - Intergenic
980809525 4:137857342-137857364 TCTTTGTTCATAGGGACTAAGGG - Intergenic
981117925 4:141013947-141013969 TTGTTGATCAAAGGGTACAAAGG - Intronic
981454407 4:144937092-144937114 TTGATGTTCATAAGGAATATTGG + Intergenic
984812825 4:183810045-183810067 TAATTCTTCATAGGTAAAAATGG - Intergenic
985365371 4:189226333-189226355 TTATTTGTCATAGGTAAAAATGG + Intergenic
986901273 5:12437061-12437083 TTGTTCCTCACAGGGAAAACAGG + Intergenic
986949757 5:13069073-13069095 TTGTTGTTCCTTGGAAAATATGG - Intergenic
986957561 5:13172538-13172560 TGGTTGTGGATAGGGAGAAATGG - Intergenic
987438012 5:17921716-17921738 TTCTTGTTTATTGGGAAGAAGGG + Intergenic
987771854 5:22315303-22315325 TTGTTGTTTACTGTGAAAAAAGG - Intronic
989152469 5:38313836-38313858 TTATGGTGCATAGAGAAAAATGG - Intronic
990456238 5:55991306-55991328 TGTTTGTAGATAGGGAAAAATGG - Intronic
991492704 5:67198422-67198444 TTGTTTTTCAGATGGGAAAACGG - Intergenic
995583246 5:113622159-113622181 TTGCTTTTGATAAGGAAAAATGG + Intergenic
997816248 5:137021116-137021138 TTGTTTATGATAGGGAAAACTGG + Intronic
998535741 5:142929281-142929303 TGGTTCTTCATAGCAAAAAATGG - Intronic
999845280 5:155472527-155472549 TTGCTGTTCAAGGAGAAAAAGGG + Intergenic
1001751992 5:174138393-174138415 TAGTTGTTCAATGGGTAAAAAGG - Intronic
1001927921 5:175652540-175652562 GAGGTGTTAATAGGGAAAAAGGG - Intergenic
1002574368 5:180163711-180163733 TTTTTGTTCATATGGAACATGGG + Intronic
1002827386 6:785690-785712 ATGTTGAACACAGGGAAAAAAGG - Intergenic
1002912366 6:1499802-1499824 CTGCTTTTCAGAGGGAAAAAGGG - Intergenic
1003913313 6:10762235-10762257 ATGTTGATAATAGGGAAAATCGG + Intronic
1004843652 6:19614683-19614705 CTGTTGTTCTTAGGGTAAGATGG - Intergenic
1004904758 6:20226904-20226926 TTGTAGATCATGGGGGAAAAAGG - Intergenic
1005914390 6:30340112-30340134 CTGATGTTCAAAGGGGAAAAGGG - Intronic
1007912958 6:45534546-45534568 TTTTTGTTCATAGGATAAAGAGG + Intronic
1008313461 6:50007856-50007878 CTGATGTTCATATGGAAAACGGG - Intergenic
1009919902 6:70044592-70044614 TTGTTGTTCCTTAGGAAATAGGG + Intronic
1010260892 6:73815701-73815723 ATCTTGTTAATAAGGAAAAAGGG + Intronic
1010806608 6:80244548-80244570 TTGTTGCCCTGAGGGAAAAATGG + Intronic
1011266281 6:85522975-85522997 TGGTTCTTCTTAGGGAAACAGGG - Intronic
1013788115 6:113805989-113806011 CTGTTGTTAATACGGACAAATGG - Intergenic
1013906738 6:115228854-115228876 ATGTTGTTAATAGGGGAAACTGG - Intergenic
1015002610 6:128237447-128237469 TCGTTTTGCATGGGGAAAAATGG - Intronic
1015219519 6:130788156-130788178 GTCTTGTTCAAAGTGAAAAATGG - Intergenic
1015280130 6:131424220-131424242 CTGTAGTTCATAGTGATAAAAGG + Intergenic
1015553731 6:134439482-134439504 TTGTTGTTCAAGGGGAAAAGTGG - Intergenic
1016110232 6:140213971-140213993 TTGGTGAGCATATGGAAAAATGG - Intergenic
1018583954 6:165335291-165335313 TTGTTGTTTAAATGGAAGAAGGG - Intronic
1019048084 6:169163255-169163277 TTGTGAGTCATGGGGAAAAATGG + Intergenic
1020599735 7:10257759-10257781 TTCTTGCTCATAGTGAAAAGTGG + Intergenic
1021794860 7:24243936-24243958 TAGTTCTTCATAGAGAAGAATGG + Intergenic
1021837289 7:24691676-24691698 TTAATTTTCTTAGGGAAAAAGGG + Exonic
1022810799 7:33866425-33866447 TTATTATTCATAAAGAAAAAAGG - Intergenic
1023527394 7:41118954-41118976 TTTTTGTTTATAGAGGAAAAAGG + Intergenic
1024060331 7:45692908-45692930 ATGTTGGTCAAAGGAAAAAAAGG + Intronic
1024726180 7:52198506-52198528 TTGATGTTCATAATGAAAATTGG + Intergenic
1026292688 7:69022451-69022473 TTGTATTTCACAGGGAAAACTGG + Intergenic
1026384511 7:69832800-69832822 TTGTTGTTGTTAGGGATAGAAGG - Intronic
1027288743 7:76678452-76678474 TTGTGGTTCATTCAGAAAAATGG + Intergenic
1027874379 7:83749902-83749924 TGCTTGCTCATAGGCAAAAATGG + Intergenic
1028320679 7:89456052-89456074 TTGGTGTTCATAGCAAAGAAAGG - Intergenic
1028600402 7:92594513-92594535 TATGTGTTGATAGGGAAAAATGG + Intergenic
1031205604 7:118753548-118753570 TTCTTGTTGTTAGGGAACAAGGG - Intergenic
1031491658 7:122397237-122397259 TTGTAGTTCATAGGAAATATAGG - Intronic
1031514216 7:122682249-122682271 TTGTTGTTCATCATGGAAAAGGG + Intronic
1031692499 7:124806965-124806987 TTGTTTTTCAAAAGTAAAAAGGG - Intergenic
1032365566 7:131295969-131295991 TTGTCACTCATAGGTAAAAATGG - Intronic
1032766030 7:134994758-134994780 TTTTTGTTCATAGAGGACAAAGG + Intronic
1035835199 8:2742967-2742989 TTGATGTTGATAGCCAAAAACGG + Intergenic
1036975211 8:13403638-13403660 TTGTTGCAAAAAGGGAAAAAAGG - Intronic
1037376829 8:18239403-18239425 TTCATTTTCATAGGAAAAAATGG + Intergenic
1037789609 8:21925574-21925596 TGGTTGGTCATAGGGAAAGGGGG + Intronic
1038913180 8:31990147-31990169 TTGTTTTACATATGGGAAAATGG + Intronic
1039654171 8:39380776-39380798 TTGTTGTTCATAGGTTCAAGAGG + Intergenic
1040126612 8:43744979-43745001 TTTTTCTTCATAGGCAAAAATGG - Intergenic
1040128969 8:43772055-43772077 TTTTTCCCCATAGGGAAAAATGG - Intergenic
1040882482 8:52221785-52221807 CTGTAGTTCCTGGGGAAAAATGG + Exonic
1043238976 8:77907042-77907064 TTGTTGTGCAATGGGAAATATGG - Intergenic
1043288549 8:78567157-78567179 TTGTTAATAATAGAGAAAAATGG - Intronic
1043364277 8:79513556-79513578 TTCTTGTACATAGAGAAAGATGG + Intergenic
1044505599 8:93014385-93014407 TAGTTGTTCATATAGCAAAATGG - Intronic
1045070829 8:98502831-98502853 TTGATGTTCATAAGGAATATTGG + Intronic
1046825789 8:118689999-118690021 CTGTTGTGCATAGGACAAAAGGG - Intergenic
1046942789 8:119947212-119947234 TGGATGTTCATAGGCAAGAAAGG + Intronic
1048514126 8:135090302-135090324 TTTTTGTTAAAGGGGAAAAATGG + Intergenic
1050716637 9:8535395-8535417 ATCTTGTTCAAAGGGAAAAGAGG - Intronic
1051084427 9:13331620-13331642 TTTTTTTTAATACGGAAAAAAGG - Intergenic
1051713674 9:19959046-19959068 GTGTGGATCTTAGGGAAAAAAGG - Intergenic
1052839638 9:33281057-33281079 TCGTTTTTCATAAGAAAAAAAGG - Exonic
1055807124 9:80108325-80108347 TTGTTGTTCAAAAAAAAAAAGGG + Intergenic
1057789171 9:98111400-98111422 TTGTTGTTTTTTGGTAAAAATGG - Intronic
1058632509 9:107003683-107003705 TTGTTTTTAATAAGGAAAACTGG + Intronic
1059003877 9:110380619-110380641 TTGATGTTCATCGGGGAAATTGG + Intronic
1059550752 9:115226461-115226483 TTCTTTTCCAAAGGGAAAAATGG + Intronic
1060535919 9:124388058-124388080 TAGTGGTTTATAGGGAAAAGAGG - Intronic
1203486634 Un_GL000224v1:61974-61996 TTGCTGTGCAGAGGGTAAAAAGG - Intergenic
1203499256 Un_KI270741v1:3874-3896 TTGCTGTGCAGAGGGTAAAAAGG - Intergenic
1186027645 X:5330856-5330878 TTGATGTTAATAGAGAAAGAGGG + Intergenic
1187996564 X:24933208-24933230 TCATAGTTCATAGGGAACAATGG + Intronic
1188006455 X:25019084-25019106 CTGTTGTTTATGGTGAAAAATGG + Intergenic
1188211345 X:27428890-27428912 TTGTTGTTTATAGGAAGAAAGGG - Intergenic
1188959752 X:36476564-36476586 TTTCTGTTCAAAGGGAATAATGG + Intergenic
1189138306 X:38573514-38573536 CTGTTAGTAATAGGGAAAAATGG - Intronic
1189716096 X:43867969-43867991 TACTTTTTCTTAGGGAAAAAAGG - Intronic
1190810830 X:53881740-53881762 TTGTTGTTCAGAAAGAATAATGG - Intergenic
1193802798 X:85956512-85956534 TGGTTGATCTTAGGAAAAAATGG + Intronic
1194567832 X:95515715-95515737 TTGTTGTTCAAGGAGAAAATTGG - Intergenic
1195114227 X:101680557-101680579 TTGTTTGTAAGAGGGAAAAATGG - Intergenic
1195506787 X:105667145-105667167 TTATTGTTCATATGTAAAATTGG - Intronic
1196161456 X:112488515-112488537 TTGTTGTTCCTGAGGAAGAAGGG + Intergenic
1197582162 X:128296813-128296835 TTTTTGTATATAGTGAAAAATGG - Intergenic
1199115732 X:143989893-143989915 ATATTGATCATATGGAAAAATGG - Intergenic
1199747568 X:150783401-150783423 TTGTAGTTCACAGGGTTAAAGGG - Intronic
1199787965 X:151122347-151122369 TTGATGTTCATAAGGAATATTGG - Intergenic
1200739659 Y:6839808-6839830 TTGTTGTTGTTATTGAAAAATGG + Intergenic
1202128031 Y:21585849-21585871 TTTTTGTTCATAGGGCAGATAGG - Intergenic