ID: 1106100456

View in Genome Browser
Species Human (GRCh38)
Location 13:26690892-26690914
Sequence ATTGATGAACAGATGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 412}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106100456 Original CRISPR ATTGATGAACAGATGGAGAG GGG (reversed) Intergenic
900485667 1:2921482-2921504 CTGGATGGACAGATGGACAGAGG - Intergenic
900485753 1:2921902-2921924 CTGGATGGACAGATGGACAGAGG - Intergenic
900485761 1:2921944-2921966 CTGGATGGACAGATGGACAGAGG - Intergenic
900498218 1:2986368-2986390 ATGGGTGAATAGATGGAAAGAGG - Intergenic
901006611 1:6174767-6174789 ATTGATGGATAGATGGTGGGTGG + Intronic
901297540 1:8171997-8172019 AATGATGAACAAATGTTGAGAGG - Intergenic
902687440 1:18087831-18087853 ATTAATGAAGAGGTGGGGAGGGG - Intergenic
902687454 1:18087888-18087910 ATTAATGAAGAGGTGGGGAGGGG - Intergenic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
903341661 1:22658744-22658766 ATGGATGGATAGATGGACAGAGG + Intronic
903341681 1:22658819-22658841 ATGGATGGACAGATGGACAGAGG + Intronic
903389665 1:22954930-22954952 GTTGCTGACCAGATGGGGAGTGG - Intronic
904464521 1:30699967-30699989 ATGGATGAAGGGATGGATAGAGG - Intergenic
905401419 1:37706402-37706424 GTTGATGAACAGATGGAGGCCGG - Intronic
906234138 1:44193586-44193608 GTTGATGAACAGAAGCAGAAGGG + Intergenic
906391227 1:45418367-45418389 ATTGATGACAAGATGCAGAATGG - Intronic
906482773 1:46210724-46210746 GTAGCTGAACAGATGGAGGGTGG - Intronic
907501504 1:54884929-54884951 AGGGATGGACAGATGGAGATGGG + Intronic
907614063 1:55905910-55905932 ATTGAAGAAAAGAAGGTGAGTGG + Intergenic
907820195 1:57959974-57959996 GTTGGTGAACAGTTGGTGAGTGG - Intronic
909294318 1:73927572-73927594 AATGATGAAAAGAAGGAAAGAGG + Intergenic
910712382 1:90195355-90195377 GTAGATGAAAAGAGGGAGAGAGG - Intergenic
911157708 1:94653385-94653407 ATTGATGGATTGATGGAAAGTGG - Intergenic
912660129 1:111520085-111520107 ATTGAAGACCATATGGAAAGAGG - Intronic
912749992 1:112279504-112279526 ATGGAAGAACACATGGAGAGAGG - Intergenic
912859000 1:113196337-113196359 ATAGCTGAACACATGGAGGGTGG + Intergenic
914196422 1:145450353-145450375 AATGATGAACAGGTGGAGGGAGG + Intergenic
917612903 1:176707347-176707369 ATGGATGAATTTATGGAGAGAGG - Intronic
918565416 1:185924528-185924550 ATTGTTGAATAGTTGTAGAGTGG + Intronic
918616876 1:186554158-186554180 ATTGAAGAACAGATAGAAAAAGG + Intergenic
918992536 1:191716500-191716522 TTTGATCAACAAATGGATAGCGG - Intergenic
920195429 1:204223309-204223331 ATGGATGAATGGATGGATAGTGG + Intronic
920406030 1:205711905-205711927 GTGGATAAACAGATGAAGAGAGG - Intergenic
920755561 1:208727747-208727769 ATGGATGGATAGATGGATAGAGG + Intergenic
920819579 1:209367898-209367920 CTAGATGACCAGATGGAGAATGG + Intergenic
921721799 1:218480693-218480715 ATTAATGAACAGATGTGAAGAGG + Intergenic
921930608 1:220751476-220751498 AATGATGAACTGTTGGAGAAAGG + Intronic
923084047 1:230688699-230688721 ATTGATGAAGAGAGGGAGGTTGG + Intronic
923218565 1:231872650-231872672 TTTTAAGAACAGATGGAAAGAGG - Intronic
923366834 1:233270036-233270058 ATGGATGACCAGATGGACAAAGG - Intronic
924509184 1:244714351-244714373 TTTGATTAGAAGATGGAGAGAGG - Intergenic
1062968586 10:1629014-1629036 ATTGATGAGAAGACAGAGAGAGG + Intronic
1063069560 10:2647724-2647746 ATAGATGAATAGATGGATGGAGG - Intergenic
1063877603 10:10496549-10496571 ATGGATGAAAAGATGGAGGGTGG + Intergenic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1064440809 10:15351697-15351719 ATGGATGGATGGATGGAGAGTGG + Intronic
1064877856 10:20015709-20015731 AATTATGAAAAGATAGAGAGAGG + Intronic
1065830631 10:29610755-29610777 ATTCATGAAAAGATGGAGGTTGG - Intronic
1066329162 10:34399253-34399275 ATTTATGCTCAGATAGAGAGTGG - Intronic
1066459607 10:35601675-35601697 ATTCATGGACACATGCAGAGTGG + Intergenic
1067685029 10:48461526-48461548 AATGAGGAATAGAGGGAGAGAGG + Intronic
1069312976 10:67062035-67062057 ATTGAAGAACAGATAGGAAGGGG + Intronic
1070504708 10:77103010-77103032 GTGAATGAACCGATGGAGAGGGG + Intronic
1071095478 10:81969090-81969112 ATTGTTGAACAGATTATGAGGGG + Intronic
1071490328 10:86131876-86131898 GTTGGTAAACAGATGGAGGGTGG - Intronic
1071693254 10:87844586-87844608 GTGGAGGAACAGGTGGAGAGTGG - Intergenic
1071840543 10:89466245-89466267 AGTGATGAACAAATGAAAAGAGG - Intronic
1073926552 10:108522697-108522719 ATTACAGTACAGATGGAGAGAGG - Intergenic
1074074758 10:110112804-110112826 ATTCAAGAACAGATGAAGAAAGG + Exonic
1074365911 10:112857354-112857376 ATTGATGAACAAATGAAGGAAGG - Intergenic
1074685853 10:115961939-115961961 ATAGATGACCAGATGGAGGCAGG + Intergenic
1075311937 10:121421708-121421730 AGTGAGGAACATGTGGAGAGGGG - Intergenic
1075316579 10:121458241-121458263 ATTGATGACCGAATGGGGAGGGG - Intergenic
1075843047 10:125520638-125520660 ATTGATGAGGAGATGGAGTTTGG + Intergenic
1075962843 10:126584362-126584384 ATGGATGGACAGATGGAAGGTGG - Intronic
1075962854 10:126584417-126584439 ATGGATGGACAGATGGAAGGTGG - Intronic
1076323871 10:129605414-129605436 AATGATGTACAGATGGGGACAGG - Intronic
1076599260 10:131646537-131646559 CTTGATGAACAGATGGTTTGTGG - Intergenic
1076825097 10:132963249-132963271 GTTGACGGACAGATGGAGGGAGG - Intergenic
1076825110 10:132963309-132963331 TTTGATGGACAGATGGAGGGAGG - Intergenic
1076825122 10:132963369-132963391 GTTGATGGACAGATGGAGGGAGG - Intergenic
1076825165 10:132963541-132963563 ATGGATGGATGGATGGAGAGAGG - Intergenic
1076845003 10:133065650-133065672 ATGGATGGATAGATGGAGGGTGG + Intergenic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280559 11:1743165-1743187 ATGGATGGACAGATGAAGAATGG + Intronic
1077280564 11:1743203-1743225 ATGGATGGACAGATGAAGAATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077280579 11:1743297-1743319 ATGGATGGACAGATGAAGAATGG + Intronic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077312124 11:1893557-1893579 ATGAATGGACAGAGGGAGAGAGG + Intergenic
1077354133 11:2107056-2107078 ATGGATGAATAGATGCATAGAGG + Intergenic
1077479903 11:2808874-2808896 ATGGATGAACACATGGACAATGG + Intronic
1077479921 11:2808973-2808995 ATAGATGCAGAGATGGAGGGAGG + Intronic
1077548963 11:3191169-3191191 AGTGGTGAAAAGATAGAGAGAGG + Intergenic
1079897676 11:26142482-26142504 AAAGATGAACAGATGGAATGAGG + Intergenic
1084408868 11:68994522-68994544 ACTGATGGACTGATGGACAGTGG + Intergenic
1084568568 11:69945417-69945439 ATGGATGAACAGATGATGAATGG + Intergenic
1084740004 11:71133410-71133432 ATGGATGGACAGATGGAGGGAGG + Intronic
1084841126 11:71849383-71849405 GTTTATGAACAGATGGATAAAGG - Intergenic
1084843523 11:71879043-71879065 TTTGATCAAAAGATGGTGAGAGG + Intronic
1085350034 11:75792398-75792420 ATTGAGGCCCAGAGGGAGAGAGG - Intronic
1085717248 11:78883355-78883377 ATGGCTAAACAGCTGGAGAGTGG + Intronic
1087434828 11:98101602-98101624 AGTGATTAACAGATGTACAGAGG + Intergenic
1087635186 11:100694263-100694285 ATTAATGTATATATGGAGAGTGG + Intronic
1088226534 11:107626509-107626531 AGGGAGGAACAGAGGGAGAGAGG - Intronic
1089580053 11:119476092-119476114 ATAGATGAATAGATGGATGGTGG + Intergenic
1089795524 11:120977517-120977539 GTTGAAAAACAGATGGAGCGGGG - Intronic
1090139771 11:124243967-124243989 AATGAGGAAAGGATGGAGAGAGG + Intergenic
1090139795 11:124244133-124244155 AATGAGGAAAGGATGGAGAGAGG + Intergenic
1090305939 11:125691140-125691162 CATGATAAACAGATGAAGAGAGG - Intergenic
1091057017 11:132429061-132429083 ATGGATGGATGGATGGAGAGTGG + Intronic
1091657684 12:2357517-2357539 AATTATGAACAGCTAGAGAGAGG - Intronic
1091833417 12:3567117-3567139 GTTGATCCACAGATGGAGAGGGG - Intronic
1092015423 12:5154657-5154679 AGTCATGAAAAGAGGGAGAGTGG + Intergenic
1092044283 12:5417911-5417933 ATTAATTGACAGATGGACAGAGG - Intergenic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1093106271 12:15091565-15091587 AGTGATGAACATTTGGAAAGAGG - Intergenic
1093185074 12:16010613-16010635 GTTTATGAACAGAAGGAGAGAGG + Intronic
1093953246 12:25188326-25188348 ATTTATGAAAAGATGTACAGTGG + Intronic
1093971489 12:25380115-25380137 AGTGGTGAAAAGATGGAGATAGG - Intergenic
1095758859 12:45804002-45804024 ATATATGAAGAGAGGGAGAGAGG + Intronic
1095917147 12:47491101-47491123 AATGATGAGCGCATGGAGAGTGG + Intergenic
1097064809 12:56313175-56313197 ATTAATGAACACATGGACACAGG - Intronic
1098023309 12:66177100-66177122 AATGATGAAGAGATGGTTAGAGG - Intergenic
1100370847 12:93967162-93967184 ATGGATGGACGGATGGAAAGAGG - Intergenic
1100552797 12:95662205-95662227 AAGGAAGAACAGAAGGAGAGGGG - Intronic
1101232309 12:102754035-102754057 GGTGGTGAATAGATGGAGAGTGG - Intergenic
1101539660 12:105653523-105653545 ATAGATGAACTCATGGAGACTGG + Intergenic
1101849613 12:108391818-108391840 ACTGAGGCAGAGATGGAGAGAGG + Intergenic
1103030262 12:117606821-117606843 ATTGAGGAAAACAGGGAGAGAGG - Intronic
1103038218 12:117673441-117673463 AAGGATGGACAGATGGAAAGAGG + Intronic
1105279768 13:18956596-18956618 ATGAATGAACAAATGGTGAGTGG - Intergenic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106100456 13:26690892-26690914 ATTGATGAACAGATGGAGAGGGG - Intergenic
1106412452 13:29520061-29520083 ATTGATGGATGGATGGTGAGTGG - Intronic
1107880451 13:44827730-44827752 ATTAATGAAGGGAAGGAGAGAGG - Intergenic
1108276272 13:48813012-48813034 ATTGGTGAGGAGATGGAGAAAGG - Intergenic
1109429561 13:62213456-62213478 ATTGAGGAAAAGACGGACAGAGG - Intergenic
1111737241 13:92158097-92158119 AAAGATAATCAGATGGAGAGTGG + Intronic
1112439144 13:99413024-99413046 ATAGATGAATAGAGGGACAGAGG + Intergenic
1112439151 13:99413137-99413159 ATAGATGAATAGAGGGATAGAGG + Intergenic
1114345936 14:21795217-21795239 ATTGGTGCACTGGTGGAGAGTGG - Intergenic
1114732186 14:25004730-25004752 ATTGAGGAAAAGAGGGAAAGAGG + Intronic
1115002160 14:28435803-28435825 GTGGAAGAACAAATGGAGAGTGG + Intergenic
1115490952 14:33957607-33957629 ATATATGAACAGAAGCAGAGAGG - Intronic
1116725297 14:48555042-48555064 ATGGATGAATAGATGAACAGTGG + Intergenic
1117045294 14:51807491-51807513 ACTAATGATCAGAGGGAGAGAGG + Intergenic
1118188242 14:63557144-63557166 ATTGCAGAACAGAGGGAGTGAGG - Intergenic
1118812527 14:69285758-69285780 CCTGAGGGACAGATGGAGAGGGG - Intronic
1119174781 14:72561108-72561130 ATTGATGAATTGATGGATAACGG - Intronic
1119294692 14:73523306-73523328 CTTGAAAAACAGATGGAAAGGGG + Intronic
1120102241 14:80458583-80458605 ATGTCTGAACAGATGAAGAGGGG - Intergenic
1122625081 14:103080926-103080948 AATGATGAACAGGTGCTGAGCGG + Intergenic
1122877508 14:104675641-104675663 ATGGATGGACAGATGGATAATGG + Intergenic
1202923403 14_KI270724v1_random:4199-4221 AGGGAGGAACAGAGGGAGAGAGG - Intergenic
1123427724 15:20185615-20185637 ATGGAGGGACAGATGGGGAGGGG - Intergenic
1123536961 15:21192165-21192187 ATGGAGGGACAGATGGGGAGGGG - Intergenic
1123804639 15:23858836-23858858 GTTAATCAACAGATGCAGAGTGG + Intergenic
1124147718 15:27143831-27143853 ATTTATGAATTGATTGAGAGAGG - Intronic
1125403253 15:39326752-39326774 AGTTATGAGCAGATGGAGGGAGG - Intergenic
1126315097 15:47361672-47361694 TTTGAGGAACAGATGATGAGAGG + Intronic
1126719617 15:51563833-51563855 ATTGAGGTAAGGATGGAGAGGGG - Intronic
1127631997 15:60836271-60836293 CTTTATGTGCAGATGGAGAGAGG + Intronic
1128320244 15:66688491-66688513 ATGGAAGAACAGAAAGAGAGAGG - Intergenic
1128550120 15:68592632-68592654 ATATATGAATAGATGCAGAGAGG - Intronic
1128793413 15:70449151-70449173 ATGGATGGAGAGATGGAGGGAGG + Intergenic
1130640573 15:85670227-85670249 AGTGATAAAGAGAGGGAGAGAGG - Intronic
1132621938 16:871879-871901 AGAGATGAACAGCAGGAGAGGGG + Intronic
1132631705 16:920833-920855 AACGAGGGACAGATGGAGAGAGG + Intronic
1133887682 16:9845812-9845834 TGTGATGAACAGAAAGAGAGTGG - Intronic
1135555286 16:23431063-23431085 ATTAATGAACAGACAGAGACAGG + Intronic
1135840295 16:25870087-25870109 ATAGATGGACAGATGGATGGAGG - Intronic
1135887039 16:26319622-26319644 AGTGGTGAACAGAGGTAGAGAGG + Intergenic
1136290832 16:29270419-29270441 ATAGGTGAACTGATGGAGACTGG + Intergenic
1137798960 16:51245124-51245146 CGTGATGAATAGAAGGAGAGTGG - Intergenic
1140895066 16:79317454-79317476 ATGGAAGAAAAGAGGGAGAGAGG - Intergenic
1141483729 16:84324964-84324986 ATGGATGAATAGATTGATAGAGG - Intronic
1141596501 16:85100153-85100175 ACTGAAGAACAGATGGAGGGGGG + Exonic
1141854827 16:86673844-86673866 ATGGATGAAGGGATGGAGGGAGG - Intergenic
1141854847 16:86673943-86673965 AGGGATGAACAGATGGATGGGGG - Intergenic
1141854853 16:86673963-86673985 ATGGATGAAGGGATGGAGGGAGG - Intergenic
1141854867 16:86674014-86674036 ATGGATGAAGGGATGGAGGGGGG - Intergenic
1141854945 16:86674343-86674365 ATGGATGAAGAGATGGAGGGAGG - Intergenic
1142124039 16:88401419-88401441 GATGATGGACAGATGGATAGAGG + Intergenic
1142152707 16:88519746-88519768 ATAGATGGACAGATGGATGGTGG + Intronic
1143533155 17:7517967-7517989 ATGAATGAAAAAATGGAGAGAGG - Intergenic
1143689027 17:8545034-8545056 ATAGCTGACCAGAGGGAGAGAGG - Intronic
1143769166 17:9157006-9157028 ACGGATGGATAGATGGAGAGAGG - Intronic
1146497466 17:33336001-33336023 GTTGCTGAACAGAAGGACAGAGG - Intronic
1146826734 17:36029614-36029636 GTGGATGAACAGATGGACAGAGG - Intergenic
1146939193 17:36832296-36832318 ATGGATGGACAGATGGATGGTGG - Intergenic
1147977503 17:44256183-44256205 ATGGATGAATAGATGGATAATGG - Intronic
1148614651 17:48991177-48991199 ATGGAGGAACAAAAGGAGAGGGG + Intergenic
1148792690 17:50182404-50182426 ATTGATCAAGAGATGGAGCCTGG + Intergenic
1148980058 17:51565659-51565681 AGTGAGGGACAGATGGAGATGGG - Intergenic
1151140444 17:71986405-71986427 ATCAAAGTACAGATGGAGAGTGG - Intergenic
1151526585 17:74673668-74673690 ATTGATCACCAAATTGAGAGTGG + Intronic
1155519259 18:26652719-26652741 ATTGTTGAACAAATGGAGGGAGG + Intronic
1155802347 18:30123410-30123432 ATAGATGTATAGATAGAGAGGGG - Intergenic
1156030869 18:32710771-32710793 AGAAATGGACAGATGGAGAGGGG + Intronic
1156100830 18:33593068-33593090 ATTGTTGAAAAGATAGAGAAAGG + Intronic
1156617416 18:38803839-38803861 ATGGATGAAAAGATAGGGAGAGG - Intergenic
1157793559 18:50555233-50555255 GTTGAAGAACAGAGGAAGAGTGG - Intergenic
1159479055 18:68963578-68963600 AGTGAAGAACAGATGGAGCCAGG - Intronic
1159719453 18:71869302-71869324 ACTGATACACAGATGGAAAGGGG - Intergenic
1160521131 18:79508782-79508804 ATGGACGGAGAGATGGAGAGAGG - Intronic
1160681772 19:414952-414974 ATGGATGGACAGATGGAAAATGG + Intergenic
1161857888 19:6776197-6776219 ATGGATGAGCAGATGGATGGAGG - Intronic
1161982882 19:7638988-7639010 ATGGATGGACAGATGGATGGAGG - Intronic
1162535296 19:11260070-11260092 ATGGATGAACAGATGAATATAGG + Intronic
1163238454 19:16043500-16043522 ATGGATGAATGGATGGAGGGAGG + Intergenic
1163382706 19:16979295-16979317 ATGGATGAATAGATGGATGGAGG - Intronic
1163462150 19:17445471-17445493 ATTGATGGATAGATGGAGAGTGG - Intronic
1164012405 19:21215257-21215279 ATTTATGAAGAGGTGGAAAGTGG - Intergenic
1164797438 19:31045301-31045323 ATGGATGGATAGATGGAGACTGG + Intergenic
1166153585 19:40893519-40893541 AGTGAATAACAGTTGGAGAGTGG - Intronic
1167233755 19:48301637-48301659 ATGGATGAACAGATGGATGTGGG + Intronic
1167718803 19:51163152-51163174 ATTGATCAAGAAATGGAGAAAGG + Intergenic
1168070413 19:53947204-53947226 ATTGATAAACAGATGGAACCAGG - Intergenic
926967132 2:18427311-18427333 ATAGATGAACAGATGAGGAAAGG + Intergenic
928368929 2:30724840-30724862 TTTGATGAACAGAATGAGATTGG + Intronic
928879734 2:36084582-36084604 ATTGATGGAAAGATGGAGAGTGG - Intergenic
930987068 2:57602841-57602863 ATTGATGAACAAAAGGAAATAGG + Intergenic
931160660 2:59686724-59686746 ATGAATGAACAGATGAATAGAGG - Intergenic
931183981 2:59931757-59931779 GTTGGGGAAGAGATGGAGAGTGG + Intergenic
931364151 2:61604080-61604102 AGTGATGAATAGATGGAGGTGGG + Intergenic
932323209 2:70837116-70837138 ATGGATGAATGGATGGATAGAGG + Intergenic
932786537 2:74609693-74609715 ATTGGTGAGGAGATGGAGAAGGG - Intronic
933478039 2:82817721-82817743 ATAGCTGAGCAGATGGAGTGGGG - Intergenic
933545457 2:83705696-83705718 ACAGATTACCAGATGGAGAGGGG - Intergenic
934556135 2:95287986-95288008 GCTGGTGAACAGATGGAAAGGGG + Intronic
934902323 2:98170489-98170511 TTTTTTGAACAAATGGAGAGGGG + Intronic
935307901 2:101755655-101755677 GATGAGGAACAGAGGGAGAGCGG - Intronic
936355551 2:111746795-111746817 ATGGATGGGCAGCTGGAGAGGGG - Intergenic
936635257 2:114248907-114248929 ATCGATGAAAAGATGTAAAGAGG - Intergenic
936836995 2:116721211-116721233 ATCCATGCACAGATGGGGAGAGG - Intergenic
937155903 2:119718707-119718729 AGTGAAGAACAGTTGAAGAGAGG + Intergenic
938108156 2:128547180-128547202 ATGGATGGATAGATGGAGAATGG - Intergenic
938767733 2:134471789-134471811 ATGCATAAACAGTTGGAGAGAGG + Intronic
939242982 2:139585923-139585945 ACTGATAAACAGATAAAGAGAGG + Intergenic
939547302 2:143569384-143569406 AGAGAAGAACAGATGGAGACGGG + Intronic
940088644 2:149891661-149891683 ATTGGTGAAGAGATGGAGCATGG + Intergenic
940391658 2:153139576-153139598 AGATATGAACAGATGGAGATGGG + Intergenic
940763424 2:157763699-157763721 ATTGATTAATTGATTGAGAGAGG - Intronic
942384838 2:175431740-175431762 CTTGAAAAACAGATGAAGAGTGG + Intergenic
942787555 2:179717386-179717408 ATAGATGGATAGGTGGAGAGAGG + Intronic
942797872 2:179842696-179842718 TTTGCTGAACAGCTGGAGGGAGG - Intronic
943663371 2:190583179-190583201 CTTGATGGGCAGAAGGAGAGAGG + Intergenic
945044630 2:205770950-205770972 AGTGGTAAACTGATGGAGAGGGG - Intronic
945371625 2:209025631-209025653 AGTGAGCAACAGATGCAGAGAGG + Intergenic
946046577 2:216826378-216826400 AGTGAGGAACAGATGGAGAGCGG - Intergenic
946156671 2:217811559-217811581 ATTGTTGAACAGACAGAGTGGGG + Intronic
946300679 2:218822030-218822052 ACTGATGACCAGATGGGGAGGGG + Intergenic
947384827 2:229580582-229580604 ATAAAGGAACAAATGGAGAGAGG + Intronic
948029925 2:234809211-234809233 AAGGATGAACTGGTGGAGAGAGG + Intergenic
948578187 2:238967339-238967361 ATTGGTGAGATGATGGAGAGAGG - Intergenic
948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG + Intergenic
948963176 2:241356126-241356148 ATTGGTGAACGGACGGAGAAGGG - Intergenic
1169404365 20:5311250-5311272 ATTGCTGAACACATGGGGTGGGG + Intronic
1170721808 20:18887862-18887884 ATTGATGGACATGTGCAGAGAGG + Intergenic
1170881048 20:20296528-20296550 TTTGATGAACAAATTGAGTGAGG - Intronic
1172333834 20:34097294-34097316 ATGGTGGAACAGATGCAGAGAGG - Intronic
1172650005 20:36496182-36496204 ATTTTTGACCAGGTGGAGAGGGG + Intronic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1173056111 20:39614631-39614653 ATGGATGAACAGACAGAAAGAGG - Intergenic
1174230142 20:49039718-49039740 ATTGATGGGGAGATGGGGAGGGG - Intergenic
1174288176 20:49486808-49486830 ATAAATGAACTGATGGAGAAAGG - Intergenic
1174730052 20:52907286-52907308 AATGATAAAAAGAAGGAGAGTGG + Intergenic
1174747056 20:53073369-53073391 AATGATGAATGGATGGAGGGAGG - Intronic
1175053549 20:56177301-56177323 GTTCATGAACAGATGAAGTGGGG - Intergenic
1175131302 20:56791744-56791766 ATGGGTGGACAGATGGATAGAGG - Intergenic
1175512847 20:59545687-59545709 ATTGTTGAGCAGATGGAAAAGGG + Intergenic
1176421447 21:6519466-6519488 ATGAATGAACAGATGAAGGGAGG - Intergenic
1178713910 21:34946112-34946134 ATTCATGAAGAGCTGAAGAGAGG - Intronic
1179343407 21:40533630-40533652 ATGGATGGACAGATGGATGGAGG - Intronic
1179623705 21:42635164-42635186 GTGGATGAACAGATGGACAATGG - Intergenic
1179696937 21:43127782-43127804 ATGAATGAACAGATGAAGGGAGG - Intergenic
1180012822 21:45062521-45062543 ATAGATGGGTAGATGGAGAGAGG - Intergenic
1181905503 22:26192029-26192051 ATTGATGAATGGATGGACAGGGG - Intronic
1182023757 22:27101486-27101508 ATGGATGGATGGATGGAGAGAGG - Intergenic
1182039108 22:27222529-27222551 ATGGGTGGATAGATGGAGAGTGG + Intergenic
1182450121 22:30415056-30415078 ATTGAAGTACAGCAGGAGAGGGG - Intronic
1182458961 22:30470860-30470882 ATAGATGGATGGATGGAGAGTGG + Intronic
1183262291 22:36803516-36803538 ATGGATGGACAGATGGAGGGAGG + Intronic
1183289613 22:36991689-36991711 ATTGTGGAACGGAAGGAGAGTGG + Intronic
1184869404 22:47225805-47225827 ATGGATGACCAGTTGCAGAGAGG - Intergenic
1185104467 22:48859355-48859377 ATAGATGAATGGATGGAGGGTGG - Intergenic
949606024 3:5654787-5654809 TTTGATGGAGAGATGGAGAGGGG + Intergenic
950077096 3:10194997-10195019 AGTGAGGAACAGATGGGGAGGGG - Intronic
951515966 3:23560001-23560023 ATTAATAAACAGATACAGAGTGG - Intronic
952000562 3:28781103-28781125 ATAGATGGACATATGGAGAGAGG + Intergenic
952193749 3:31050772-31050794 ATTAAAGAACAAAAGGAGAGGGG + Intergenic
952573453 3:34745382-34745404 ATGGATGGAAAGATGGATAGTGG + Intergenic
952750813 3:36823429-36823451 CGTGATGAACTGAAGGAGAGAGG + Intergenic
953211875 3:40883042-40883064 ATGGAGGAACAGCTGGTGAGTGG + Intergenic
953702138 3:45204846-45204868 CTTGATGATCAGAAGGGGAGTGG - Intergenic
954623675 3:52010403-52010425 ATGGATGGACAGATGGATAGAGG - Intergenic
955139477 3:56255148-56255170 GTAGATGAAAAGATGGAGAAAGG - Intronic
955718152 3:61852978-61853000 TTAGATGAACAGATGCAAAGAGG - Intronic
955824263 3:62928672-62928694 ATGGATGAATAGATGGATGGGGG + Intergenic
956819257 3:72938225-72938247 ATGGATGTATAGATGGATAGGGG + Intronic
956900830 3:73714292-73714314 ATGGATTAAGAGATGGAGAAAGG - Intergenic
957254351 3:77817478-77817500 ATAGATGTACAGATTGAGACTGG + Intergenic
957877539 3:86168441-86168463 ATTGATTAAAAGATGGAGAGTGG - Intergenic
958903065 3:99910926-99910948 AAGGATGAAGAGATGGAGACTGG + Intronic
959625238 3:108442321-108442343 AAAGAAGCACAGATGGAGAGAGG + Intronic
960484394 3:118233707-118233729 ACTAATGAACACAGGGAGAGAGG - Intergenic
960883231 3:122367134-122367156 AAGGATGAAGAGAAGGAGAGAGG + Intronic
961014187 3:123454798-123454820 ATTGCAGAACAGATGTAGATTGG + Intergenic
961827780 3:129607595-129607617 AATGAGGAAAACATGGAGAGAGG + Intergenic
962410100 3:135133413-135133435 ATGGATGGACAGATGGACAGAGG + Intronic
963947507 3:151162418-151162440 ATTGATGAATTGATTGAGACAGG + Intronic
965642905 3:170849773-170849795 TTTGATGATGAAATGGAGAGAGG - Intronic
966722094 3:183073947-183073969 AGTGACTAACAGATGGGGAGTGG + Intronic
967023339 3:185542128-185542150 ATTCATGAACATGTGTAGAGTGG + Intronic
967081653 3:186055086-186055108 AATGATGAACAGATGGCAAAGGG - Intronic
967403916 3:189095278-189095300 AATGATGAACAAAGGGAGAGTGG + Intronic
968189035 3:196654090-196654112 ATGAATGAACAACTGGAGAGTGG - Intronic
969782223 4:9415409-9415431 GTTTATGAACAGATGGATAAAGG - Intergenic
969784620 4:9445123-9445145 TTTGATCAAAAGATGGTGAGAGG + Intronic
971137866 4:23889428-23889450 TCTGATGAACAGAGAGAGAGGGG + Intronic
971276409 4:25201870-25201892 ATTGAGGAACAGATGGTGTTTGG - Intronic
971964415 4:33534168-33534190 ATTGATAAACAAATAGAGAAAGG + Intergenic
972156996 4:36175717-36175739 ACTTATCAAAAGATGGAGAGGGG + Intronic
973269293 4:48244958-48244980 ATTAATGAACAAAGGGAGGGAGG - Intronic
973555482 4:52077353-52077375 AAGGAGGAAGAGATGGAGAGAGG - Intronic
973733231 4:53843953-53843975 AGTGATGAGCAGATGCAGAGAGG + Intronic
973767443 4:54176059-54176081 CTAGAAGGACAGATGGAGAGAGG + Intronic
973976168 4:56264548-56264570 ATCCCTGAACAGATGGTGAGAGG - Intronic
975383471 4:73728824-73728846 ATTTTTAAAAAGATGGAGAGGGG - Intergenic
977359125 4:95981316-95981338 ATGGATGACCAGCTGCAGAGAGG + Intergenic
977706306 4:100074891-100074913 ATTGATAGCCAAATGGAGAGTGG + Intergenic
978247289 4:106589251-106589273 ATAGATGAACAGACAGAAAGAGG - Intergenic
978577238 4:110199248-110199270 ATTAATGAACAGAGGCAGAGTGG + Intergenic
978797238 4:112720394-112720416 ACTGGAGAAAAGATGGAGAGAGG - Intergenic
978857994 4:113414991-113415013 ATTGAGGAACAGATGGTGTTTGG + Intergenic
979046074 4:115866888-115866910 ATTGCTGAACAAATGCAAAGAGG - Intergenic
979483645 4:121246820-121246842 ATTGAAGCCCAGATAGAGAGAGG + Intergenic
979977994 4:127220574-127220596 ATTGATGGACAAATGGATATAGG - Intergenic
980148369 4:129016704-129016726 ATCCAAGAAGAGATGGAGAGAGG - Intronic
980306221 4:131064647-131064669 TAGGATGAACAGATGCAGAGAGG - Intergenic
980892126 4:138827119-138827141 CTTGCTGAATTGATGGAGAGAGG - Intergenic
982158026 4:152540422-152540444 ATGGATGACCAGCTGCAGAGAGG - Intergenic
983609419 4:169626223-169626245 ACAGATGAACAGATGCATAGGGG + Intronic
985929291 5:3043707-3043729 ATGGATAAAGAGATGGAGACAGG - Intergenic
987331424 5:16860768-16860790 GTGGATGGACGGATGGAGAGAGG + Intronic
987379308 5:17269948-17269970 AGTGATGAAGAGGTGGTGAGGGG + Intronic
988022057 5:25633402-25633424 AATGATGAACACATGGACATAGG + Intergenic
989454644 5:41628988-41629010 ATTGATGTACTGATGGAAAATGG - Intergenic
990476309 5:56164488-56164510 AGTGATGAAAAGAGGCAGAGTGG + Intronic
990718133 5:58661826-58661848 ACTGAGGAAGAGATGGACAGAGG + Intronic
994294874 5:98079108-98079130 ATTAATGAACAGATTGGCAGTGG - Intergenic
994534864 5:101016903-101016925 ATTGTTTAACAGATGGTGGGTGG - Intergenic
994591223 5:101775237-101775259 ATGGAGGGACAAATGGAGAGAGG - Intergenic
994921561 5:106051190-106051212 ATTGATGAATTGATGGACAGAGG + Intergenic
996145098 5:119965136-119965158 ATAGAAGGACAGCTGGAGAGGGG - Intergenic
999479921 5:151938597-151938619 AAAGATGAAGAGATGCAGAGGGG + Intergenic
1000487685 5:161868526-161868548 ATTGATGAAAACATCAAGAGAGG + Intronic
1000666718 5:164006804-164006826 ATTTATAAACAGAAGGAAAGAGG + Intergenic
1001425768 5:171621322-171621344 ATATATGAACAGATGGAAGGTGG + Intergenic
1001517038 5:172363163-172363185 ATGGATGGACAGATGGATGGAGG - Intronic
1001855760 5:175009380-175009402 ATAGATGAATAGATGGATGGAGG + Intergenic
1003431929 6:6047047-6047069 TGTGATGAACGGATGGAAAGGGG + Intergenic
1004121773 6:12830458-12830480 AATGATGACTAGAAGGAGAGAGG + Intronic
1004366131 6:15014206-15014228 ATTGAGGAAGTGTTGGAGAGGGG - Intergenic
1006945029 6:37779245-37779267 AATCATTAACAGGTGGAGAGAGG + Intergenic
1008970095 6:57357293-57357315 ATTGCTGAAGAGTTGGGGAGGGG - Intronic
1009159061 6:60259108-60259130 ATTGCTGAAGAGTTGGGGAGGGG - Intergenic
1010816733 6:80366679-80366701 ATGGATGAATGGATGGATAGAGG - Intergenic
1015423907 6:133042176-133042198 AGTGAGGCATAGATGGAGAGGGG - Intergenic
1016687126 6:146894635-146894657 TTTGATGAACAGAAAGACAGAGG + Intergenic
1016957915 6:149644264-149644286 ATTAAGGAAAAGAGGGAGAGAGG - Intronic
1017130043 6:151100404-151100426 ATTGATGAAGAGAGGGAACGAGG - Intronic
1018963137 6:168462892-168462914 GTGGATGATCAGATGGTGAGAGG + Intronic
1019095404 6:169575385-169575407 ATGGATGGATGGATGGAGAGAGG - Intronic
1019103424 6:169650145-169650167 ATGGATGGAGGGATGGAGAGGGG - Intronic
1019202492 6:170329813-170329835 CTTGATGAAGAGAAGAAGAGTGG - Intronic
1019804588 7:3113934-3113956 ATTGTGAAACAGATGGAGTGTGG + Intergenic
1020521938 7:9201353-9201375 ATGGATGGATAGATAGAGAGAGG + Intergenic
1020602025 7:10287876-10287898 ATTGAGGAACAGGTGGTGATAGG + Intergenic
1021703625 7:23345135-23345157 ATTGATGAACTGAGGAAGAGTGG - Intronic
1022031413 7:26494562-26494584 ATTGATGACCATTTGGGGAGTGG - Intergenic
1022525188 7:31032633-31032655 ATGGACTAACACATGGAGAGAGG + Intergenic
1023579486 7:41666144-41666166 ATTGATGAACTTTTGGAGGGGGG - Intergenic
1025120122 7:56294727-56294749 ATAGATGAATGGATGGATAGTGG + Intergenic
1028516476 7:91682746-91682768 CTAGCTGAACACATGGAGAGTGG + Intergenic
1028696402 7:93717817-93717839 AGTGAGGGAAAGATGGAGAGAGG + Intronic
1029101181 7:98131360-98131382 AGAGATGAAGAGAGGGAGAGTGG - Intronic
1030680184 7:112426034-112426056 ATTCATGAAAGGAAGGAGAGAGG - Intronic
1030939960 7:115633671-115633693 ATTGTTGAACAGATTTAAAGAGG - Intergenic
1031111646 7:117617836-117617858 ATTGAGGAAAAGATGGAAAGTGG - Intronic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1032535371 7:132658489-132658511 ATTGATGGAAAGATGAATAGAGG - Intronic
1035078588 7:156198037-156198059 CTGGAGGAACACATGGAGAGAGG - Intergenic
1035488901 7:159254904-159254926 ATTGAAGAACAGGTGAAGATGGG + Intergenic
1035647963 8:1242908-1242930 ATGGATGGACAGATAGACAGTGG + Intergenic
1036605055 8:10297242-10297264 GAAGATGAACAAATGGAGAGGGG - Intronic
1036836907 8:12079034-12079056 GTTTATGAACAGATGGATAAAGG + Intergenic
1036858699 8:12325280-12325302 GTTTATGAACAGATGGATAAAGG + Intergenic
1037038752 8:14203921-14203943 ATTCATAAATATATGGAGAGGGG + Intronic
1037038764 8:14204008-14204030 ATTCATAAATATATGGAGAGGGG + Intronic
1038476921 8:27875158-27875180 AGGGAGGAACAGAGGGAGAGAGG - Intronic
1039250180 8:35654956-35654978 AATGATGCACAGATGGAAAGTGG + Intronic
1041092912 8:54319290-54319312 ATACAAGAACAGATGGACAGTGG + Intergenic
1041152127 8:54945329-54945351 CTTGATGAAGAAATGGAGAAGGG - Intergenic
1042951681 8:74206521-74206543 ATGGATGAACACGTGGAGACAGG - Intergenic
1044753246 8:95436384-95436406 ATTGATGAACACATGTGGACAGG + Intergenic
1045958913 8:107943910-107943932 AAAGAAGAACAGAGGGAGAGGGG + Intronic
1046924205 8:119768753-119768775 ATTGAAGCAGAGAGGGAGAGGGG - Intronic
1046935944 8:119885835-119885857 ATTAATTGACAGATGGATAGAGG - Intronic
1047826096 8:128577423-128577445 TTTTATAAAAAGATGGAGAGAGG + Intergenic
1048091580 8:131246887-131246909 ATTGCTGAACAGTGGGGGAGGGG + Intergenic
1048093025 8:131261683-131261705 AGTGATGAAATGATGGAGAATGG - Intergenic
1049155278 8:141062478-141062500 ATGGATGACTGGATGGAGAGAGG + Intergenic
1049350698 8:142163007-142163029 ATTGATGTATAGATGGAGGATGG + Intergenic
1049364272 8:142229175-142229197 ATGGATGGACAGATGGTGAATGG + Intronic
1049381526 8:142318751-142318773 ATGGATGGACAGGCGGAGAGAGG + Intronic
1049833131 8:144714586-144714608 ATGGATGAACAGATACAGAATGG - Intergenic
1049956408 9:696934-696956 ATTGATGCACAGATGAAGAAAGG + Intronic
1050182366 9:2934605-2934627 CTGGATGAACAGCTGCAGAGAGG + Intergenic
1050752035 9:8950378-8950400 ATTTAGGAACATATGGAGAAGGG + Intronic
1051196132 9:14564536-14564558 ATTGTTTAAGGGATGGAGAGGGG + Intergenic
1053290030 9:36873704-36873726 TTTGAGCATCAGATGGAGAGAGG - Intronic
1053389980 9:37727712-37727734 GGTGATGAACAAGTGGAGAGAGG + Intronic
1053390000 9:37727805-37727827 GGTGATGAACAAGTGGAGAGAGG + Intronic
1054882173 9:70155386-70155408 ATTGATCAGGAGATGAAGAGAGG - Intronic
1055010508 9:71560163-71560185 AGAGATGGACAGGTGGAGAGAGG + Intergenic
1056249317 9:84731945-84731967 AGTGATTAACAGATGGGGAAGGG - Intronic
1057028218 9:91752858-91752880 ATTGATGGACAGATGGAGGCTGG + Intronic
1057673645 9:97119083-97119105 ATTGAAGAACAGAGAGAAAGTGG + Intergenic
1057673731 9:97120161-97120183 ATTGATCAAAAGATGGAGATTGG + Intergenic
1057715408 9:97491277-97491299 ATTTAAGAACAGATGGATAATGG - Intronic
1058037520 9:100269210-100269232 ATGGATGAACAGCTCCAGAGAGG - Intronic
1058075778 9:100649279-100649301 ATTTTTGTACAAATGGAGAGGGG + Intergenic
1058375779 9:104319921-104319943 ATTGATGAAGAGGCAGAGAGTGG + Intergenic
1059304922 9:113346668-113346690 CTTGATGAACAGATAGGGAAAGG + Intergenic
1059324061 9:113492786-113492808 ATTGAAGAACACTTAGAGAGAGG + Intronic
1059739447 9:117135473-117135495 ATTAATGAATGGATGGAGACGGG - Intronic
1060985698 9:127817874-127817896 ATGGATGGATAGATGGACAGTGG + Intronic
1061116617 9:128617445-128617467 ATAGATGCATAGATGGACAGAGG + Intronic
1061244930 9:129396683-129396705 ATGGATGAAAAGATGAAGGGTGG + Intergenic
1061911843 9:133729177-133729199 CATGATGAACGGATGGAAAGAGG + Intronic
1062698310 9:137886482-137886504 AATGATGAACAGGTGGAGGGAGG - Intronic
1185661633 X:1733197-1733219 ATTGAAGAAAAAAAGGAGAGGGG + Intergenic
1186150470 X:6669474-6669496 ATGAATGAATGGATGGAGAGTGG + Intergenic
1190219072 X:48499355-48499377 ATGGATGGACAGATGGACAGTGG + Intergenic
1191905757 X:66087793-66087815 ATTGAGGAACAGATGGTGTTTGG + Intergenic
1193872127 X:86812494-86812516 ATTGATTAATAGATTTAGAGAGG + Intronic
1194432822 X:93831690-93831712 ATTTATCAACATATGCAGAGTGG - Intergenic
1195454624 X:105053619-105053641 ATTGATGAACATATTAAGTGAGG - Intronic
1195792919 X:108608532-108608554 ATAGATGAATGGATGGAGACAGG - Intronic
1196514864 X:116597730-116597752 ACTGGTGAAGAGATGGAGAAAGG - Intergenic
1196532896 X:116810184-116810206 ATGGAAGAAGAGATGGAAAGAGG - Intergenic
1196800793 X:119541549-119541571 ATTACTGAAAAGATGGAGAATGG - Intronic
1197105820 X:122714177-122714199 AAAAATGAACACATGGAGAGAGG + Intergenic
1197606478 X:128591310-128591332 AATGATGAACACATGGACACAGG - Intergenic
1199081041 X:143577150-143577172 ATTGATGCATAGATGGAGGGTGG + Intergenic
1199595760 X:149504818-149504840 ATGGATGAATAGATGGAAAGAGG + Intronic
1200882855 Y:8237533-8237555 ATGGAGGGACAGAGGGAGAGGGG + Intergenic
1202162885 Y:21953855-21953877 AGTAATGAACACATGGACAGAGG - Intergenic
1202228471 Y:22632513-22632535 AGTAATGAACACATGGACAGAGG + Intergenic
1202314686 Y:23563663-23563685 AGTAATGAACACATGGACAGAGG - Intergenic
1202556115 Y:26106930-26106952 AGTAATGAACACATGGACAGAGG + Intergenic