ID: 1106101106

View in Genome Browser
Species Human (GRCh38)
Location 13:26695684-26695706
Sequence CTGTGGCTTTCACACTTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106101099_1106101106 8 Left 1106101099 13:26695653-26695675 CCTTTTACAAAGATGTTTTGCTG 0: 1
1: 0
2: 2
3: 28
4: 412
Right 1106101106 13:26695684-26695706 CTGTGGCTTTCACACTTAGGTGG 0: 1
1: 0
2: 0
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106101106 Original CRISPR CTGTGGCTTTCACACTTAGG TGG Intergenic
900470936 1:2854653-2854675 CTGTGGCTTGCAGACTGAGTTGG - Intergenic
905410725 1:37766140-37766162 CTGAGGGTTTAACACTTTGGTGG + Intergenic
912760396 1:112361020-112361042 CTGTGGCTTAAAAACTCAGGTGG - Intergenic
913204848 1:116528878-116528900 TTGTGGATTTGGCACTTAGGAGG - Intronic
917974799 1:180231603-180231625 CTGTGGCTTGCACGCTCAGCAGG + Intronic
918516995 1:185374389-185374411 CTGTTGCTTTAGCACCTAGGAGG - Intergenic
919080755 1:192863149-192863171 CTGTTGCCTTCACACTTACATGG - Intergenic
923790103 1:237104526-237104548 CTGTGCCTTTTACAATTATGTGG + Intronic
1064551533 10:16506149-16506171 CATTGGATTTCACAATTAGGAGG + Intronic
1068142823 10:53028183-53028205 GTGTGCCTTTAACACTTTGGTGG + Intergenic
1068524331 10:58110087-58110109 CTGTGGCTTTCTCACTTTCTCGG - Intergenic
1070541128 10:77416170-77416192 ATGTGGCTTTCAGACTTCAGGGG + Intronic
1070996333 10:80786465-80786487 CTGGGGCTTTACCACTTAAGTGG - Intergenic
1072895233 10:99360628-99360650 CAGTGTTTTCCACACTTAGGGGG - Intronic
1084539319 11:69776278-69776300 CAGGGGTTTTCACACCTAGGTGG - Intergenic
1085518059 11:77122754-77122776 CTGAGGCTTCCCCACTCAGGGGG + Intronic
1085680097 11:78565153-78565175 CTGTGGCTTTCCCAGGTAGAGGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1085916959 11:80902009-80902031 CAGTGGCTTTCACACATAAATGG - Intergenic
1090555318 11:127868422-127868444 CTTTGGCTTTCACATTTATCTGG + Intergenic
1090751809 11:129752881-129752903 CAGTGGCTCACACACTTTGGAGG + Intergenic
1091152031 11:133337967-133337989 CTGTGGCTTCCACAGGTAGCAGG - Intronic
1093820879 12:23616299-23616321 CTGTGGATTAACCACTTAGGAGG - Intronic
1096191351 12:49622286-49622308 CTGTGGTTTTCAAACTTTTGGGG - Intronic
1096307217 12:50488290-50488312 CATTGGATTTCACAATTAGGTGG + Intergenic
1098210229 12:68156088-68156110 CAGTGGTTCTCAAACTTAGGTGG - Intronic
1100028055 12:90153160-90153182 CTGTGGTTTGCACAGTTATGTGG - Intergenic
1101936911 12:109065627-109065649 CTATGGATTACACTCTTAGGGGG + Intronic
1103051358 12:117782734-117782756 TTTTGGCTTTTTCACTTAGGAGG - Intronic
1103562367 12:121799516-121799538 CTGTGTCTTTCAGAAGTAGGCGG + Intronic
1105291266 13:19055251-19055273 CTGTGGGATTCTCACTGAGGAGG - Intergenic
1106101106 13:26695684-26695706 CTGTGGCTTTCACACTTAGGTGG + Intergenic
1106863408 13:33936143-33936165 CTGTGGCTTCCACACCTTGGGGG - Intronic
1107918949 13:45183382-45183404 CTGTGGCTTCCATCCTCAGGGGG + Intronic
1109116229 13:58390053-58390075 TTGTGCATTTCACACTTAGAAGG + Intergenic
1111644975 13:91021473-91021495 CTGTGCCTTTCACATTTGGATGG - Intergenic
1113428885 13:110231847-110231869 TTGTGGATTTCTCACCTAGGAGG + Intronic
1115056212 14:29130886-29130908 CTGTGCCTTTCACCAGTAGGTGG + Intergenic
1116755031 14:48937043-48937065 CTGTTGCTTTAACACTTTGGGGG + Intergenic
1121832329 14:97063134-97063156 CTGTGTCTGTCACACCTGGGGGG - Intergenic
1122888442 14:104721978-104722000 CTGTGGGTTCCACTCTTTGGGGG - Intronic
1124672090 15:31649671-31649693 CTTTGGCTTTCACAGGTAAGAGG - Intronic
1124952326 15:34335441-34335463 CTATGGTTTTCAAACTTGGGTGG + Intronic
1129436207 15:75542665-75542687 CTGGGGCTGTCACACTTGGCTGG - Intronic
1130149536 15:81300666-81300688 CTCTGCCTTTCACATTAAGGAGG + Intronic
1130292959 15:82621002-82621024 GTGTGGCTTTAACAGTTAAGTGG - Intronic
1131956405 15:97740628-97740650 CTGTGGCTTTCATACAGAGGAGG - Intergenic
1135993381 16:27230841-27230863 CTGTGCCTTTCTCAGTTCGGTGG - Intronic
1140280891 16:73554708-73554730 CGGTGGCTGACACACTCAGGAGG + Intergenic
1141154497 16:81587796-81587818 CTGAGGCTCTCACCCTCAGGAGG - Intronic
1142248159 16:88979154-88979176 CTGTGGCTTTCAGAGCTGGGCGG + Intergenic
1143980686 17:10866993-10867015 ATGTGGCTTCCACACATGGGTGG + Intergenic
1146705482 17:34998024-34998046 CTGTGGCTTTGAAACACAGGAGG - Intronic
1149416050 17:56461053-56461075 CTGTGGGTTCCACACTTACAGGG - Intronic
1149658546 17:58322961-58322983 CTGTGGCTCTCCCACTGAGCCGG + Exonic
1152819956 17:82432467-82432489 CTGTGGTTTCCACAGTGAGGGGG + Intronic
1155996232 18:32333941-32333963 TTGTGGCTTTCCTGCTTAGGTGG - Intronic
1156393888 18:36680220-36680242 CTATGGCTATCACTCATAGGTGG - Intronic
1157577876 18:48755637-48755659 CTGTTGCCTTGACACTTGGGTGG - Intronic
1157991766 18:52504780-52504802 TGGTGGCTTTTACACTGAGGTGG - Intronic
1159841824 18:73407055-73407077 CTGGGGCTCTCACACTCATGGGG - Intergenic
1161145489 19:2675717-2675739 CTGTGGTTTTCACGATTGGGGGG + Intronic
927545329 2:23947800-23947822 CAGTGGCTTGCACACATTGGTGG + Intronic
929612232 2:43279619-43279641 TTGTGGCTTTCCCACTAAGATGG + Intronic
929909434 2:46076390-46076412 CCGTGGCTTTCACACACAGATGG + Intronic
931467457 2:62503637-62503659 CTGTGCCTGGCACACTTAGTAGG + Intronic
935201209 2:100858178-100858200 CTGTAGCTTTCACAGTGAGAAGG - Intronic
935453862 2:103242931-103242953 CTGTGGTTCTCACACTTTGCAGG - Intergenic
937904833 2:127047947-127047969 CTGTGGCTTTCTTACTGAGATGG - Intergenic
938202060 2:129380404-129380426 TTGAGGCTTGCTCACTTAGGTGG - Intergenic
938824515 2:134991712-134991734 CTGTGGAATTCACACAGAGGTGG + Intronic
939419236 2:141944341-141944363 CTGGGACTTTCACATTTAAGAGG - Intronic
940908757 2:159191858-159191880 CTGTGGTTTTCACATTTAGTGGG + Intronic
941305566 2:163861303-163861325 CTTTGTCTTTTTCACTTAGGTGG + Intergenic
943304911 2:186249028-186249050 CAGTTGCTTTCAGACCTAGGAGG - Intergenic
944479935 2:200145978-200146000 CTGTGGAACTCACACTCAGGTGG + Intergenic
944961672 2:204881937-204881959 TTGTGGCTTTCACTTTTAGAGGG + Intronic
946118798 2:217490561-217490583 CTGGGGCTTCCACACCTAGCAGG - Intronic
1170810052 20:19667128-19667150 CTCTGACTTTCAGAATTAGGGGG + Intronic
1173362749 20:42359441-42359463 CAGTGGTTTTCAGCCTTAGGAGG - Intronic
1178815886 21:35928987-35929009 CTTTGGCTTTCAAGCCTAGGGGG + Intronic
1179783403 21:43716830-43716852 CAGTGCCTTTCACCCTTGGGTGG + Intergenic
1180663276 22:17487814-17487836 CTGTGGCTTACACTCTTAAACGG + Intronic
1180694708 22:17744305-17744327 CTGTGGCCTTCTCACCTAGTGGG - Intronic
1180824731 22:18854612-18854634 CTGGGGCTTTCAGACCTGGGCGG + Intronic
1181125149 22:20697763-20697785 CTGGGGCTTTCAGACCTGGGCGG + Intergenic
1181187999 22:21119935-21119957 CTGGGGCTTTCAGACCTGGGCGG - Intergenic
1181211199 22:21290558-21290580 CTGGGGCTTTCAGACCTGGGCGG + Intergenic
1181265363 22:21628080-21628102 GTGTGTCTTTCAAACTTGGGTGG - Exonic
1181398305 22:22636330-22636352 CTGGGGCTTTCAGACCTGGGCGG - Intergenic
1181651109 22:24259730-24259752 CTGGGGCTTTCAGACCTGGGCGG + Intergenic
1181706271 22:24651009-24651031 CTGGGGCTTTCAGACCTGGGCGG - Intergenic
1181886597 22:26026825-26026847 CTGGGGCCTCCACACTAAGGAGG + Exonic
1182158896 22:28102021-28102043 CTATGGATTTCAAATTTAGGAGG - Intronic
1182939004 22:34255592-34255614 CTGTGGGTTTCACAGTTCTGTGG + Intergenic
1185157843 22:49204998-49205020 CTGTGGCTGGGACACTCAGGCGG + Intergenic
1203215750 22_KI270731v1_random:4873-4895 CTGGGGCTTTCAGACCTGGGCGG - Intergenic
1203274877 22_KI270734v1_random:80518-80540 CTGGGGCTTTCAGACCTGGGCGG + Intergenic
950485015 3:13267996-13268018 CTGGAGCTTTCACATTTGGGGGG + Intergenic
951687856 3:25364443-25364465 ATGTGGGCTTCACACTCAGGAGG + Intronic
953191549 3:40692061-40692083 CTCTGACCTTCACACTTATGTGG - Intergenic
954225677 3:49179433-49179455 CTTTGGCTATCACAAATAGGAGG - Intronic
954278265 3:49556555-49556577 CTGTGACTATCAGACTCAGGAGG + Intronic
957916549 3:86694544-86694566 GTGTGCCTTTAACACTTTGGTGG + Intergenic
961005803 3:123404614-123404636 CAGTGGCCTTCCCACTCAGGAGG - Intronic
963278614 3:143358514-143358536 CTGTGTCATTCACATTTATGGGG + Intronic
963670826 3:148249670-148249692 CTGTGCCTTTAACACTAATGGGG + Intergenic
964223269 3:154369544-154369566 GTGTGCCTTTAACACTTCGGTGG - Intronic
966706899 3:182926079-182926101 CTGTGGCTTTTACAGTGAGGTGG - Intergenic
967826982 3:193884877-193884899 CTGTGGTTCTCACACTTTAGAGG - Intergenic
968520320 4:1032126-1032148 CTGTGGCTTTCACACGCTGACGG - Intergenic
970825937 4:20274667-20274689 CTGTGGATTTCACACTCAGAAGG - Intronic
970877076 4:20884048-20884070 CTCTGGCCTTGACACTTATGTGG + Intronic
974233818 4:59153837-59153859 CTGAGGCCTTCAGACTTAGATGG - Intergenic
974966015 4:68761506-68761528 CTGTGGCTTTTCCAGTTGGGTGG + Intergenic
984623823 4:181982713-181982735 CTGTGGGTTTCACAGAAAGGAGG + Intergenic
985620975 5:955894-955916 CTATGGCTGTCACTCATAGGAGG - Intergenic
985660015 5:1152331-1152353 CTGTGGCTTCTACACTCAGTTGG - Intergenic
988334817 5:29893469-29893491 CTGTGGATCTCACACTTTGCTGG + Intergenic
990620183 5:57550566-57550588 CTGTGGGTTGCACACTTCCGTGG + Intergenic
990998121 5:61753812-61753834 ATGTGGCTTACACACCTGGGTGG + Intergenic
994213846 5:97114780-97114802 CTGAGGCTTACACAATTTGGGGG + Intronic
995246094 5:109937239-109937261 CTGAGGCATTTACACTTTGGGGG + Intergenic
999860048 5:155634936-155634958 CTGGGGCTTTCTCTCCTAGGAGG + Intergenic
1000403662 5:160862400-160862422 CTGTGGATTTCACACTTACCTGG + Intergenic
1004612588 6:17258276-17258298 CTTTGTCTTTCACACTTAATGGG - Intergenic
1004835954 6:19531752-19531774 CTGAGGCTTTCAGACTTAGACGG + Intergenic
1006424931 6:33958081-33958103 CTGTGGCTATGGCACTCAGGAGG - Intergenic
1007926616 6:45654842-45654864 CTGTGGCTTTGACCCCTAAGGGG - Intronic
1008880493 6:56376304-56376326 CTGTGGGTTTCACAGTAAGCTGG - Intronic
1012630458 6:101460146-101460168 CTGTGGCTTTGACACTGTCGTGG - Intronic
1013855066 6:114562685-114562707 CTGTGGCTTTGGCTCTTAAGAGG + Intergenic
1018579441 6:165295985-165296007 GTGTGGCTTTCTCACTTATGTGG + Intronic
1018789121 6:167132429-167132451 CTGGGGCTCTCACACTTTGTTGG - Intronic
1021236699 7:18151208-18151230 AGGTGGCTTTCTCACTCAGGGGG + Intronic
1027207802 7:76116224-76116246 CTGTGTGTTTCATAGTTAGGTGG - Intergenic
1029562410 7:101311545-101311567 CTGTCACTTTCACAGTGAGGAGG - Intergenic
1029868768 7:103665065-103665087 CTTTGCTTTTCACATTTAGGTGG + Intronic
1031389141 7:121191578-121191600 CTGTGGCTTTCAGACTAGTGTGG + Intronic
1032505702 7:132433011-132433033 CAGTGGCTCTTACACATAGGAGG + Intronic
1034163660 7:149010064-149010086 CTGTGGCTTTCAGAGTCAGATGG + Intronic
1034401660 7:150865634-150865656 CTGTGCCTCTCCCAGTTAGGGGG + Intergenic
1035373671 7:158394376-158394398 CTGTGCCTCTCACACTTCCGTGG - Intronic
1036107645 8:5857748-5857770 ATGTGGCCATCACACATAGGAGG + Intergenic
1036685886 8:10909961-10909983 CTGAGGCTTTCACATCTCGGGGG + Intronic
1037619574 8:20551524-20551546 CCGTGGGTTTCACTCTCAGGAGG + Intergenic
1041446562 8:57957744-57957766 CTGTGGCTCCCACACTGAAGCGG - Intergenic
1041649262 8:60285590-60285612 CTGTGGCTTAAACACATAAGGGG - Intergenic
1042821639 8:72936323-72936345 CTCTGGGTTTCACCCTTAGGCGG + Exonic
1047426694 8:124752980-124753002 CTGTGGGTTCCATTCTTAGGTGG + Intergenic
1050365005 9:4865824-4865846 CTGAGGCTTTAAGACTGAGGAGG - Intronic
1051877614 9:21808156-21808178 CAGTGGCTGTCAAACTTCGGTGG - Intronic
1052893368 9:33724138-33724160 CAGTGGCTCACACACTTTGGAGG + Intergenic
1057308896 9:93929077-93929099 CTGTGGCATACTGACTTAGGTGG - Intergenic
1057918612 9:99077057-99077079 CTGTGGCTATCAGCCTCAGGAGG - Intergenic
1059547608 9:115193982-115194004 CTGAGGCTTTGACAGTTAGTAGG - Intronic
1060428078 9:123523226-123523248 CTGTTGCTGTCACACGTAAGGGG - Intronic
1062045849 9:134424159-134424181 CTGTGGCTGTCCCTCTTAGGTGG + Intronic
1062678934 9:137765920-137765942 CTGTGAATCCCACACTTAGGTGG + Intronic
1185919543 X:4075149-4075171 CTGTGCCTTTTATACTTGGGAGG - Intergenic
1186311494 X:8323997-8324019 CTGTGACTTTCATCCTTAGCAGG - Intergenic
1186515051 X:10160785-10160807 ATCTGGCTTTGACACCTAGGAGG + Intronic
1191940381 X:66473702-66473724 CTCTTGCTTTCACAATGAGGTGG + Intergenic
1192291047 X:69795738-69795760 CTGTGGCTTTGCCACTGGGGAGG - Intronic
1192451192 X:71246082-71246104 CTGTGGCTTCCACTCTTCTGTGG + Exonic
1192756103 X:74048428-74048450 CTGTAGCTTTCATACTTGGGAGG + Intergenic
1195476262 X:105289297-105289319 GTTTGGCTTTCACTCTTAGATGG + Intronic
1201330101 Y:12809393-12809415 CTGTGGGTTTCATAAATAGGAGG + Intronic