ID: 1106105888

View in Genome Browser
Species Human (GRCh38)
Location 13:26733260-26733282
Sequence CTAAATATACAAGTAGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 9, 3: 55, 4: 404}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106105887_1106105888 6 Left 1106105887 13:26733231-26733253 CCTTGATTTTCTTTTCTTTTACT 0: 1
1: 2
2: 33
3: 515
4: 4531
Right 1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG 0: 1
1: 0
2: 9
3: 55
4: 404
1106105885_1106105888 29 Left 1106105885 13:26733208-26733230 CCCGTGGAGGATCTTTATACACA 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG 0: 1
1: 0
2: 9
3: 55
4: 404
1106105886_1106105888 28 Left 1106105886 13:26733209-26733231 CCGTGGAGGATCTTTATACACAC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG 0: 1
1: 0
2: 9
3: 55
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106105888 Original CRISPR CTAAATATACAAGTAGACAA TGG Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904483596 1:30809349-30809371 CTAAATGTACAAGATGACAGTGG + Intergenic
905957310 1:42009205-42009227 CAATAGATACCAGTAGACAATGG - Intronic
908244285 1:62215393-62215415 CTCAATATACAAACATACAATGG - Intergenic
908718500 1:67097060-67097082 GTCAATAAACAAGTAAACAAGGG + Intronic
909150948 1:72004137-72004159 ATAAATATATAATTGGACAAAGG - Intronic
909675145 1:78231137-78231159 CTGAATATAGAAGCAGACATAGG + Intergenic
909690344 1:78399518-78399540 CTAAATATCCAAGGGGACTAGGG - Intronic
910367339 1:86480349-86480371 CCAAATAGAAAAATAGACAAAGG + Intronic
910546812 1:88427337-88427359 ATCAATATTCAAGTAGACAAAGG + Intergenic
910724487 1:90324161-90324183 CTAAAGCTACAAGGAGCCAAGGG + Intergenic
910807216 1:91200761-91200783 AAAAATATACATGTCGACAATGG - Intergenic
910983092 1:92977997-92978019 TTAAAGATACACATAGACAAAGG - Intergenic
911811357 1:102285913-102285935 TTCAATATACAAGTAGAAGAAGG + Intergenic
912269011 1:108190558-108190580 CTAAATATACGAAGAGATAATGG - Intronic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
917469634 1:175315272-175315294 CTAAAAATACTAGTTAACAATGG + Exonic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917910991 1:179645943-179645965 CTAAATATAAAGATAGAGAAGGG - Intronic
918460272 1:184769296-184769318 CCAAAGAAACAAGTAGTCAAAGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918805829 1:189042630-189042652 CTCCATTAACAAGTAGACAAAGG - Intergenic
918814795 1:189168837-189168859 CTAGATCTATAACTAGACAAAGG + Intergenic
918872143 1:189989027-189989049 CTAACCATACAAGTATAAAATGG + Intergenic
919497031 1:198285824-198285846 AAAAATAAACAAGTAGAAAAAGG - Intronic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
920770081 1:208875779-208875801 CTAAATCTACAAATATCCAAAGG - Intergenic
921400102 1:214712807-214712829 CTACATATACAAGTATAAAGAGG - Intergenic
921989794 1:221352458-221352480 CTCAATTAACAAGTAGGCAAAGG - Intergenic
922065670 1:222137766-222137788 ATCAATATACAAGTACAAAAAGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922815779 1:228447776-228447798 CTAACTTTAAAAATAGACAAAGG - Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924396244 1:243624241-243624263 CTACATATAGAAGTTGTCAATGG + Intronic
924618774 1:245641348-245641370 ATAAATATTCAGGTACACAAAGG - Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1063927035 10:10989831-10989853 CTGACCATAAAAGTAGACAAAGG + Intergenic
1064592152 10:16905205-16905227 GTAAATAAACAAGTAGATAGAGG - Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067009171 10:42693383-42693405 GTAAATAAACAAGTAGATAGAGG - Intergenic
1068226268 10:54110391-54110413 GTATATATATAAGTAAACAAAGG + Intronic
1068361589 10:55980732-55980754 TTAAATATACAATTATACATAGG + Intergenic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069324093 10:67209384-67209406 CTAGAAATACAAGGAGAAAATGG + Intronic
1069564577 10:69454868-69454890 CAAAATTTAGAAGTAGAAAAGGG + Intronic
1070214395 10:74362079-74362101 ATAAATATTCAGGTAGACTAAGG - Intronic
1070399847 10:76043978-76044000 CTAATTATTTACGTAGACAAGGG - Intronic
1071050947 10:81448570-81448592 ATCAATATACAAGTACAAAAAGG - Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1072063068 10:91836301-91836323 CTAAAAATACTAGAAGAAAACGG - Intronic
1072863018 10:99026455-99026477 CTAGATATATAAGTACAAAAAGG + Intronic
1073365693 10:102938959-102938981 TAAAATAAACAAGCAGACAAAGG + Intronic
1074473211 10:113745862-113745884 CTAAATACAAAAATAGACACTGG + Intergenic
1074636976 10:115330794-115330816 ATAAATATTCAAGTACAGAAAGG - Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1075154076 10:119959477-119959499 CTAAATAAACAAACAAACAAAGG - Intergenic
1075218798 10:120565735-120565757 AGAAATATTCAAGTAGATAATGG - Intronic
1075434630 10:122426275-122426297 AAAAAAATACAAGTAGCCAAAGG - Intronic
1079415086 11:20226831-20226853 CCAAATTTACAAATAGACTAGGG - Intergenic
1080237363 11:30086618-30086640 AAAAATATACAAACAGACAATGG - Intergenic
1080497528 11:32834360-32834382 TAAAATCTACAAGAAGACAAAGG + Intronic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1082025578 11:47569061-47569083 CTAAATATTCAAGTACCCAAAGG + Intronic
1082682589 11:56194856-56194878 CTATATATATATGTAGGCAAAGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1084336897 11:68463478-68463500 GAAAATATAGAACTAGACAATGG - Intronic
1084730214 11:71068186-71068208 CTTAATCTACAAGTAGAAAGAGG + Intronic
1085763671 11:79263659-79263681 CTAAATGTCCAGGTAGCCAATGG + Intronic
1086224989 11:84497074-84497096 CTAATTAAACAAATAGATAATGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086524485 11:87709603-87709625 ATAAATATCCAAGTACAGAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1087711925 11:101563884-101563906 CTAAATGTACAAGTAGAAAATGG - Intronic
1090992596 11:131832822-131832844 TTAAATATATATATAGACAAGGG + Intronic
1091864979 12:3825621-3825643 GTAAATATACAAGAAGGAAAAGG + Intronic
1092054560 12:5498114-5498136 CTTTACAGACAAGTAGACAAAGG - Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094574193 12:31669062-31669084 ATAAATAAACAAGTAAACTAAGG + Exonic
1094794592 12:33956490-33956512 CTAAATATACAAACCAACAATGG + Intergenic
1095106448 12:38239104-38239126 CTAAATATACAAACCAACAATGG + Intergenic
1095328588 12:40929038-40929060 ACAAATACACAAGGAGACAATGG - Intronic
1095343119 12:41116350-41116372 TTCAATATTCAAGTAGACCATGG + Intergenic
1095421834 12:42032130-42032152 CTAAATAAGCAAGTACACAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097163651 12:57069100-57069122 TTAAATATCCAAGCAGGCAACGG + Intronic
1097947480 12:65388173-65388195 CTAAATATACAAATAATCTAGGG - Intronic
1098689407 12:73467394-73467416 AAAAATATACAAGTAGACAGTGG - Intergenic
1099564710 12:84228899-84228921 ATAAATATCCAAATACACAAAGG - Intergenic
1099702864 12:86110348-86110370 CTATATATACACATAGTCAAGGG + Intronic
1101458727 12:104866005-104866027 CTAGATATGGAAGTAGCCAATGG + Intronic
1103605215 12:122080921-122080943 CTACATATACAGGGAGAGAATGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104123861 12:125825211-125825233 CTATACAAACAAGTAAACAATGG + Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104422006 12:128643917-128643939 CTAAATATAATATTAGAAAATGG + Intronic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1109405161 13:61888139-61888161 GAAAATATACAATTAGACAATGG + Intergenic
1109505908 13:63303161-63303183 CTAAATTTATAACTAGACAAAGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109690317 13:65879551-65879573 CTAAATATTGAAGTTGAAAAAGG + Intergenic
1110121658 13:71889150-71889172 CTAAAGATAAGACTAGACAAGGG + Intergenic
1110451381 13:75640863-75640885 GTAAATAAACAAGTACACACTGG - Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112683232 13:101791441-101791463 CAAAATATAGTAGTCGACAAAGG + Intronic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114961699 14:27899603-27899625 ATAAATATACAAATAAACCAAGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115307521 14:31947641-31947663 CTAAACATACAAGTATTGAATGG + Intronic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116646499 14:47535615-47535637 CTAAAAATAGAAGCAGATAATGG + Intronic
1116940036 14:50782540-50782562 ATATTTATACAATTAGACAAAGG + Intronic
1116985846 14:51219088-51219110 CTAAAGCTTCAAGTAGACAGAGG - Intergenic
1117608679 14:57460147-57460169 TTAAATAAACAACTATACAATGG - Intergenic
1117793955 14:59372131-59372153 CCAAATATACAAATAGGCAGTGG - Intergenic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1118601952 14:67476962-67476984 CTAAAAATACAAAAAAACAATGG + Intronic
1119995578 14:79249701-79249723 CAAAATATACAAGAAGCCAGAGG + Intronic
1120280383 14:82431168-82431190 GTAAAAATGCAATTAGACAAAGG - Intergenic
1120361846 14:83514342-83514364 CTAGATTTATAAGTAGACACAGG - Intergenic
1120410843 14:84153376-84153398 CAAAATAAAGAAGTAGATAAAGG - Intergenic
1120783107 14:88503907-88503929 CAATATGTACAAGTATACAAAGG + Intronic
1122562492 14:102626215-102626237 CTAATGAAACAAGAAGACAAAGG - Intronic
1123830526 15:24131638-24131660 CTACAGATTGAAGTAGACAAGGG - Intergenic
1123850773 15:24354240-24354262 CTACAGATTGAAGTAGACAAGGG - Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124474967 15:30025386-30025408 GGAAATATACAAATATACAAGGG - Intergenic
1126309580 15:47300539-47300561 CTAGCTATATAAGTAGAAAAAGG - Intronic
1126352961 15:47764306-47764328 GTAAATAAAAAAGTAGAAAAGGG + Intronic
1126563381 15:50069585-50069607 CTAAAGACAAAAGTAGATAAAGG - Intronic
1127364769 15:58278076-58278098 ATAAATAAATATGTAGACAATGG + Intronic
1127667151 15:61159042-61159064 ATAAATATACAGCTAGACATAGG + Intronic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1131468913 15:92678819-92678841 ATAAATATTCATGTATACAAAGG + Intronic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1132211140 15:100023164-100023186 CTAAAAACAAAAGTTGACAAGGG - Intronic
1132238195 15:100237585-100237607 CTCAATACACAAGTAGGGAAAGG + Intronic
1133373096 16:5260922-5260944 CTAAATGTACAAGACCACAATGG - Intergenic
1134337600 16:13315564-13315586 CTAATTACACAGCTAGACAATGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1136033510 16:27520565-27520587 CTAATTGTACAAGGAAACAAGGG + Intronic
1136899990 16:34024841-34024863 CTAAAAAAAAAAGTAGAGAAAGG + Intergenic
1138809837 16:60136572-60136594 CTAAATAAAGAACTATACAAAGG - Intergenic
1138853036 16:60653405-60653427 GTAATAATATAAGTAGACAAAGG + Intergenic
1139030063 16:62869119-62869141 CTATATATACAATTAAACAGAGG - Intergenic
1139069644 16:63364464-63364486 CTAAATCTACAAGCTGACCAGGG - Intergenic
1139091447 16:63653000-63653022 TTCAACATATAAGTAGACAAAGG - Intergenic
1140403455 16:74691064-74691086 TTAAATATATATGTGGACAAAGG + Intronic
1141059894 16:80856797-80856819 CTAAATATAAAAGTATATGATGG - Intergenic
1141129113 16:81422775-81422797 ATCAATCAACAAGTAGACAAGGG + Intergenic
1142029760 16:87832682-87832704 ATATATATATAAGTAAACAAAGG + Exonic
1144060662 17:11581123-11581145 CTGAATATGCAAGCAGACAATGG + Intergenic
1144308355 17:13989908-13989930 CTAAACATACAAGCAAAAAAAGG + Intergenic
1148357168 17:46983173-46983195 CCAAATATGCAAATAGACAATGG - Intronic
1150180738 17:63118339-63118361 CTAAAAATACAAGTAAACAAAGG - Intronic
1150536221 17:66044956-66044978 CTCAATTTAAAAATAGACAAAGG + Intronic
1150902667 17:69298911-69298933 CTATATATATATGTTGACAAAGG + Intronic
1153059864 18:983766-983788 CAGAATATAAAAGTAGACATGGG - Intergenic
1153453708 18:5258279-5258301 CTCAATAAATAAGTATACAAAGG - Intergenic
1153746326 18:8183766-8183788 AAAAATAAACAGGTAGACAAAGG + Intronic
1153807885 18:8725469-8725491 CTCAATATACAACTATACAAAGG + Intronic
1154924052 18:20854037-20854059 TTACATATAAAAGTAGACAGCGG + Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156258778 18:35425121-35425143 TCAAATAAACAAGTAGAAAAAGG - Intergenic
1156303126 18:35852917-35852939 CAGACTATACAAGCAGACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157917728 18:51684489-51684511 TTAAATTAAAAAGTAGACAAAGG + Intergenic
1158156014 18:54426249-54426271 CTAGATAAACAAATAGTCAAGGG - Intergenic
1158361328 18:56677348-56677370 CAAAATAAACAAGCAAACAATGG - Intronic
1158378049 18:56894882-56894904 AAAAGTATACAAGTAGTCAAAGG + Intronic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159381049 18:67659590-67659612 ACTAATACACAAGTAGACAATGG + Intergenic
1159389833 18:67776452-67776474 CTCAATATACATGTGAACAAAGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1161666500 19:5580194-5580216 CTAAATAAGCAAGAAAACAAAGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1165547998 19:36557894-36557916 ATACATATTCAGGTAGACAAAGG + Intronic
1165967197 19:39592418-39592440 CTCAAAATAAAAGTAGGCAAAGG + Intergenic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
925471482 2:4166148-4166170 ATAAATAAACAACTAAACAATGG - Intergenic
926206453 2:10837289-10837311 CTAAATATTCAAGGAGGCGACGG + Intronic
926804293 2:16690594-16690616 CTTAATATACAAGGAGGCTAGGG + Intergenic
927326282 2:21809499-21809521 CAAAATATAGAAGTTGATAATGG - Intergenic
928308322 2:30189854-30189876 AAATATATACAAGTAGCCAATGG + Intergenic
928710221 2:33996672-33996694 ATAAATATCCAGGTAGAGAAAGG - Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
930673783 2:54178657-54178679 CTAGAATTACAAGTACACAAGGG - Intronic
930931108 2:56885251-56885273 CTAGATATAGAAGTGGACAATGG + Intergenic
930949711 2:57125739-57125761 CAAAAAATACAAGTATACAAAGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932874095 2:75432593-75432615 CTAACAATCCAAGTAGAAAATGG + Intergenic
932907358 2:75768325-75768347 TGAAATATACAACCAGACAATGG + Intergenic
933011817 2:77074754-77074776 CTAAATCAAGAAGTGGACAAAGG + Intronic
933057638 2:77692877-77692899 CCGACTACACAAGTAGACAATGG + Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933448211 2:82409805-82409827 CTAAGTATACAAATATAAAAGGG + Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935392052 2:102563068-102563090 ATAAATAAACAAATAGACTAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938265382 2:129924325-129924347 CTAAAAATACAAAAAGAAAACGG + Intergenic
938868096 2:135445440-135445462 CTAAATAAATAAGTAAATAAAGG + Intronic
938963661 2:136365901-136365923 CAAAACATACAATGAGACAAAGG - Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
940572276 2:155453112-155453134 CAAAGTATTCTAGTAGACAAAGG - Intergenic
941172281 2:162154000-162154022 TCAAATAGACAAATAGACAATGG - Intergenic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
943192823 2:184702525-184702547 ATAAATATAGAAGTAAAGAAGGG - Intronic
943355213 2:186847299-186847321 CTATGTATACATGTAGAAAATGG + Intronic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
943842827 2:192602267-192602289 CTAAATATACAGGTTGAAAGAGG + Intergenic
943847065 2:192664011-192664033 CTAAATATACTAGAGGAAAACGG - Intergenic
943904414 2:193479740-193479762 ATAAATAGAAAAGAAGACAAAGG + Intergenic
943976133 2:194480237-194480259 CAAAATAAACAAGCAAACAAAGG - Intergenic
944000165 2:194824999-194825021 CCAAATAAACAAGTAGAGAGAGG + Intergenic
944558502 2:200911494-200911516 TTAAATATATAAGTATAAAAAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946276794 2:218637688-218637710 CTATAGATACAGGTAGACAAAGG + Intergenic
946382918 2:219361098-219361120 GCAAATAAACAAGTAAACAAAGG - Intergenic
946635348 2:221719016-221719038 CTGCATATACAAGCAGACAATGG + Intergenic
947458436 2:230280532-230280554 CGAAAGATACAAATAGAGAATGG - Intronic
948300028 2:236898655-236898677 CTAAATATACAAGCATATAGAGG + Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1170406498 20:16043432-16043454 ATCAGTATACAAATAGACAATGG - Intronic
1171312854 20:24159673-24159695 CTTATCATACAAGTAGACAGTGG + Intergenic
1172262110 20:33576299-33576321 CTTAATATAAAAGTAGATACTGG + Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175674525 20:60935334-60935356 GTAATTATCCAAGTAGCCAAAGG + Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177027147 21:15933961-15933983 CTAAAAATACAAGAAAAAAAAGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1181783442 22:25208958-25208980 CTAAATAAACAAACAAACAAAGG - Intergenic
1181912143 22:26247153-26247175 CTTAAGATTCAAGTAAACAAAGG + Intronic
1183117302 22:35701901-35701923 CTAAATATACAGGTTGAAAGAGG - Intergenic
1184327537 22:43800963-43800985 ATAAATATCCAGGTACACAAAGG + Intronic
950057400 3:10037166-10037188 CCTAATAGAAAAGTAGACAAAGG + Intronic
950470857 3:13185405-13185427 CAGAATAAACAAGTAGACAAAGG - Intergenic
951063675 3:18239139-18239161 CTCAATATAAAAATAGCCAAAGG + Intronic
952732259 3:36650951-36650973 CCAAATAGACAATTAGAGAATGG + Intergenic
953039687 3:39244583-39244605 CTAAATAGAGAATTAGAAAATGG - Intergenic
953076486 3:39575669-39575691 CTAAAAATAAAAGAAGATAAAGG - Intergenic
953079701 3:39604612-39604634 ATAAATACAAAAGTTGACAAAGG - Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953317021 3:41938265-41938287 CTAAATATACAATTGGTAAATGG + Intronic
953558985 3:43970323-43970345 ATAAATATACATGTATATAAAGG - Intergenic
953937295 3:47056713-47056735 CAATATATACAAGTAGTCCATGG + Intronic
955010165 3:55006251-55006273 CTCAATATATGAGTAAACAAAGG - Intronic
955039842 3:55305272-55305294 CTCAATATACATGAAAACAAAGG + Intergenic
955078131 3:55632988-55633010 ATAAATAGACAGGTGGACAATGG - Intronic
955088179 3:55723232-55723254 TCAAATATATATGTAGACAATGG + Intronic
955333572 3:58067445-58067467 AGTAAAATACAAGTAGACAAGGG - Intronic
955589904 3:60524000-60524022 CTAAAGATAAAAGAGGACAACGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
958225566 3:90813383-90813405 CTACATTTACAACTAGACAGAGG + Intergenic
958485327 3:94698910-94698932 CTATGTAAACAAGTAGAAAATGG + Intergenic
958599859 3:96282400-96282422 CTAAATCTACAAAGAGACTATGG - Intergenic
960079851 3:113529908-113529930 CTAAATATGCAAGTGGGCAATGG - Intergenic
960127937 3:114020990-114021012 CTAAAACTTCAAGTAGAGAAAGG + Intronic
960404895 3:117247750-117247772 CTTAATAAACAAATAGATAATGG - Intergenic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
962450144 3:135506704-135506726 CTCAATAGATAAGTAGGCAAGGG + Intergenic
962497319 3:135954262-135954284 CAGAATATATAAGGAGACAAGGG - Intergenic
962497325 3:135954318-135954340 CAGAATATATAAGGAGACAAGGG - Intergenic
963420749 3:145058002-145058024 CTAAATCAACAAGTAAAGAAAGG + Intergenic
963460663 3:145610745-145610767 CTAAATATAGAAGTAGATGAAGG - Intergenic
963727502 3:148938466-148938488 ATAAATATACAAATATACACTGG + Intergenic
963799936 3:149665535-149665557 CTAAATATTTAAGAAGAGAATGG + Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964629134 3:158790545-158790567 CTAAATACACAAATATAGAAGGG + Intronic
965268757 3:166585035-166585057 CTAAAGTTACAAGTGAACAAAGG - Intergenic
965466222 3:169033558-169033580 CTAAAAAAATAAGTAGAAAAAGG - Intergenic
965877084 3:173337406-173337428 TAAAAAATATAAGTAGACAAGGG + Intergenic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966404518 3:179582285-179582307 CTAAATTTTGAAGTAGAAAATGG - Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
972054825 4:34787413-34787435 ATAAATTTATAAGTAGCCAATGG + Intergenic
972856713 4:43115653-43115675 ATAAATATACAAGTACAAGAAGG + Intergenic
973628919 4:52800345-52800367 CAATATATAAAAGTAGAAAATGG - Intergenic
974314610 4:60262767-60262789 CTAAAAATAGATGTACACAAAGG + Intergenic
974326432 4:60420215-60420237 CTAGATAAACATGTTGACAAAGG - Intergenic
974592003 4:63963698-63963720 ATAAATATACAAATATAGAAAGG + Intergenic
975181574 4:71351697-71351719 CTAAAAATACAAGTGGAGAAGGG + Intronic
975356884 4:73417184-73417206 TGAAAGATACAAGTAGAAAATGG - Intronic
975749151 4:77505152-77505174 CCAGATATACAGATAGACAAAGG - Intergenic
977531112 4:98201277-98201299 CTATATATATATATAGACAATGG + Intergenic
977566358 4:98584561-98584583 CTACATATATAAGTAGAAGATGG - Intronic
978092879 4:104739330-104739352 CTAAATATTAAAGTAGAGACTGG - Intergenic
979047844 4:115892789-115892811 CTCAATATACAGGGAGCCAATGG - Intergenic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979735801 4:124082032-124082054 CTAAATATCACAATAGACAAAGG + Intergenic
980087939 4:128410554-128410576 CAAAATATAAAAGTAGAAGATGG - Intergenic
980432353 4:132719531-132719553 CTAAATATAAAAGAATAAAAAGG - Intergenic
980680514 4:136154082-136154104 GTAAATTGACAAGTAGAGAAGGG + Intergenic
980771217 4:137375891-137375913 CTAAGCATACAAGTAAACAAAGG + Intergenic
981441047 4:144782441-144782463 ATATATATACAAGCCGACAAGGG + Intergenic
982642288 4:157978150-157978172 CTAAATATACATTTAGAAACTGG + Intergenic
983725709 4:170922506-170922528 CTATATATACATGTACACACAGG - Intergenic
983966397 4:173817783-173817805 ATAAATATAAAAGGAGAAAAGGG - Intergenic
984738690 4:183137909-183137931 CTAAACATACAAGGAAACAAAGG - Intronic
985025913 4:185738953-185738975 CTAACTATGCAAATAGAGAATGG - Intronic
986175046 5:5345009-5345031 CTGAATATTCAAGTAGAAACTGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986904385 5:12476220-12476242 TTGAATATAGAAGTAGACAATGG - Intergenic
987249903 5:16088755-16088777 CAAAATATACAAATAGATCATGG + Intronic
988145309 5:27298421-27298443 CTAAATAAATAAGTAAATAAAGG + Intergenic
988559936 5:32271977-32271999 CTTAATATCCAAGTAGAGAATGG - Intronic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
990073986 5:51819867-51819889 ATAAATATAAAAAAAGACAATGG - Intergenic
990128320 5:52547522-52547544 CTAAATATACCATTAAATAATGG - Intergenic
990335696 5:54770114-54770136 ATAAATACACAAATAGACATGGG + Intergenic
992963003 5:81973925-81973947 CTAAATAAAACAGGAGACAAGGG - Intronic
993458169 5:88149018-88149040 CTAAATAGTCAAATAGACATTGG - Intergenic
993824190 5:92660968-92660990 CTAAATTTACAAGGAGTGAAGGG - Intergenic
995592930 5:113718394-113718416 CTATATATATAAGAAGAAAAGGG + Intergenic
996031791 5:118713376-118713398 ATAAATATCCAAGTACATAAAGG + Intergenic
996066994 5:119090368-119090390 ATAAATATCCAGGTAGACAAAGG - Intronic
996258355 5:121434356-121434378 CTTTTTATACAAGTAGAGAAAGG + Intergenic
996632478 5:125651031-125651053 CTAAAAACAAAAATAGACAATGG + Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997810061 5:136958281-136958303 CTAGATATACAAACAGAGAATGG - Intergenic
998596893 5:143540458-143540480 CAAAAAATATAAGTAGAGAATGG + Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1003339702 6:5207864-5207886 CTAAATGAACAATTAGAAAAAGG + Intronic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004848155 6:19668682-19668704 CTAACCTTACAAGTAGATAAAGG + Intergenic
1005020390 6:21412458-21412480 TCAGAGATACAAGTAGACAAAGG - Intergenic
1005315825 6:24601942-24601964 CTGGATATAAAAGCAGACAATGG - Intronic
1006656739 6:35601349-35601371 CTACATCTACAAGTAGCAAAGGG + Intronic
1006821147 6:36896445-36896467 CCAAATAAAAAAATAGACAAAGG - Intronic
1008172742 6:48229749-48229771 CTATAAAGACAAGTAGAGAAAGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1010089256 6:71960759-71960781 CTAAATATTCAAGTAGACATGGG + Intronic
1011147203 6:84231310-84231332 CAAAATACACAATTAGAAAATGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012231554 6:96766104-96766126 TTAAATATACAAGTAGGCTGGGG - Intergenic
1012415996 6:99014441-99014463 CTAAATATTCAAGTACAAGAAGG + Intergenic
1012727403 6:102831904-102831926 GTAAATATAGAGGTTGACAAGGG + Intergenic
1012737740 6:102972702-102972724 AGAAATTAACAAGTAGACAAGGG + Intergenic
1012773741 6:103478033-103478055 CTAAATGCACAAGTAAACAATGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013871854 6:114773130-114773152 CTAAACATACAAGAATATAATGG + Intergenic
1014477111 6:121887357-121887379 CTTAAAAAACAAGTAAACAATGG + Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015030485 6:128588263-128588285 ATAAATATCCAAGTACACAAAGG + Intergenic
1016127961 6:140429178-140429200 ATAAATAGACACGTAGATAATGG - Intergenic
1016144998 6:140659735-140659757 ATAAATATACAAATACACTAAGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016651929 6:146471818-146471840 GGAAATATTCAAATAGACAAAGG + Intergenic
1016710542 6:147166348-147166370 CTCAGTATACAAATACACAATGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017052876 6:150409533-150409555 CTACATCTACAAGTAGACAGGGG + Intergenic
1017679729 6:156851362-156851384 CTAAATATACAATTAAACATTGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1020604066 7:10313193-10313215 CTAAATATGAAAGTAGAGTATGG - Intergenic
1020829285 7:13073437-13073459 ACAAATATACAACTAGAAAATGG - Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1022534470 7:31087231-31087253 CTGAGTACAGAAGTAGACAAGGG - Intronic
1022726184 7:32983874-32983896 CTAAATAGAAAAATAGGCAAAGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024133490 7:46382336-46382358 CATAATAGACAAATAGACAATGG + Intergenic
1024170448 7:46779609-46779631 CTCAATATTCAAGTAGAAGAAGG + Intergenic
1025047412 7:55703796-55703818 CTAAATAGAAAAATAGGCAAAGG + Intergenic
1027976964 7:85171002-85171024 CTCAATATATAAGTATACTAAGG + Intronic
1028050782 7:86182884-86182906 CTAAATCTACAAATTGAAAAGGG + Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028365831 7:90030515-90030537 TTAAATATAAAAATAGGCAAAGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029209575 7:98895615-98895637 CTCAAGATACAAATAGGCAATGG - Intronic
1031103282 7:117508159-117508181 CTAGGTAAACAATTAGACAAAGG - Intronic
1031109136 7:117584519-117584541 ACAAATAGGCAAGTAGACAATGG - Intronic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031209076 7:118798773-118798795 CTAAATATGCAAACAAACAATGG - Intergenic
1031846885 7:126815973-126815995 CTAAACATACAAATACACAAAGG + Intronic
1032009450 7:128333734-128333756 ATAAAAATAAAAATAGACAAAGG + Intronic
1032228279 7:130051565-130051587 CTAAATATGCTAGTTGATAAAGG - Intergenic
1032895768 7:136249088-136249110 CTAAATAAAAAAGTACAAAAGGG - Intergenic
1033197993 7:139343624-139343646 CTAGATATTCAAATAGAGAAAGG + Intronic
1033734748 7:144210641-144210663 CTCAACAGAAAAGTAGACAAAGG - Intergenic
1033748307 7:144340328-144340350 CTCAACAGAAAAGTAGACAAAGG + Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035793366 8:2328965-2328987 ATAATTAACCAAGTAGACAATGG + Intergenic
1035799438 8:2392740-2392762 ATAATTAACCAAGTAGACAATGG - Intergenic
1037526179 8:19726715-19726737 AAAAATATACTAGAAGACAATGG + Intronic
1038252519 8:25918798-25918820 CGTTATATACAAGGAGACAAAGG - Intronic
1038260525 8:25989508-25989530 ATAAATATCCATGTAAACAAGGG + Intronic
1038550415 8:28462963-28462985 CTAAATATACATGTAAGAAATGG - Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040129076 8:43773255-43773277 CCAAATATACAGATAGACACGGG + Intergenic
1040849615 8:51885648-51885670 CTAAAAATACAAATTCACAAAGG + Intronic
1041401969 8:57455768-57455790 ATAAACATAAAAGTAAACAAGGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044459088 8:92424158-92424180 CTAAATATACCAAGAGAGAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045075330 8:98559925-98559947 CTAAAGAAACAAGCAGAGAAGGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045546169 8:103130737-103130759 CTAGATATACAAGCAGAAACTGG + Intergenic
1045715785 8:105043353-105043375 TTAAATGTACAATTATACAATGG + Intronic
1045727441 8:105190981-105191003 CTAATAATACAATTAAACAATGG - Intronic
1046090100 8:109492283-109492305 CTAAAAATGAAAATAGACAATGG + Intronic
1047056331 8:121168651-121168673 CTAAAGATACAAGTAAAGATGGG - Intergenic
1047120723 8:121901623-121901645 ATATATAGAGAAGTAGACAATGG - Intergenic
1047261708 8:123268013-123268035 ATAAATAAATAAGTATACAAAGG + Intronic
1048258776 8:132926951-132926973 CTAACTCTGCAAGTAAACAAAGG - Intronic
1048644991 8:136410109-136410131 CTAAATATAGAAGCAAAAAAGGG - Intergenic
1050224419 9:3435364-3435386 CTAAATATACAAAAAGATTACGG - Intronic
1050335348 9:4584831-4584853 GTAAATAAACAAGTACACCATGG + Intronic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051033328 9:12710762-12710784 CCAAATATAGAAGCAGAGAAGGG + Intergenic
1051558789 9:18415866-18415888 CAATATATACAAGAAGAGAATGG + Intergenic
1051794008 9:20843617-20843639 ATCAATATTCAAGTACACAAAGG - Intronic
1051797951 9:20896334-20896356 CTAAAATTAAAACTAGACAAAGG - Intronic
1052254335 9:26436556-26436578 CTCAACATACAAGTAAACTACGG + Intergenic
1052350438 9:27453335-27453357 CTCAAAATACAAGTATGCAATGG + Intronic
1052516232 9:29483952-29483974 CTAAATCAACAAGCAGACATGGG - Intergenic
1053737830 9:41112755-41112777 CTAAATATACAGCTTGAAAAAGG + Intergenic
1054690519 9:68318565-68318587 CTAAATATACAGCTTGAAAAAGG - Intergenic
1054961879 9:70978300-70978322 ATAAATATATAAGCAGTCAATGG - Intronic
1055744519 9:79427951-79427973 CTAAATAGAAGAGTAGACCAAGG - Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1056337263 9:85584856-85584878 CTAAATAGACACATAGGCAATGG + Intronic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1058481584 9:105401231-105401253 TTAAATATACAAATAAGCAAAGG - Intronic
1058521703 9:105818921-105818943 CTAAATATACAGGTTGAAAGAGG + Intergenic
1059150695 9:111947203-111947225 CAAAGAATACAAGAAGACAATGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1060848181 9:126853744-126853766 GTGAATATAGAAGTAGACACGGG - Intergenic
1186366541 X:8900544-8900566 CTAAAAAGACAAATAGAGAAAGG + Intergenic
1186954118 X:14661569-14661591 CTTAATTTAAAAGTAGAAAATGG + Intronic
1188615140 X:32149063-32149085 CAAAATATGAAAGTAGAAAAAGG + Intronic
1188904367 X:35774424-35774446 ATAAATAAACAAATAGGCAAAGG - Intergenic
1189565367 X:42235993-42236015 TTAAATATAAAAGGAGACTAAGG - Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1194980301 X:100433499-100433521 CTAAATATAATGGTAGAAAAAGG - Intergenic
1196633471 X:117971785-117971807 CTAAATACACAATTAAACTAAGG + Intronic
1197204109 X:123774854-123774876 CTAAAAATACAAATAGCCAGGGG + Intergenic
1197676574 X:129336966-129336988 ATCAATATACAAGTACAAAAAGG + Intergenic
1198874447 X:141207919-141207941 CTAAAAAAACAAGTACATAATGG + Intergenic
1201051060 Y:9935855-9935877 CTAAAAATACAAGAAAAAAATGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201372030 Y:13276268-13276290 ATAAATAAATAAGTAGAGAAAGG + Intronic
1201678664 Y:16617750-16617772 ATAAATAAACAAATAAACAATGG + Intergenic
1202101996 Y:21319443-21319465 CTAAATACAAAAGTAGGCATAGG + Intergenic