ID: 1106110175

View in Genome Browser
Species Human (GRCh38)
Location 13:26770353-26770375
Sequence CTTCACTTGCACAGGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106110175_1106110183 23 Left 1106110175 13:26770353-26770375 CCTGTCTCCCTGTGCAAGTGAAG 0: 1
1: 0
2: 2
3: 17
4: 181
Right 1106110183 13:26770399-26770421 TGCTGTACTGGCCAAGTACTTGG 0: 1
1: 0
2: 0
3: 4
4: 88
1106110175_1106110180 11 Left 1106110175 13:26770353-26770375 CCTGTCTCCCTGTGCAAGTGAAG 0: 1
1: 0
2: 2
3: 17
4: 181
Right 1106110180 13:26770387-26770409 TCCCTTTCTTTCTGCTGTACTGG 0: 1
1: 0
2: 1
3: 20
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106110175 Original CRISPR CTTCACTTGCACAGGGAGAC AGG (reversed) Intergenic
900953594 1:5873478-5873500 CTTCTCTGGCACAGTGAGGCCGG - Intronic
901382947 1:8887208-8887230 CTGCACTTGCACACTGGGACTGG - Intergenic
901645984 1:10716985-10717007 CTTCACCAGCACAGGCAGGCGGG + Intronic
903860713 1:26362914-26362936 CTCCACTTGCTCAGGAGGACTGG + Intronic
906150623 1:43585441-43585463 CTTCACTCTCACAAGGACACTGG - Intronic
907326351 1:53640982-53641004 CTTCAAAAGCACAGGGAGACAGG + Intronic
908897261 1:68914251-68914273 CCTCACTTGCAAAATGAGACTGG - Intergenic
909531430 1:76686046-76686068 GTTAACTTGCACAGGGTGCCTGG - Intergenic
911256390 1:95638181-95638203 CTACACTTGAAGAGGGAGACAGG + Intergenic
911588252 1:99715910-99715932 CTTCACTTGCACAGAGCAGCAGG + Intronic
913437888 1:118865978-118866000 CTTCACTTCCTCAAAGAGACAGG - Intergenic
915690002 1:157679395-157679417 CTTCACTTGCACAGGGAAATTGG + Intronic
916052622 1:161047118-161047140 CCTCTCTTGCACATGGTGACTGG + Exonic
917596640 1:176535873-176535895 CTTCACTTTCACATAGTGACAGG - Intronic
921098705 1:211909982-211910004 CTTCAGTTGCACAAAGAAACAGG + Intergenic
922160696 1:223077603-223077625 CTCCACGTCCACAGGGAGAGAGG + Intergenic
923229546 1:231972083-231972105 GTTCATTTGCAAAGTGAGACCGG - Intronic
1062909168 10:1201251-1201273 CTGCATTTGCAGAGGGAGAGAGG - Intronic
1065886340 10:30080775-30080797 CTTCAGTTGAACAGGGGCACAGG - Intronic
1066658901 10:37720805-37720827 CTTTCCTTCCACAGGGAGAAAGG - Intergenic
1067043312 10:42970040-42970062 CTTCCCTTCCACAGGGAGAAAGG - Intergenic
1067744347 10:48924128-48924150 CTTCACCTCCCCAGGGAGTCTGG + Intronic
1067761240 10:49048687-49048709 CTTCCCTTACACAGGTACACAGG - Intronic
1072848294 10:98857265-98857287 CCTTACTTGCACAGATAGACAGG + Intronic
1073283839 10:102375257-102375279 CTTCACTGGCCTAAGGAGACTGG + Intronic
1075236732 10:120737268-120737290 CTGCTCTGGCACAGGGAGAATGG - Intergenic
1075605020 10:123798570-123798592 TTTCACTTGTACAAGGACACAGG + Intronic
1075942468 10:126403327-126403349 CTTCATATTCACAGGGATACTGG + Intergenic
1076646334 10:131957505-131957527 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646353 10:131957579-131957601 CTTCATCTCCACAGGGAGATGGG - Intronic
1076646380 10:131957689-131957711 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646390 10:131957726-131957748 CTTCATCTCCACAGGGAGATGGG - Intronic
1076646439 10:131957906-131957928 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646448 10:131957943-131957965 CTTCATCTTCACAGGGAGATGGG - Intronic
1076646468 10:131958017-131958039 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646489 10:131958091-131958113 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646498 10:131958127-131958149 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646533 10:131958277-131958299 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646555 10:131958351-131958373 CTTCATCTCCACAGGAAGACGGG - Intronic
1076646593 10:131958499-131958521 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646759 10:131959165-131959187 CTTCATCTCCACAGGGGGACCGG - Intronic
1076646776 10:131959239-131959261 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646829 10:131959461-131959483 CTTCATCTCCACAGGGGGACCGG - Intronic
1076646839 10:131959498-131959520 CTTCACCTCCACAGGGGGATGGG - Intronic
1076891104 10:133283820-133283842 CTTTCCTTTCACAGGGAGACAGG - Intronic
1077056308 11:595513-595535 CTCCACCTGCACAGGGAGCTTGG - Intronic
1078186969 11:9060380-9060402 CTTCACCTCCCCAGGGAGACTGG - Intronic
1078544995 11:12240841-12240863 GTTCACATGGACAGGGAGCCAGG + Intronic
1078621549 11:12913207-12913229 CTTTACCTGCACATGGAGAGGGG - Intronic
1082959523 11:58905588-58905610 CTTGGCTTCCACTGGGAGACAGG + Intronic
1091273387 11:134333067-134333089 CTGCACTTCCCCTGGGAGACAGG + Intronic
1095714641 12:45329514-45329536 CTTCCCTTGCACAGTGGCACAGG - Intronic
1097161608 12:57050098-57050120 TTTGACTGGCACAGGGAGCCTGG - Exonic
1100744349 12:97629108-97629130 CCTCATTTGCAAAAGGAGACTGG - Intergenic
1104678050 12:130729231-130729253 TCTCACCTGCAGAGGGAGACCGG - Intergenic
1104751197 12:131240373-131240395 CTTAACTTGGACAGGGAGTGGGG - Intergenic
1106110175 13:26770353-26770375 CTTCACTTGCACAGGGAGACAGG - Intergenic
1107016198 13:35709521-35709543 CTGCACTAGCACTGGGAGTCGGG + Intergenic
1107967901 13:45614033-45614055 CTTCTCTTGCACCAGCAGACAGG - Intronic
1112581056 13:100676272-100676294 CTTCACTATCACAGGGAGACAGG - Intergenic
1112701873 13:102019371-102019393 CTTCACTAGTAGAGGGAGGCAGG - Intronic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1118625917 14:67658732-67658754 GATCACTTGTAAAGGGAGACTGG - Intronic
1119749423 14:77066966-77066988 CTTGCCATGCACAGGCAGACTGG - Intergenic
1122019773 14:98828112-98828134 CTTCAGTTGCAAAGGGAAAGAGG + Intergenic
1122484538 14:102069891-102069913 TTCCACTTGCACCGGGAGAAAGG - Intergenic
1127662437 15:61112804-61112826 CTTCAAGAGCACAGGCAGACGGG + Intronic
1128184005 15:65628724-65628746 ATTGACTTGCCCAGGGAAACAGG - Intronic
1128945109 15:71814499-71814521 CATCATTTGCAAAGGGAGAGAGG + Intronic
1133180186 16:4048543-4048565 CTGCACTTGTAGAGGGACACGGG + Intronic
1133272821 16:4618994-4619016 CTTGCCTTGCATAGGGAGGCAGG + Intronic
1134219452 16:12342223-12342245 CTTCCCTTGCAGAGGGCAACAGG - Intronic
1135953070 16:26933386-26933408 CTTCACTAGCAGATGGAGAACGG - Intergenic
1142504651 17:355173-355195 TTTCTCTTGCCCAGGAAGACTGG - Intronic
1144407559 17:14966732-14966754 TTTCCCCTGCACAGGCAGACAGG - Intergenic
1146224234 17:31051946-31051968 CTTCTCCTGCACTGGGAGTCAGG - Intergenic
1146236284 17:31166799-31166821 CTTAACATCCACATGGAGACTGG - Intronic
1148031817 17:44627323-44627345 CTTCACTTGCTGAGGGAGGAAGG + Intergenic
1151525642 17:74664790-74664812 CCTCCCTAGCACATGGAGACGGG + Intergenic
1151916149 17:77119499-77119521 CTGCTCTTTCACAGGGATACCGG - Intronic
1152496240 17:80674401-80674423 CAGCACTTTCACAGGGAGGCTGG + Intronic
1152650491 17:81490307-81490329 CTGCACTGGGACAGAGAGACAGG - Intergenic
1152760718 17:82105793-82105815 CCTCACTGGCACATGGAGCCTGG + Intronic
1154291946 18:13116036-13116058 CTTCACTATCACAGGGACACAGG - Intronic
1160066794 18:75583147-75583169 CTCCACTTGCTTAGGGAGGCTGG + Intergenic
1160200890 18:76794312-76794334 CTTCACCTGCCCTGGGGGACAGG - Intergenic
1160413841 18:78693648-78693670 CTTCACTGACACTGGGCGACCGG + Intergenic
1160856015 19:1218319-1218341 CGCCACTTCCACAGGGAGATGGG + Intronic
1165225104 19:34349248-34349270 CTCCTCTCACACAGGGAGACTGG - Intronic
1166998577 19:46731666-46731688 CTGCACTTGCAGCGGGACACAGG + Intronic
1168554161 19:57324003-57324025 CTTAACTTGCCCAGGAACACAGG - Intronic
927894895 2:26775328-26775350 CTTCACACGCACAGGCACACAGG + Intronic
928826904 2:35433538-35433560 CTTCACTTGCAGGGGCAGAGAGG + Intergenic
930173886 2:48281498-48281520 CCTCATGTGCTCAGGGAGACAGG - Intergenic
931706099 2:64947734-64947756 CTTCATTTGCTCAAGGAGTCGGG - Intergenic
932268586 2:70389258-70389280 CTTCTCTAGCAAATGGAGACTGG + Intergenic
932338024 2:70942141-70942163 CTTCCCCTGCACCGGGAAACAGG - Exonic
933093059 2:78145783-78145805 CTGCACTTGCACATGGAGTGTGG + Intergenic
933636847 2:84717651-84717673 ATTAACTTGCAAATGGAGACTGG + Intronic
933966427 2:87433231-87433253 CTTCACTGTCACAGGCAGACAGG - Intergenic
935116474 2:100141390-100141412 CTTCACTTCAACAGTGAGATGGG + Intronic
936327368 2:111517254-111517276 CTTCACTGTCACAGGCAGACAGG + Intergenic
937486674 2:122322656-122322678 ATTCAGTGGCCCAGGGAGACAGG + Intergenic
938232577 2:129674378-129674400 CTTCACCTGGACACAGAGACAGG + Intergenic
940612457 2:156007406-156007428 CTGCACTTGCACATGGAGGGTGG - Intergenic
942339122 2:174924473-174924495 TTTCACATGCACATGGAGAGGGG - Intronic
942411210 2:175710711-175710733 CTTCCCCTACACAGCGAGACAGG + Intergenic
942504584 2:176628235-176628257 CATCACTTCCACAGGAAGACCGG - Intergenic
942971536 2:181962825-181962847 CTTCACATCCACATGAAGACAGG + Intronic
944227339 2:197360780-197360802 CTTCTCATGCACAAGGAGCCAGG + Intergenic
945468756 2:210202490-210202512 CTTCATTTGCACAGGAAGAAAGG - Intronic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
948786893 2:240357356-240357378 CTCCGTTTGCACAGGGAGATGGG + Intergenic
949031451 2:241799252-241799274 CTCCTCTTCCAGAGGGAGACAGG - Intronic
1170527253 20:17251511-17251533 CATCCCTGGCACAGGGGGACAGG - Intronic
1173646441 20:44636107-44636129 CTTGATTCCCACAGGGAGACAGG + Intronic
1175404903 20:58719571-58719593 CTTCCCTTGCACAGGGCCAAGGG + Intergenic
1176678745 21:9805821-9805843 CTTCACCTTGGCAGGGAGACAGG + Intergenic
1177857545 21:26416498-26416520 CTTAACTAGAACAGGGACACAGG + Intergenic
1178727272 21:35065062-35065084 CTTCTCTTGCAGAGCGAGCCCGG - Intronic
1180858729 22:19064568-19064590 CTGCACTTGTACAAGGAGAGGGG + Intronic
1182627457 22:31658255-31658277 TTTGAGTTGCACAGGCAGACTGG - Intronic
1184737475 22:46407920-46407942 CTTCAGATGCACAGGCAGAGGGG + Intronic
1185067638 22:48640080-48640102 CTGCACTGGCACAGCGAGGCAGG - Intronic
954275688 3:49540207-49540229 CTTCCCTTGCCTAGGGAGAAGGG - Intergenic
954484133 3:50830736-50830758 CTTCACTTGCATTGGGTGACTGG + Intronic
954848743 3:53582506-53582528 CTTGACTTGGAAAGGGGGACTGG + Intronic
965916790 3:173858163-173858185 CTTCACATGCACAGTGAGTCTGG + Intronic
966977127 3:185094512-185094534 CTTCCCTTGCCAAGGGAGACGGG + Intronic
967915266 3:194573729-194573751 CCTCACCAGCACAGGGAGCCAGG - Intergenic
968438847 4:611297-611319 CTTCACCTGCACACAGAGGCTGG + Intergenic
968438857 4:611365-611387 CTTCACCTGCACACAGAGGCTGG + Intergenic
968438869 4:611433-611455 CTTCACCTGCACACAGAGGCTGG + Intergenic
968438881 4:611501-611523 CTTCACCTGCACACAGAGGCTGG + Intergenic
968589877 4:1452031-1452053 CATCACTTGGAAAGGGAGCCTGG + Intergenic
969290134 4:6233542-6233564 CTTCTCTTCCAGTGGGAGACAGG - Intergenic
969495094 4:7521962-7521984 CTTCAGTGGCACAGTGACACAGG + Intronic
969936597 4:10688157-10688179 CTTCAGTGGCACTGTGAGACAGG - Intergenic
970075298 4:12211761-12211783 CTTCACTTTCACTTGGTGACAGG + Intergenic
972307803 4:37849330-37849352 CTGCATTTGCACAGAGAGCCAGG - Intronic
977161013 4:93635355-93635377 GTTCACTCTCAAAGGGAGACAGG + Intronic
978712570 4:111802696-111802718 CTTCACATTCACAGGGCGGCAGG + Intergenic
980105920 4:128588285-128588307 CTTCTCTAGCACATGGAGAGAGG + Intergenic
984861043 4:184238718-184238740 ATTCGCTTGCACAAGGAGACAGG + Intergenic
985760560 5:1746599-1746621 CTTCCCGTCCACAGGGAAACGGG - Intergenic
992875338 5:81048922-81048944 CTTCTCTTGCACATGCAGCCCGG + Intronic
995420452 5:111961087-111961109 CTTCACTTGCAAAGTGGGAAGGG - Intronic
999080248 5:148836828-148836850 ATACACTTCCACAGGGAGAGAGG - Intergenic
999174494 5:149622229-149622251 CTTCACTAACAGAGGGAGACTGG - Intronic
999622797 5:153489959-153489981 TTTCACTTGTAAAGGTAGACAGG + Intronic
1000882391 5:166713336-166713358 ATTCACATGCACAGGGGCACCGG + Intergenic
1002517320 5:179768863-179768885 CTGGGCTTGCACAGGGACACTGG - Exonic
1002884925 6:1285122-1285144 CTGCACTTGCACTGGGGGAAGGG - Intergenic
1006256326 6:32835471-32835493 CTTCACTTGCAGAGGGACAGTGG + Intronic
1006911057 6:37563943-37563965 CCTCCCTGGCACAGGGAGCCTGG - Intergenic
1007729149 6:43935283-43935305 CTTTATTTGCCCAGGGAGTCAGG + Intergenic
1008470749 6:51881604-51881626 CTTCAATTGCACATGGAAAATGG - Intronic
1009055406 6:58328755-58328777 CTTCATTATCACAGGGAGAATGG - Intergenic
1009235759 6:61121827-61121849 CTTCATTATCACAGGGAGAATGG + Intergenic
1012177915 6:96112098-96112120 CTTCACTTGCACATGGCTTCCGG - Intronic
1012277910 6:97296064-97296086 CTTCAGTTGGCCAGTGAGACTGG - Intergenic
1014038224 6:116792777-116792799 CTTCACTTGCACGGGCATCCAGG - Exonic
1023170996 7:37390322-37390344 CTTCCCTTGCACAGTGAGTGCGG - Intronic
1023303383 7:38797960-38797982 CACAACTTCCACAGGGAGACTGG + Intronic
1024594291 7:50918860-50918882 CTCCACTGGCTCAGGGAGTCTGG - Intergenic
1026634502 7:72069600-72069622 CCTCCCTTGCAGAGGGATACAGG + Intronic
1027023845 7:74836375-74836397 CTTCTCTTGCACAGGGATCATGG - Exonic
1027064084 7:75108946-75108968 CTTCTCTTGCACAGGGATCATGG + Exonic
1027947853 7:84773343-84773365 CTTCCCTTGCACATGAAGTCAGG + Intergenic
1030389373 7:108907067-108907089 TTTCACTTACACAGAGAGCCTGG - Intergenic
1032903142 7:136333947-136333969 CTTCGCTTGCACAGTGAGCAGGG + Intergenic
1034231210 7:149529982-149530004 CTTCAGTTGAATTGGGAGACAGG - Intergenic
1035304682 7:157924156-157924178 CTTCACTTGGACAGGATGAGGGG + Intronic
1035357620 7:158286068-158286090 CTCCATTTGCCCAGGGAGCCTGG - Intronic
1035868184 8:3108100-3108122 CTGCACATGGACAGGGAGCCAGG - Intronic
1035891515 8:3348885-3348907 GTTCACTTTCACTGTGAGACAGG - Intronic
1036638907 8:10569856-10569878 ATCCAGTTGCACATGGAGACAGG + Intergenic
1037720773 8:21441943-21441965 CTTCATTCGCACAGTGAGGCAGG - Intergenic
1039188629 8:34946496-34946518 CATCTCAGGCACAGGGAGACAGG - Intergenic
1039800474 8:40950249-40950271 CTTCCCTGGCCCAGGGAGATGGG - Intergenic
1041146618 8:54882814-54882836 CTACACTTGGAAGGGGAGACAGG + Intergenic
1043204871 8:77425643-77425665 CTACACTTTAGCAGGGAGACTGG + Intergenic
1044910666 8:97055045-97055067 CTTCCATTGGACAGGGGGACAGG - Intronic
1048652076 8:136489243-136489265 CTGCACTTGCACAGATAAACAGG + Intergenic
1050325461 9:4492849-4492871 CTCCACTTCCACAGGGAATCAGG - Intronic
1057527672 9:95816975-95816997 ATTCACTTGAACATGGAGAACGG + Intergenic
1058674617 9:107389733-107389755 CCTCACTGGCAGAGGGAGAGTGG - Intergenic
1059435180 9:114271720-114271742 GCTGACTTGCACAGGGTGACCGG - Intronic
1059684013 9:116617026-116617048 CATCACTTTCACAGAGGGACAGG - Intronic
1060969302 9:127729191-127729213 CTTCACTTGTATTGGGAGAATGG + Intronic
1061043913 9:128154182-128154204 CTGAACTTGCACGGGGAGAAGGG - Intergenic
1062689942 9:137836490-137836512 CTGCACTTGAACAGCGAGGCCGG + Intronic
1203663916 Un_KI270754v1:8357-8379 CTTCACCTTGGCAGGGAGACAGG + Intergenic
1186161731 X:6783895-6783917 TTTCTCTTGCCCAGGGACACTGG - Intergenic
1189593131 X:42536676-42536698 CTTTAATGGCACAGGGAGAGGGG + Intergenic
1189846298 X:45141792-45141814 CTTCACCTGCACTGGCAGCCGGG - Intergenic
1191724275 X:64262634-64262656 CTTCACTTGCATTTGCAGACAGG - Intergenic
1193185031 X:78501844-78501866 CTGGACTTGCCCAGGGAGAGAGG + Intergenic
1196794419 X:119490768-119490790 CTGCACCTGCAGAGGGAGATTGG - Intergenic
1198175723 X:134152511-134152533 CTTTACTTGCACAGGAAACCAGG + Intergenic
1202576299 Y:26329470-26329492 CCACACATGCACATGGAGACAGG + Intergenic