ID: 1106111479

View in Genome Browser
Species Human (GRCh38)
Location 13:26781458-26781480
Sequence ATGTCTGTGGAGTGCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106111479 Original CRISPR ATGTCTGTGGAGTGCTCTCC TGG (reversed) Intergenic
900290579 1:1921982-1922004 CAGGCTGTGGAGGGCTCTCCTGG + Exonic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
901917980 1:12514816-12514838 ATTTCTGTGCAGTCCTTTCCCGG + Intergenic
902217040 1:14940801-14940823 ATGACTGCGGAGTGCTATCAGGG + Intronic
903737158 1:25537340-25537362 ATGTCTATGCAGTGACCTCCAGG + Intergenic
906145874 1:43560404-43560426 ATGTGTGTGGAGTGCACAGCAGG + Intronic
909885322 1:80934969-80934991 ATGTCTGTGAAGCGCTTTGCTGG - Intergenic
910079448 1:83323890-83323912 TTGTCTATGGAGTGCTTACCAGG - Intergenic
913057976 1:115179591-115179613 AGGGCTGTGGAGTGCGCTCGTGG - Intergenic
916383341 1:164238108-164238130 ATGTGTGTGGGGTGTTTTCCTGG - Intergenic
916722758 1:167496977-167496999 ATTTCTTTGGAATGCACTCCTGG - Intronic
921410796 1:214834717-214834739 CTGCCAGTGGGGTGCTCTCCTGG + Intergenic
1064151253 10:12867031-12867053 ATTTTTGTGGAGTGACCTCCAGG + Intergenic
1067180496 10:43982276-43982298 ATGGGTGTGGAGTGGTCTCTTGG + Intergenic
1069153321 10:64993385-64993407 ATGTCTGTTGTGTGCTATCCTGG - Intergenic
1070533798 10:77360538-77360560 ATGTGGAGGGAGTGCTCTCCTGG - Intronic
1072632527 10:97156188-97156210 GTCACTGTGGAGTGGTCTCCAGG + Intronic
1074208850 10:111309432-111309454 ATTTCTGTCACGTGCTCTCCAGG + Intergenic
1074685152 10:115955129-115955151 ATGTCTCTGAAGTGGCCTCCAGG + Intergenic
1074966955 10:118499476-118499498 ATGTCTGTGTAGTGCTTACTTGG + Intergenic
1083378534 11:62245410-62245432 ATGACTGTGGAGTGCGCACTGGG - Intergenic
1084517720 11:69645524-69645546 GTGACTGTGGAGTCCACTCCAGG + Intronic
1085910415 11:80818311-80818333 TTGTCTGTGTAGTCCTCTCCTGG - Intergenic
1087674081 11:101138906-101138928 ATGTCTATGGAGTGGGCTTCTGG - Intergenic
1088776358 11:113087762-113087784 ATGTCTGTGCATTGCTCTTTTGG + Intronic
1090859194 11:130638153-130638175 ATTTATGAGGAGTGCTTTCCCGG + Intergenic
1102063397 12:109952432-109952454 ATGTCTGGGGAGGACTCTTCTGG - Intronic
1102904372 12:116662792-116662814 AGGGCTGTGGAGGGCTCTGCTGG + Intergenic
1103889831 12:124230090-124230112 ATGTCTGTGGGCTGGTCTGCTGG + Intronic
1104686427 12:130787932-130787954 TTCACTGTGGAGCGCTCTCCCGG - Intergenic
1104714052 12:131005061-131005083 ATGTCTGATGAGGGCTGTCCTGG - Intronic
1105637156 13:22226608-22226630 GTGTCTGTGCAGTTGTCTCCTGG - Intergenic
1106111479 13:26781458-26781480 ATGTCTGTGGAGTGCTCTCCTGG - Intergenic
1106709034 13:32311603-32311625 AAGGCTGTGCAGTGCTCTCTGGG - Exonic
1106828278 13:33548456-33548478 ATTTCTGTGGAGTGGACTCGTGG + Intergenic
1107024639 13:35787318-35787340 ATGTTTCTGAAGTGATCTCCAGG - Intronic
1114988157 14:28254433-28254455 ATGTACATGGAATGCTCTCCAGG + Intergenic
1119032380 14:71202881-71202903 GAGTCTGTTGAGTGCTCCCCGGG + Intergenic
1119140225 14:72260701-72260723 ATGCCTGCGGAGCTCTCTCCAGG + Intronic
1121224140 14:92308892-92308914 ATGTCTGTCCAGTGCTCGTCTGG + Intergenic
1124399139 15:29333393-29333415 ATGTCTCTGGACTGCTGGCCAGG - Intronic
1127917115 15:63463943-63463965 ACGTCTGTGGGGTGGTGTCCTGG + Intergenic
1129348825 15:74941972-74941994 AGGGCTGTGGACTGCTCTCAAGG - Intergenic
1130059607 15:80560008-80560030 ATGTGTGGGGAGGGCTCTCCTGG - Intronic
1131643266 15:94314937-94314959 GTCTCTGTCCAGTGCTCTCCCGG - Intronic
1132222216 15:100113430-100113452 CTGACTATGGGGTGCTCTCCTGG + Intronic
1132821822 16:1876791-1876813 ATGTCTTGGGAGTGCTGTCATGG + Intronic
1134454726 16:14386701-14386723 TAGTCTGTGGGGTGCTGTCCTGG - Intergenic
1138713918 16:58999943-58999965 ATGTTTTTGTAATGCTCTCCTGG - Intergenic
1139433502 16:66923720-66923742 ATGTGTGTTGTGTGTTCTCCAGG - Exonic
1144817407 17:18045239-18045261 AAGTCTGTGGTGTGCTCCACAGG + Intronic
1145055930 17:19704049-19704071 AGGTAGGTGGAGTCCTCTCCTGG - Exonic
1151729312 17:75901482-75901504 CTGTCTGTGGTGTGCCCTCCTGG - Intronic
1151868405 17:76820226-76820248 AGGCCTCTGGAGTGCTCTGCAGG + Intergenic
1152930927 17:83109536-83109558 GTGCCTGTGGGGTCCTCTCCGGG + Intergenic
1156830097 18:41481572-41481594 ATTTCTGTGGAGTGGGTTCCAGG - Intergenic
1157716939 18:49894322-49894344 AAGTCTGTGGGGGGGTCTCCAGG + Intronic
1159972355 18:74669702-74669724 ATCTCTGTGAAGTGCTGACCTGG + Intronic
1160949596 19:1659011-1659033 ATGTCTGTGGAGTGCAGGGCCGG - Intergenic
1161249786 19:3274267-3274289 AGGGCTGTGGATTGCTCTCTGGG + Intronic
1162060394 19:8091264-8091286 ATGTCTATGGAGGGCTAACCTGG - Intronic
1162395250 19:10414455-10414477 ATGTCTGTTGAGGGCCCACCAGG + Intronic
1162717759 19:12644594-12644616 AGGACTGTGGAGTACTCTTCAGG - Intronic
1168153471 19:54461023-54461045 ATTTGTGGGGAGTGCGCTCCAGG + Exonic
927517968 2:23682941-23682963 ATGCATGTGGCGTGTTCTCCAGG + Intronic
929436795 2:41934809-41934831 ATCTCTGTGGAGTGTCCTCTGGG - Intergenic
931292884 2:60891778-60891800 TTGTCTGTGCTGTGCTCCCCTGG - Exonic
931712107 2:64997177-64997199 ATCTCTGGGAAGGGCTCTCCTGG - Intronic
932163064 2:69480628-69480650 TTCTCTGTGGAGTGATCTCTGGG - Intronic
935071810 2:99700982-99701004 ATGAGTGTGGAGTGTTCCCCGGG - Intronic
940385682 2:153068695-153068717 GTGCCTGTTGAGTGCTGTCCTGG + Intergenic
946630925 2:221668063-221668085 TTGTCTGTGCTGTGCTCTCTAGG + Intergenic
947451843 2:230215918-230215940 GTCTCTGAGGAGTGCTCTCTGGG + Intronic
1169391744 20:5196413-5196435 ATGCCTTTGCAGTGGTCTCCCGG + Exonic
1170797074 20:19557270-19557292 ATGTCTGTGCAGTGGTGTGCTGG + Intronic
1172135019 20:32681078-32681100 ATCTCTGGGGAGAGCGCTCCAGG + Intergenic
1172699745 20:36845796-36845818 CTGTCACTGGAGAGCTCTCCTGG - Intronic
1174762151 20:53216701-53216723 ATGTCTGCGCTGTGTTCTCCAGG - Intronic
1179479612 21:41669019-41669041 AGGCCTGGGGAGTGCTCGCCAGG - Intergenic
1179549217 21:42132949-42132971 ATGCCAGTGTAGTGCTCTACTGG - Intronic
1180102554 21:45595912-45595934 AAGTCTCTGGAGTGGTGTCCAGG - Intergenic
1182020476 22:27077303-27077325 ATGTCTGGGGAGTTCTCTGGTGG + Intergenic
1183886477 22:40887481-40887503 ATTTCTGGTGAGGGCTCTCCCGG + Intronic
1185296206 22:50056594-50056616 GTGGGTGTGGAGGGCTCTCCTGG - Intronic
949543696 3:5054197-5054219 ATGTCAATGGAGTGCTCCCATGG + Intergenic
953663696 3:44909979-44910001 ATGTCTCTGGAGTCCTGGCCAGG + Intronic
956059788 3:65337909-65337931 ATGTCTGTAGAGTGACTTCCAGG + Intergenic
959189788 3:103097033-103097055 ATGTCTGTGAACTTCTCTTCAGG + Intergenic
961155613 3:124677052-124677074 ATGTATGTGGAGTGTTCTGGAGG + Intronic
961375900 3:126465640-126465662 ATGTCTTTGAAATGCTTTCCTGG - Intronic
963753647 3:149210301-149210323 ATGTATGTATACTGCTCTCCTGG + Exonic
964437239 3:156666863-156666885 ATGTATGTCCAGTGCTCTACTGG + Intergenic
964523458 3:157591706-157591728 CTGGCTGTGCAGTGTTCTCCAGG - Intronic
968518543 4:1024832-1024854 ATGGGTCTGGGGTGCTCTCCTGG + Intronic
968824836 4:2887554-2887576 ATGTCAGTGGAATGCTGTCAAGG + Intronic
969149077 4:5153048-5153070 ATGGCAGTGGGGTCCTCTCCAGG - Intronic
969590309 4:8118271-8118293 ATGAGTGTGGAGTGCTCTTCTGG - Intronic
970154475 4:13127867-13127889 ATGTCTGAGTGGTGCCCTCCAGG + Intergenic
970254248 4:14150792-14150814 ATCTCTGTGCAGTGCTATCTAGG + Intergenic
975416491 4:74111293-74111315 TTGTCTGAGGAGTGATCTGCTGG - Intergenic
976737026 4:88320662-88320684 ATGGAGGTGGAGTGCTGTCCTGG + Intergenic
977643886 4:99389736-99389758 GTGGCTGAGGAGTGCTGTCCTGG + Intergenic
985571074 5:645499-645521 GTGTGTGTGGTTTGCTCTCCCGG + Intronic
985614295 5:910347-910369 CTGTCTGTGGCCTTCTCTCCTGG + Intronic
986689828 5:10305189-10305211 AGCTCTGTGGAGTGCCCTGCAGG + Intronic
990346159 5:54873730-54873752 TTGTCTGTGGATTGCTCTCCAGG - Intergenic
999436581 5:151568024-151568046 ATGGCTTTGAAGTGCTTTCCAGG + Exonic
1003348334 6:5292324-5292346 ATGCCTCTGGCCTGCTCTCCAGG - Intronic
1003890151 6:10556893-10556915 TTGTCTATGGAGGGATCTCCAGG + Intronic
1005064213 6:21802719-21802741 ATGACTGATGAGTGCTCTTCAGG + Intergenic
1014296361 6:119622781-119622803 ATGCATGTGGATTGCTTTCCAGG + Intergenic
1018672547 6:166191862-166191884 ATCTATTTGGAGTGCTTTCCAGG - Intergenic
1019612449 7:1943737-1943759 ATGTGTGTGCAGTTCTCTCGGGG - Intronic
1022446257 7:30473085-30473107 GTGTGTGTGAAGTGCTCTGCTGG - Intronic
1024950790 7:54858332-54858354 TTGGCTGAGGAGAGCTCTCCAGG + Intergenic
1025958233 7:66199052-66199074 TTGGCTCTGGAGTCCTCTCCTGG + Intergenic
1029440106 7:100582714-100582736 ATGTCAATGGAGGGCTATCCTGG + Intronic
1029596434 7:101539949-101539971 AGGTCGGCGGAGTGCTCTCGGGG - Exonic
1032918953 7:136524595-136524617 ATGTCTCTGGACTGCACTGCAGG + Intergenic
1033428618 7:141267778-141267800 ATGCCTGTGAAGGGCTCTGCTGG + Intronic
1033556235 7:142490553-142490575 TGGTCTGTGGACTCCTCTCCAGG + Intergenic
1036705094 8:11040632-11040654 GTGTCTGGTGAGGGCTCTCCTGG + Intronic
1038086109 8:24198159-24198181 ATTTTTTTGGAGTGCTCCCCTGG + Intergenic
1039684359 8:39781571-39781593 ATTTCTGTGTAGTGCACTACAGG + Intronic
1043605212 8:81991317-81991339 AGGTCTGTGGATTTCTCTACAGG + Intergenic
1043949287 8:86290306-86290328 ATGTCTGCAGAGTGCTATCAAGG - Intronic
1045747008 8:105434133-105434155 ATGTTTGTGGATTCCTATCCTGG - Intronic
1046407740 8:113796655-113796677 GTGTGTGTGGTGTGCTCCCCGGG + Intergenic
1047803491 8:128334007-128334029 CTGTTTGTGGAGTGCTTACCAGG + Intergenic
1048768827 8:137873196-137873218 ATGTCTGAGATGTGCTCTCAAGG - Intergenic
1049183429 8:141235358-141235380 GTGTCTGTAGAGTGCACTTCCGG + Intronic
1049222310 8:141433672-141433694 AAGTCTGTGAAGTGCCCTGCAGG - Intergenic
1059662919 9:116419468-116419490 TTGGCTGTGGACTTCTCTCCAGG + Intergenic
1060999634 9:127895949-127895971 GTGACTGTGGAGTGCTGTGCAGG - Intronic
1061894998 9:133642535-133642557 AGGACTGTGGACAGCTCTCCAGG - Intronic
1061992783 9:134169006-134169028 ATATTTGTTGAGTGCTTTCCGGG - Intergenic
1062168049 9:135118268-135118290 GGGTCTTTGGAGTGCTCACCGGG + Intronic
1062168052 9:135118288-135118310 GGGTCTTTGGAGTGCTCACCAGG + Intronic
1062168069 9:135118430-135118452 GTGTCTTTGGAGTGCTCACCAGG + Intronic
1062168119 9:135118793-135118815 GTGTCTTTGGAGTGCTCGCCGGG + Intronic
1062168123 9:135118813-135118835 GGGTCTTTGGAGTGCTCGCCGGG + Intronic
1062168127 9:135118833-135118855 GGGTCTTTGGAGTGCTCACCGGG + Intronic
1062168135 9:135118893-135118915 GGGTCTTTGGAGTGCTCGCCGGG + Intronic
1062168160 9:135119077-135119099 GGGTCTTTGGAGTGCTCACCGGG + Intronic
1185519602 X:728794-728816 CTGTCTGTGGTGAGCTCTGCTGG - Intergenic
1185519780 X:729733-729755 TTGTCTGTGGTGAGCTCTGCTGG - Intergenic
1186465934 X:9785176-9785198 CTCTCTGTCCAGTGCTCTCCCGG + Intronic
1187303858 X:18077433-18077455 ATATCTGTGGAGTACCCACCAGG - Intergenic
1192639924 X:72852156-72852178 AGGACTGTGGAGTGATCTCAAGG - Intergenic
1192641787 X:72868649-72868671 AGGACTGTGGAGTGATCTCAAGG + Intergenic
1192862823 X:75096348-75096370 ATCTCTGTTGAGTACTCTCCCGG - Intronic
1198052657 X:132963681-132963703 ATGTCTCTCTAGTGCTCTCCTGG + Intergenic
1200001472 X:153063619-153063641 TTGGCTGTGGAGAGCTCACCAGG - Intergenic