ID: 1106112782

View in Genome Browser
Species Human (GRCh38)
Location 13:26791751-26791773
Sequence CTGGTCCCTCCCACAACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8764
Summary {0: 1, 1: 17, 2: 301, 3: 2536, 4: 5909}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106112782_1106112787 0 Left 1106112782 13:26791751-26791773 CCAACTGTTGTGGGAGGGACCAG 0: 1
1: 17
2: 301
3: 2536
4: 5909
Right 1106112787 13:26791774-26791796 ATGGAGATCATTGAATTATGGGG 0: 1
1: 2
2: 123
3: 1145
4: 4341
1106112782_1106112789 4 Left 1106112782 13:26791751-26791773 CCAACTGTTGTGGGAGGGACCAG 0: 1
1: 17
2: 301
3: 2536
4: 5909
Right 1106112789 13:26791778-26791800 AGATCATTGAATTATGGGGGTGG 0: 2
1: 93
2: 1272
3: 3528
4: 5841
1106112782_1106112790 19 Left 1106112782 13:26791751-26791773 CCAACTGTTGTGGGAGGGACCAG 0: 1
1: 17
2: 301
3: 2536
4: 5909
Right 1106112790 13:26791793-26791815 GGGGGTGGTTTTGCCCATACCGG 0: 1
1: 0
2: 10
3: 22
4: 142
1106112782_1106112785 -2 Left 1106112782 13:26791751-26791773 CCAACTGTTGTGGGAGGGACCAG 0: 1
1: 17
2: 301
3: 2536
4: 5909
Right 1106112785 13:26791772-26791794 AGATGGAGATCATTGAATTATGG 0: 1
1: 1
2: 137
3: 1066
4: 3207
1106112782_1106112791 27 Left 1106112782 13:26791751-26791773 CCAACTGTTGTGGGAGGGACCAG 0: 1
1: 17
2: 301
3: 2536
4: 5909
Right 1106112791 13:26791801-26791823 TTTTGCCCATACCGGTCTTGTGG 0: 1
1: 0
2: 1
3: 83
4: 573
1106112782_1106112788 1 Left 1106112782 13:26791751-26791773 CCAACTGTTGTGGGAGGGACCAG 0: 1
1: 17
2: 301
3: 2536
4: 5909
Right 1106112788 13:26791775-26791797 TGGAGATCATTGAATTATGGGGG 0: 2
1: 51
2: 858
3: 3414
4: 8205
1106112782_1106112786 -1 Left 1106112782 13:26791751-26791773 CCAACTGTTGTGGGAGGGACCAG 0: 1
1: 17
2: 301
3: 2536
4: 5909
Right 1106112786 13:26791773-26791795 GATGGAGATCATTGAATTATGGG 0: 1
1: 2
2: 128
3: 1129
4: 4444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106112782 Original CRISPR CTGGTCCCTCCCACAACAGT TGG (reversed) Intergenic
Too many off-targets to display for this crispr