ID: 1106114026

View in Genome Browser
Species Human (GRCh38)
Location 13:26801652-26801674
Sequence GCTTACAGCAGTGGGCTCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106114018_1106114026 11 Left 1106114018 13:26801618-26801640 CCATGAGCAGCGTCAGCAATGCC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1106114026 13:26801652-26801674 GCTTACAGCAGTGGGCTCAGCGG 0: 1
1: 0
2: 0
3: 15
4: 187
1106114017_1106114026 21 Left 1106114017 13:26801608-26801630 CCAGCAGATTCCATGAGCAGCGT 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1106114026 13:26801652-26801674 GCTTACAGCAGTGGGCTCAGCGG 0: 1
1: 0
2: 0
3: 15
4: 187
1106114023_1106114026 -10 Left 1106114023 13:26801639-26801661 CCAGAGGGTTTGGGCTTACAGCA 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1106114026 13:26801652-26801674 GCTTACAGCAGTGGGCTCAGCGG 0: 1
1: 0
2: 0
3: 15
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106114026 Original CRISPR GCTTACAGCAGTGGGCTCAG CGG Intergenic