ID: 1106117424

View in Genome Browser
Species Human (GRCh38)
Location 13:26829642-26829664
Sequence TCCTGCAGGCAGATGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 355}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106117424 Original CRISPR TCCTGCAGGCAGATGGTGGA GGG Intergenic
900430318 1:2598299-2598321 TCCTGGGGGCAGAAGGTAGAGGG + Exonic
900466705 1:2829168-2829190 CGCGGCAGGCAGATGGAGGATGG - Intergenic
900688680 1:3966105-3966127 GGCTGCAGGCAGTTGGTGCAGGG + Intergenic
901148422 1:7084274-7084296 TCTTGAAGACAGATGGAGGACGG + Intronic
901218957 1:7571482-7571504 ACCTGAAGGCAGAAGGTGGGAGG - Intronic
902036701 1:13463168-13463190 TCCTGAAGGCAGAGGGAGGGAGG + Intergenic
902051341 1:13565873-13565895 TCCTGCAGGCGGATGGCAGTTGG - Intergenic
902229501 1:15018984-15019006 TCCTGAAGGCACATGGCGGGCGG + Intronic
905335381 1:37241103-37241125 TCCTGCGGGCAGAATGTGGGGGG + Intergenic
909209828 1:72808813-72808835 TGCTGCTGGGAGATGGGGGAGGG + Intergenic
909232307 1:73106000-73106022 TCCTACAGGAAGCTGCTGGAGGG + Intergenic
913049076 1:115099809-115099831 TCGTGCAGCCAGTTGGGGGAAGG + Intergenic
913052305 1:115128521-115128543 TCCTGAAGGCAGAAGGAAGATGG - Intergenic
913698023 1:121346766-121346788 ACTGGCAGGCAGATGATGGAAGG + Intronic
914139527 1:144933286-144933308 ACTGGCAGGCAGATGATGGAAGG - Intronic
915297077 1:154929043-154929065 TTTTGCAGGAAGATTGTGGAGGG - Exonic
915331893 1:155117852-155117874 CCCTGCAGGCAGGTGGGAGATGG - Intergenic
915580265 1:156809140-156809162 CCCTGCAGGTAGATGGGGGAAGG - Intronic
915631158 1:157154947-157154969 TCCTGCAGGCAGAGGTGGGTAGG - Intergenic
918048333 1:180954351-180954373 GCCTGCAGCCTGAGGGTGGAGGG + Intergenic
919705870 1:200675071-200675093 TCCAGCAGGCAGGTGGAGGAGGG + Intergenic
919978831 1:202629851-202629873 CCCAGCAGGCAGCTGGTGGGGGG + Intronic
920242886 1:204566439-204566461 TCCAGCAGGCAGTAGGGGGAGGG + Intergenic
920311597 1:205052023-205052045 TCTTGCAGGCAGTTGGTGAAAGG + Intronic
920485419 1:206365416-206365438 ACTGGCAGGCAGATGATGGAAGG + Intronic
920696820 1:208187047-208187069 TCCTGTAGGAAGGTGGGGGAGGG + Intronic
921795864 1:219344200-219344222 AACTGCAGGCAAATGGTGTAGGG - Intergenic
922182769 1:223248359-223248381 TCCTGCAGGCAGAGGTTGGGTGG - Intronic
922552984 1:226510740-226510762 TGCTGCAGTCAAATGGTGGCTGG - Intergenic
923075615 1:230606294-230606316 TCCTGCAGGCAGACGGCAGTCGG - Intergenic
1062855855 10:779257-779279 TCCAGCAGGCGGAACGTGGAGGG + Intergenic
1062961694 10:1577270-1577292 TCATGCACACAGAAGGTGGATGG + Intronic
1063570583 10:7211312-7211334 ACCTGCAGGCAGATGAAGGCAGG + Intronic
1064478549 10:15718224-15718246 TAGTGCAGGCAGAGTGTGGATGG - Intronic
1065269059 10:24008096-24008118 TCTTGCAGGCAGAATGTTGAGGG - Intronic
1066979826 10:42402773-42402795 TCCTGCACGCGGAAGGTGGAAGG - Intergenic
1067878635 10:50025175-50025197 TCCTGCAGGCAGATGGCCCCAGG - Intergenic
1067893091 10:50152761-50152783 TCCTGCAGGCAGATGGCCCCAGG + Intergenic
1069071272 10:63992572-63992594 CCATGGAGGCAGATGGTTGAGGG + Intergenic
1069735674 10:70652574-70652596 TCCTGCAGGTAGGAGGAGGAAGG + Intergenic
1071529062 10:86375347-86375369 TCCAGCAGGAAGAAGGGGGAAGG - Intergenic
1072689716 10:97564030-97564052 TCCTGCAGGCGGATGGCAGTTGG + Intronic
1073130449 10:101185481-101185503 TCCTGCAGGCAGACGGCAGTTGG + Intergenic
1073133660 10:101207204-101207226 GCATGCAGGCAGATGGAGGGTGG - Intergenic
1074053452 10:109900546-109900568 CCTTGCAGGCAGGTGGTAGAGGG - Intronic
1077017998 11:405441-405463 CCATGCAGGCAGATCCTGGATGG - Intergenic
1078018958 11:7639819-7639841 TCAGGCTGGCAGATGGTGGGAGG - Exonic
1078187227 11:9062308-9062330 GCCTACAGGCAGGTGGTTGAAGG + Intronic
1078203213 11:9203517-9203539 TTTTGCAGGTAGGTGGTGGATGG - Intronic
1080695705 11:34601321-34601343 TCCAGCAGGCAGATGTGGCAGGG - Intergenic
1081195040 11:40151011-40151033 TCTTGCAGGCATATGGAGCATGG - Intronic
1081703556 11:45166752-45166774 TCCTCCAGGAAGGAGGTGGAAGG - Intronic
1085387059 11:76163532-76163554 TCATGCAGGGAGAGGGTGGAAGG - Intergenic
1086048567 11:82561953-82561975 TCCTGTAGGCAGATACTGCAAGG - Intergenic
1089279736 11:117365431-117365453 CCCTGCTGTCAGCTGGTGGATGG + Intronic
1089280995 11:117374423-117374445 TCCTCCAAACAGATGGAGGATGG - Intronic
1090448679 11:126786953-126786975 TCCTGCAAGCAGGGGTTGGAAGG + Intronic
1091383784 12:79046-79068 TCCTGAAAGTAGATGGCGGAGGG - Intronic
1093409860 12:18852045-18852067 TCCTGCAGTCTAATTGTGGATGG - Intergenic
1095301432 12:40589361-40589383 TCCTGCACGCAGATGATTAAAGG - Intergenic
1096474696 12:51901161-51901183 TGCAGCAGGCAGATGATGGCTGG + Intergenic
1096518703 12:52172210-52172232 ACCTACAGGAAGCTGGTGGAGGG - Exonic
1100744565 12:97631700-97631722 TCCTGCAGGCAAAGGGTGCAAGG - Intergenic
1101026319 12:100609909-100609931 TGCTGCTGGAAGATGGAGGAAGG + Intronic
1101817950 12:108160175-108160197 TTCTGCAGGAAGATGGTTGGTGG + Intronic
1102669138 12:114602280-114602302 TCCTGCTGGGGGATGCTGGAAGG - Intergenic
1102727232 12:115076503-115076525 TTCTGCAGGCAGATCGGAGATGG - Intergenic
1102959860 12:117085414-117085436 TCGGGAAGGCAGAAGGTGGAAGG + Intronic
1103001160 12:117386412-117386434 TCCTGCAATCAGATAGTGGCAGG + Intronic
1103005513 12:117417296-117417318 TCCTGGAGGCAGCTGGGGGAAGG - Intronic
1103564909 12:121810635-121810657 TCCTCCAGGCCGGTGCTGGAGGG - Exonic
1103764022 12:123269418-123269440 TCCTGGAGAGAGATGGCGGAAGG + Intronic
1104354442 12:128072830-128072852 TCCTGAAGCCAGATGGTAGGTGG - Intergenic
1104470848 12:129028497-129028519 TTCAGCTGGCAGATGGTGCAAGG + Intergenic
1105062727 12:133168634-133168656 TCCAGCTTGCAAATGGTGGATGG - Intronic
1105353219 13:19634234-19634256 GGCTGCAGGCAGCTGGTGAAGGG + Intronic
1105754749 13:23454013-23454035 TCCAGCTTGCAGATGGTAGATGG - Intergenic
1106117424 13:26829642-26829664 TCCTGCAGGCAGATGGTGGAGGG + Intergenic
1106257888 13:28038271-28038293 TACTGCAGTGAGATGTTGGATGG + Intronic
1106796585 13:33212534-33212556 TCCTGCAGGCAGGTGTGGGCAGG + Intronic
1109130402 13:58577129-58577151 TCCTGGTTGCAGATTGTGGAAGG - Intergenic
1112146932 13:96710341-96710363 GCCTGCAGGCAGCTGGTGCTGGG + Intronic
1112491415 13:99867839-99867861 TTCTGCTGGGTGATGGTGGAGGG - Intronic
1113077977 13:106487083-106487105 TGCTGGAGGCAGTGGGTGGATGG + Intergenic
1113630600 13:111880443-111880465 TCCTGTAGGCAGATGGAGCGGGG + Intergenic
1113630615 13:111880501-111880523 TCCCGCAGGCAGATGGAGGAGGG + Intergenic
1114531163 14:23397256-23397278 TCCTGGAGGCAGATGAAGGTGGG + Exonic
1114938596 14:27576530-27576552 TCTTGAAGGCAGAAGATGGATGG - Intergenic
1115569335 14:34652230-34652252 TCCTGCAGGCAGACGGCGGTTGG - Intergenic
1117866191 14:60151930-60151952 TCAGGCAGGCAGATGAGGGAGGG - Intronic
1118318099 14:64737785-64737807 TCCTGCAGGCAGCTGCGGGGGGG - Intronic
1119688574 14:76652917-76652939 TCCGGCAGGCAGAGGTTGCAGGG - Intergenic
1119981851 14:79090663-79090685 TTCTGCTGACAGTTGGTGGATGG - Intronic
1120829890 14:88988359-88988381 TTCAGCAGGCAGATGGGGAAAGG + Intergenic
1121560762 14:94873691-94873713 TCCTGCATGGAGGTTGTGGAAGG + Intergenic
1121694738 14:95903762-95903784 TACTGGGGGCAGATGGTGGCTGG + Intergenic
1121999049 14:98630931-98630953 GCCTCCAGTCAGAGGGTGGAGGG - Intergenic
1122299153 14:100722322-100722344 ACCTGGGGGCAGAGGGTGGAGGG - Intergenic
1122325336 14:100878270-100878292 TCCTGCAGCCAGCCAGTGGAGGG + Intergenic
1122514978 14:102301134-102301156 TCATGCACTCAGATGGTGGCTGG - Intronic
1122816583 14:104316974-104316996 GGGTGCAGGCAGATGGTGAATGG + Intergenic
1123685664 15:22795387-22795409 AGCTGCAAGCAGATGGTGGCTGG + Intronic
1125892345 15:43276050-43276072 GCCTGCAGGCAGAGGATGGAGGG - Intergenic
1126786381 15:52180348-52180370 TCCTGCAGGCAGAGAGAGGACGG + Intronic
1127525732 15:59790854-59790876 TCCAGCAGGCAGAGGTGGGATGG + Intergenic
1128625092 15:69193203-69193225 ACCTCCAGGCAGAAGCTGGAGGG + Intronic
1129277200 15:74453917-74453939 TCCTCCAGGTAGAAGGTGGGAGG + Intronic
1130330635 15:82919423-82919445 TTCTGCAGGGAGGTGGTTGATGG - Intronic
1131007990 15:88994099-88994121 TGCTGCAGGCTGGTGGTGTAGGG - Intergenic
1132203397 15:99970344-99970366 TCCTGGAGGCAGGTGGGCGACGG + Intergenic
1132800243 16:1748467-1748489 CCCTGCAGGCCGGTCGTGGATGG - Intronic
1133281255 16:4666695-4666717 TGCCGCAGGCAGGTGGCGGAAGG - Intronic
1133302812 16:4793169-4793191 GCCTGGAAGCAGAGGGTGGAGGG + Intronic
1134120486 16:11580726-11580748 TCCTGGAGGCAGGTGGTGATAGG - Intronic
1135975770 16:27108264-27108286 TCAGGCAGGCAGGTGGGGGACGG + Intergenic
1136022638 16:27449753-27449775 TCCTGGAGGCAGACGCTGGAGGG - Exonic
1136283214 16:29226344-29226366 TCCTGCAGGGAGATGGAGCAGGG + Intergenic
1137699860 16:50489602-50489624 TCCTGCTGGGAGATGGTGGGCGG + Intergenic
1138133880 16:54504741-54504763 TCCTACAAGCAGATGTTAGAAGG + Intergenic
1139510589 16:67426196-67426218 TCCTGCATCCAGATGAGGGACGG - Intergenic
1140217788 16:73022338-73022360 CCAGGCAGGCAGATGGTGAAAGG + Intronic
1142087595 16:88192241-88192263 TCCTGCAGGGAGATGGAGCAGGG + Intergenic
1142521382 17:507286-507308 TTCTGCAAGCAGAGGGTGAAAGG + Intergenic
1143101482 17:4506955-4506977 TCCTGCGGGCAGACGGGGGCAGG + Intronic
1143664124 17:8346543-8346565 TCCTGCTGTTACATGGTGGAGGG - Intergenic
1144154465 17:12485590-12485612 TCCTGCTGTGAGATGGTGGGAGG - Intergenic
1144401944 17:14913174-14913196 TCCTGCAAGCAGGAGGTGAAGGG + Intergenic
1144837290 17:18163339-18163361 TCCTGCAGCCAGGTACTGGAGGG + Intronic
1145052814 17:19676912-19676934 TGGGGCAGACAGATGGTGGATGG + Exonic
1145959146 17:28876306-28876328 ACATGCAGCCAGATGGTGGCTGG + Intergenic
1146183747 17:30712057-30712079 GCCTGCAGGGAGGGGGTGGAAGG + Intergenic
1146226969 17:31075386-31075408 TCCTGCAGGGAGGGGGTGGGTGG - Intergenic
1146286108 17:31575149-31575171 TCCTGCAGGCAGAAGGCGCTGGG + Intronic
1146501731 17:33370481-33370503 TCCTGCAAGCAAAGGCTGGAGGG + Intronic
1146820145 17:35978218-35978240 TACTTCAGGCAGCAGGTGGATGG + Exonic
1148993672 17:51688681-51688703 TTCTGCAGGCAGATGGGGAAAGG - Intronic
1149779780 17:59388171-59388193 TCCCGCTGGCAGATGGTGTGGGG - Intronic
1150492303 17:65582920-65582942 GCCTGGAGGGAGATGGTGGTGGG - Intronic
1150515683 17:65807521-65807543 TCCTCCAGGCCTATGGTGGGAGG - Intronic
1150602499 17:66663025-66663047 TTCTGCTGGCGGATGGAGGAAGG + Intronic
1152105961 17:78329380-78329402 TCCTGCTGGCGGTAGGTGGATGG + Intergenic
1152454454 17:80405413-80405435 TTCTGCAGGCAGATGGTGGTTGG - Intergenic
1152699413 17:81811708-81811730 TACTGCTGGCTGCTGGTGGAGGG + Exonic
1153774044 18:8437338-8437360 CCCTGCTGGGAGAGGGTGGAGGG - Intergenic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1155449020 18:25944019-25944041 TTCTGCAAGCACAGGGTGGATGG - Intergenic
1156137156 18:34056440-34056462 TTCTACAGGCAGATGCTAGAAGG - Intronic
1156177503 18:34564073-34564095 TCCAGAAGGCAGAAGGCGGAAGG + Intronic
1156375883 18:36515033-36515055 GCCTGCAGGCCGCTGGTGGGAGG - Intronic
1157367109 18:47075307-47075329 TCGTCCAGGAAGATCGTGGATGG - Exonic
1157481783 18:48059896-48059918 CCCTACAGGCAGCTGGTGGGAGG + Intronic
1157700519 18:49759179-49759201 TCCTGCTGGCTGATGGGGGTGGG + Intergenic
1157729381 18:49990506-49990528 TCCTCCAGGCAGATGATGAGAGG - Exonic
1159897240 18:74008829-74008851 TCCTGCACCCGGATGCTGGAGGG + Intergenic
1159948503 18:74461247-74461269 TCCTACAGGCAGGAGTTGGAGGG - Intergenic
1161615927 19:5270165-5270187 TCCTGCTGGGGGATGGAGGAAGG - Intronic
1162208834 19:9075801-9075823 GCCTGCAGGGAGGTGGGGGAAGG - Intergenic
1162423737 19:10581438-10581460 TCCTGCAGCCAGGCCGTGGAAGG + Intronic
1162975049 19:14203696-14203718 GCCTGCAGGGAGGGGGTGGAAGG - Intronic
1163509844 19:17727893-17727915 TCCACCATGCAGATGCTGGATGG - Exonic
1163598257 19:18232938-18232960 TCCTGCAGGCGGTAGGTGGCCGG - Exonic
1164883266 19:31754525-31754547 TACTCAAGGCAGAAGGTGGAGGG + Intergenic
1165700751 19:37935595-37935617 GGCTGCAGTCAGAGGGTGGATGG + Intronic
1166670762 19:44708296-44708318 TCCTTCAGCCTGATGGGGGATGG - Intronic
1166705023 19:44903761-44903783 CCCTGCAGGCGGCTGGGGGAAGG - Intergenic
1166935645 19:46330814-46330836 GCTGGCAGACAGATGGTGGATGG + Intronic
1168241227 19:55089851-55089873 TGGTGCAGGCAGATGGTTGAAGG - Intergenic
924964191 2:60119-60141 CCCTTCAGGTAGATGTTGGAAGG - Intergenic
925159772 2:1675955-1675977 TCACGCAGGCAGATGGGAGAAGG + Intronic
925275469 2:2645167-2645189 TTCTGAAGGCAGTGGGTGGAAGG - Intergenic
925364466 2:3302557-3302579 TCCTGAGTGCAGTTGGTGGATGG + Intronic
925736301 2:6967073-6967095 TCATACAGGCATATGGGGGATGG - Intronic
925976720 2:9146854-9146876 TCCTGCAGGCTGTGGGTGGCAGG - Intergenic
926251865 2:11159396-11159418 GCCTGCAGGCAGCTGGGGGTGGG + Intronic
928239088 2:29571072-29571094 TCCTGGAGGGAGATAGTGGAGGG + Intronic
928320152 2:30276787-30276809 TACTGCAGGCTGATTGGGGAGGG - Intronic
928864129 2:35896398-35896420 TGCTGCTGGGAGATGGAGGAGGG + Intergenic
933485148 2:82912025-82912047 TCCTGCAGGGAGATGATTGCTGG - Intergenic
934051353 2:88213927-88213949 TCCTTCAGACAGGAGGTGGATGG + Intergenic
935574564 2:104695545-104695567 TCCTGCACCCAGCTGGTGGCTGG + Intergenic
936498065 2:113039908-113039930 GCATGCAGGCAGATCCTGGAGGG + Intronic
937219938 2:120336951-120336973 TCCTGCAGCCAGGGGGTGGCAGG - Intergenic
937284334 2:120740849-120740871 TCCTGCAGGCAGCTAGAGGGAGG + Intronic
938304833 2:130246062-130246084 TTCCTCAAGCAGATGGTGGAAGG + Intergenic
938449180 2:131401138-131401160 TTCCTCAAGCAGATGGTGGAAGG - Intergenic
938903408 2:135817518-135817540 CCCTGCAGGATCATGGTGGATGG - Exonic
940183419 2:150958499-150958521 TCCTGCAGGCAGATGGCATTTGG - Intergenic
940584131 2:155622608-155622630 ACCTTAAGGCAGAGGGTGGACGG + Intergenic
942218628 2:173747261-173747283 CCAACCAGGCAGATGGTGGATGG - Intergenic
942268186 2:174248503-174248525 TCCTGCCGGCAGCTGGAGGCGGG + Exonic
942290521 2:174465473-174465495 TACTGAAGGCAGATGGAGAAAGG - Intronic
942391909 2:175503425-175503447 TGCTGCTGGGAGATGGGGGAGGG + Intergenic
942957977 2:181796557-181796579 TCCTGCAAGCAGATTGTTCATGG + Intergenic
943064411 2:183071302-183071324 ACCTACAGGCAGCTGCTGGAGGG - Intergenic
945974526 2:216259835-216259857 TCCAGTAGGCAGAAGGTGGAGGG + Intronic
946676071 2:222161206-222161228 GCCTGCAGGCAGACGGCTGAGGG - Intergenic
947636965 2:231685043-231685065 GCATGCAGCCAGGTGGTGGAGGG + Intergenic
947924100 2:233905834-233905856 TCCTTCAGGAACATGGTGGAGGG + Intergenic
948339477 2:237237957-237237979 TCCTTCAGGCAGAAGCTAGAAGG + Intergenic
948371781 2:237494236-237494258 GGCAGAAGGCAGATGGTGGAGGG + Intronic
948576517 2:238955155-238955177 TCCTCCAGGCAGCAGGTGGCAGG + Intergenic
949021128 2:241742061-241742083 AGATGCAGGCAGAGGGTGGAAGG + Intronic
1168765376 20:378666-378688 TCCTCTAGGCAGAGGCTGGATGG - Intronic
1169879298 20:10329043-10329065 TCCTACAGTTAGATGGGGGAGGG + Intergenic
1169986222 20:11447873-11447895 CCCTGCTGGCAGATGGTGCCAGG - Intergenic
1170468449 20:16644314-16644336 ACCTGGAGGGAGATGGAGGATGG - Intergenic
1170525492 20:17231942-17231964 TCCTGAAGGCAGATATTTGAAGG - Intronic
1170545988 20:17436258-17436280 TCCAGCAGGCAGAGGGCAGAGGG - Intronic
1170714888 20:18823034-18823056 TCCTGCAGGCTCTTGGTGGGGGG + Intronic
1170838929 20:19908105-19908127 CCCTGCAGACAGATGGAGCATGG - Intronic
1171112769 20:22499745-22499767 TTCTACAGGCAGATGGTGCTGGG + Intergenic
1171250318 20:23641219-23641241 CCCTGCAGGCACATGCTGCAGGG + Intergenic
1172613666 20:36269197-36269219 GCCTGCAGGGAGCTGGTGGGGGG + Intronic
1174540597 20:51286255-51286277 CCCTGCAGACTGTTGGTGGAAGG - Intergenic
1175069320 20:56318633-56318655 TCCTGAAGGCAGCTGATGGTTGG - Intergenic
1175405004 20:58720172-58720194 CCCTGCAGGAAGCTGGAGGAGGG + Intergenic
1175415127 20:58795987-58796009 CCCTGCTGGCAGGGGGTGGAGGG + Intergenic
1175645865 20:60671105-60671127 CCGTGCAGGCAGATGGTGCCTGG + Intergenic
1175895673 20:62334620-62334642 GCCTGCAGGGAGAAGGTGGGAGG + Exonic
1175914764 20:62420723-62420745 TCCCACACGCAGATGCTGGAAGG + Intronic
1175960912 20:62635982-62636004 GCCTGCAGGCAGCAGGGGGAAGG + Intergenic
1175967982 20:62669190-62669212 TCCTGCAGCCAGTTTGTAGAAGG + Intronic
1176118456 20:63443616-63443638 TCCTGGAGGCAGGTGGCGGGTGG - Intronic
1178499043 21:33110601-33110623 TACTGCAGGGAGAGGGAGGAGGG - Intergenic
1179452994 21:41478246-41478268 TCCTGGAGGCCGCTGGTGGAGGG - Intronic
1179712200 21:43269694-43269716 TCAAGGAGGCAGATGGAGGAAGG - Intergenic
1179822707 21:43945968-43945990 TCCTGCGGGGACAAGGTGGAGGG - Intronic
1180192650 21:46173465-46173487 TCCTGCATGCTGGTGGGGGAAGG - Intronic
1181077915 22:20393774-20393796 TCCTGCAGACAGATGTGGGCAGG + Intergenic
1181838083 22:25627395-25627417 TCCTACAGGGAAAAGGTGGAAGG - Intronic
1182517915 22:30869437-30869459 TCCTGCAGGGAGATCGGTGAAGG + Intronic
1182938262 22:34247756-34247778 TCCTGGAGGCAGAGGTTGCAAGG - Intergenic
1184727127 22:46353681-46353703 TCATGAAGGCAGATGCTGGGAGG - Intronic
1185190502 22:49433253-49433275 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190518 22:49433334-49433356 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190549 22:49433456-49433478 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185314163 22:50171555-50171577 TCCTGCAGGGAGATGGGGGCTGG + Intronic
1185320703 22:50199031-50199053 CCCTGCAGGCAGACGGTGCCAGG - Exonic
949143250 3:662380-662402 TCCTTCTTGCAGATAGTGGAGGG + Intergenic
949671553 3:6402569-6402591 TCCTGCAGGCAGACGGCAGTTGG - Intergenic
951497670 3:23348992-23349014 TCCTGCGGGGAGGTGGTGGGGGG - Intronic
953172062 3:40515925-40515947 TCCTTCAGACTGATGGTGGGGGG + Exonic
954161177 3:48723746-48723768 TCCTGCAGGCGGATGGCAGTTGG + Intronic
954273186 3:49525237-49525259 TCCTGCAGCCAGGTAGTGGCCGG + Intronic
954532498 3:51333144-51333166 TCCAGCAGGCTATTGGTGGAGGG - Exonic
954614313 3:51961770-51961792 TCCAGCAGCCAGATGGTGGATGG + Intronic
954711121 3:52505578-52505600 TCCTGCAGGCCAAAGGTGGCAGG + Intronic
955401240 3:58593075-58593097 TCCTGCAGGCAGAAGGCAGTTGG - Intronic
955867657 3:63402107-63402129 CCCTGCAGCCAGAAGGAGGAAGG + Intronic
956731648 3:72201969-72201991 CCCCGCAGGTAGATGGTGTAGGG - Intergenic
958974621 3:100653683-100653705 TCTTGCAGTCAGATGGCGGCTGG + Intronic
959259202 3:104053207-104053229 ACCTGCAGGAGGATGGAGGAGGG - Intergenic
961585817 3:127922607-127922629 ACCTGCAGGCAGAGGGTATAGGG - Intronic
963224326 3:142846272-142846294 ACCTGCAGGCAGAGGTTGCAGGG - Intronic
963930935 3:151003737-151003759 TCCAGCTGGCAGATGGTGGTGGG + Intergenic
964353115 3:155822506-155822528 CCCAGCAGGCAGAGGGTGCAGGG + Exonic
964668563 3:159200570-159200592 TCCTGCTGGAGGATGGTGGTTGG - Intronic
964848341 3:161067869-161067891 TGCTGTAGGCAGATGGAGAAGGG - Intronic
966903386 3:184503802-184503824 TGATGCAGGCAGAAGGTGGAAGG + Intronic
967292147 3:187931673-187931695 TTCTGGAGCCTGATGGTGGAGGG - Intergenic
967450267 3:189615263-189615285 TCCTGCAGTCAGGTAGGGGAAGG - Intergenic
968051272 3:195656676-195656698 TCCCGGAGGGAGAGGGTGGAGGG + Intergenic
968104552 3:195991663-195991685 TCCCGGAGGGAGAGGGTGGAGGG - Intergenic
968302843 3:197629246-197629268 TCCCGGAGGGAGAGGGTGGAGGG - Intergenic
969200853 4:5604506-5604528 TCATGGAGGTAGAGGGTGGAAGG + Intronic
970819497 4:20196393-20196415 TCCTGCAGGCGGATGGCAGTTGG - Intergenic
970877349 4:20886429-20886451 TTCTGCAGGTAGCTGGTGGGTGG + Intronic
972065614 4:34939514-34939536 TTCTGCAGGCAGAGGGCAGAGGG + Intergenic
974103324 4:57441002-57441024 TCCTGCAGCCGGCTGGTGCAGGG + Intergenic
974350533 4:60738878-60738900 TCCTGCATGCAGAAGGCAGATGG - Intergenic
974390239 4:61258031-61258053 TCCTGGAGGAAGATGGGGGCTGG - Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
979473274 4:121125704-121125726 ACCTTCTGGCAGAGGGTGGAGGG + Intergenic
980503059 4:133682058-133682080 TTCTCCTGGCAGATGGAGGATGG - Intergenic
983669043 4:170215041-170215063 TCCTCCAGGCCTATGATGGAAGG - Intergenic
984551207 4:181161252-181161274 TCCTGGAGCGAGATGATGGAAGG - Intergenic
984707722 4:182860097-182860119 TCCAGCTGGCAGATGAGGGAAGG - Intergenic
985666269 5:1182998-1183020 TCCTGCAGACAGCTGCTGGGGGG + Intergenic
985684915 5:1277001-1277023 TCCTGCAAGCCGATGATGGCAGG + Intronic
986368464 5:7058197-7058219 TCCTGCAGGCAGATGGCAGTTGG + Intergenic
986728824 5:10619856-10619878 TCCGGCAGACAGATGGTGCTGGG - Intronic
987445847 5:18019072-18019094 CACTGCAGACAGATTGTGGAAGG + Intergenic
988395162 5:30687804-30687826 ACCTGAATGCAGATGGTGAATGG - Intergenic
991016073 5:61934028-61934050 GCCTTCAGGGAGATGGAGGAGGG - Intergenic
992459018 5:76943125-76943147 TGGTGCAGTCAGATGGTGGCTGG + Intergenic
995254642 5:110032498-110032520 ATCTGGAGACAGATGGTGGAGGG + Intergenic
995358247 5:111264183-111264205 TCCTGCTGCAAGATGGTGGCAGG + Intronic
995524707 5:113041214-113041236 GCCTCCAAGCTGATGGTGGATGG - Intronic
995705235 5:114982061-114982083 TCCCTGAGGCACATGGTGGAAGG - Intergenic
996248172 5:121291931-121291953 CCTTGCAGGCAGCTGGTGGGAGG + Intergenic
996358229 5:122619698-122619720 TCCTGCAGGCAGACGGCAGTTGG + Intergenic
996575939 5:124976490-124976512 TCCTGCAAGCAGAGGGAGGCTGG + Intergenic
997199235 5:131999736-131999758 CCCTGCATGCAGATGGAGGTGGG - Intronic
997376526 5:133401468-133401490 TATTGCAGGCAGGGGGTGGAGGG - Intronic
998148731 5:139745325-139745347 TGCCACAGGCAGATGGTGGAGGG + Intergenic
999898188 5:156057730-156057752 TCCTGCTGGCCAATGATGGAAGG + Intronic
1000101824 5:158023904-158023926 CCATGCAGGCAGATGCAGGATGG - Intergenic
1000975820 5:167763135-167763157 TGCTGAAGGCAGCTGGTGCAAGG + Intronic
1002484541 5:179525030-179525052 ACATGCAGGCAGATGGAGGCAGG + Intergenic
1005185659 6:23161153-23161175 TCCTGCATGCAGATGATCAAAGG - Intergenic
1006523436 6:34585364-34585386 GCCTGCAGGAAGATGGGAGAGGG - Intergenic
1006635128 6:35456460-35456482 TCCTGGAGGAAGAAGGAGGAAGG + Intronic
1006945231 6:37780125-37780147 TCCTGCAGCCATTTGGAGGAGGG - Intergenic
1007527687 6:42511193-42511215 TCCAGCAGGCAGAGGTTGCAGGG - Intergenic
1007820350 6:44556165-44556187 TCCTAGAGGCAGAAGGTGCAAGG + Intergenic
1007840510 6:44712344-44712366 CCCTGTAGGAGGATGGTGGAAGG - Intergenic
1008070612 6:47095408-47095430 TCCTGGAGGCAGAGGTTGCAGGG + Intergenic
1008618815 6:53251875-53251897 TCTTGAAGGCCGATGGTGAAGGG + Intergenic
1008650051 6:53552692-53552714 GCCTCCAGGCCTATGGTGGAAGG - Intronic
1009453369 6:63827008-63827030 TCCTGCAGGCAGCAGATGGTTGG - Intronic
1009874662 6:69490867-69490889 TAATGCAGGCAGTTGGGGGAGGG - Intergenic
1009929078 6:70154875-70154897 TAAAGCAGGCAGAAGGTGGAAGG - Intronic
1010083556 6:71889088-71889110 TGCTGCAGACAGCAGGTGGATGG + Intronic
1011234203 6:85197867-85197889 TCCTTCAGGCAGAGAGAGGAGGG + Intergenic
1012171006 6:96016316-96016338 TCCTCCAGGCAGAGGGTCCAGGG + Intronic
1012587718 6:100944746-100944768 TCCTGCATGCAGATGATTAAAGG - Intergenic
1013082944 6:106828593-106828615 TGCTGGAGGCAGATGATGGCAGG - Intergenic
1014029257 6:116681792-116681814 ACCTGCACGCAGGTGGAGGAGGG - Intronic
1014691097 6:124564491-124564513 TCCTGCTGGCTGGTGGGGGAGGG - Intronic
1014799235 6:125759351-125759373 GGCTGCGGGCAGGTGGTGGAAGG - Exonic
1015424039 6:133044439-133044461 TCCTGCAGGCAGTCAGTGGCAGG + Intergenic
1017593063 6:155997624-155997646 TTTTGCAGGCAGAAGATGGAAGG + Intergenic
1017922359 6:158883452-158883474 TCCTGCAGGCGGATCGTGGTTGG + Intronic
1018190763 6:161307464-161307486 TAAAGCAGGCAGAAGGTGGAAGG - Intergenic
1018454735 6:163941642-163941664 TCCTGGAGACAGAAGGAGGAGGG + Intergenic
1018519325 6:164628730-164628752 TCTTGCTGGCTGTTGGTGGAAGG - Intergenic
1018919347 6:168160742-168160764 GCCTTCAGGGACATGGTGGACGG - Intergenic
1019020484 6:168913771-168913793 CCTTGCCGGCAGATTGTGGATGG - Intergenic
1019413283 7:915936-915958 TTCTGCAGGCAGGTGGCAGACGG - Intronic
1019717395 7:2545877-2545899 TCCTGCAGCAAGATGGTGCCTGG + Intronic
1020052226 7:5089247-5089269 TCTTGCATGCAGTTGGTGGAAGG - Intergenic
1020240614 7:6391774-6391796 CCCTGCAGGCACAAGGAGGAAGG - Intronic
1021416604 7:20393461-20393483 TCTGGCAGCCAGATGGAGGATGG - Intronic
1022373255 7:29789718-29789740 TCCTGCAGGCAGACGGCAGTCGG - Intergenic
1022526448 7:31041006-31041028 TCCAGAGGGCAGATGGTGAAAGG - Intergenic
1022907557 7:34871568-34871590 TTTTACAGGCTGATGGTGGAAGG - Intronic
1023857322 7:44192645-44192667 TCCTTCGGCCAGATGGTGGTGGG - Intronic
1024457206 7:49622354-49622376 TCCTCTAGGCAAATGGTGGGTGG - Intergenic
1024742167 7:52365926-52365948 TCCTGCAGGCAGAAGGGGGAAGG + Intergenic
1027748174 7:82105605-82105627 TCATACAGGCCGTTGGTGGAAGG - Intronic
1028182824 7:87746724-87746746 TCCTGAAGGCAGAAGATGGTTGG + Intronic
1028580380 7:92403675-92403697 TCCTGCAGGCAGGCAGAGGAAGG + Intergenic
1030051118 7:105538477-105538499 TCCTGCAGGCAGGTTGTTGTGGG + Intronic
1030754514 7:113271819-113271841 TCTTGTAGGCAGCAGGTGGATGG - Intergenic
1031156968 7:118121576-118121598 TCCTGCATGCAGATGATTAAAGG - Intergenic
1032655204 7:133921061-133921083 TGCAGCTGGCAAATGGTGGATGG - Intronic
1034487267 7:151373810-151373832 TCCTGATGCCGGATGGTGGATGG + Intronic
1035158732 7:156935456-156935478 GCCTGCAGGGAGGAGGTGGAAGG + Intergenic
1038446865 8:27610653-27610675 TGCTGCAGGCAGCAGGTGGGCGG - Intronic
1041762266 8:61379423-61379445 TCCTGCAGGGACAAGGTGGTTGG + Intronic
1041984879 8:63909642-63909664 ACCTCCAGGCCTATGGTGGAAGG + Intergenic
1045645175 8:104290829-104290851 TCCTGCAGGCGGATGGCAGTCGG - Intergenic
1046118084 8:109808740-109808762 TCCTGTAGGCAGCTGGTATAGGG - Intergenic
1046384484 8:113490586-113490608 TCCTGCAGGGAGATGACTGATGG + Intergenic
1047207705 8:122816994-122817016 CTCTCCATGCAGATGGTGGATGG + Intronic
1047303619 8:123635788-123635810 TGCTGCAGGCAGCTGGGGAAAGG - Intergenic
1047714904 8:127586554-127586576 TCCTGCAGGGAGCTGCTGTAGGG - Intergenic
1048017322 8:130509102-130509124 TCCTGGAGGCAGAGACTGGAGGG - Intergenic
1048521377 8:135158543-135158565 GGATGCAGGGAGATGGTGGAAGG - Intergenic
1048822669 8:138394219-138394241 CCCTGCAGGCAGATTTTGCATGG - Intronic
1049283434 8:141762149-141762171 TCATGCAGGCAGATTGGGGAGGG + Intergenic
1049400647 8:142425456-142425478 ACATGCAAGCAGATGGTGGATGG - Intergenic
1049655898 8:143797136-143797158 TCCTGGAGGCAGAAGGTGAGGGG + Intronic
1051604463 9:18906671-18906693 GCCTGCAGGAGGATGGTGGCAGG - Exonic
1053282066 9:36826912-36826934 CCCTGCAGGCAGGTCCTGGATGG + Intergenic
1056710401 9:88987953-88987975 TCCTGGAAGCAGATGCTGGGAGG + Intergenic
1056832018 9:89924836-89924858 TCCTCCAGGCAGATACTGCAGGG - Intergenic
1057908347 9:98999370-98999392 ACCTGCAGGAAGGTGGTGGGAGG + Intronic
1058702893 9:107615218-107615240 TCATGCAGTCAGGAGGTGGAAGG + Intergenic
1060212355 9:121718291-121718313 GCGTTCAGGCAGATGGTGCAAGG + Intronic
1060881113 9:127118755-127118777 GACAGCAGGCAGATGGGGGAGGG - Intronic
1061883457 9:133579206-133579228 TCCTGCAGGAAGAAGGTGGGGGG + Exonic
1061913792 9:133738618-133738640 TCCAGCAGGCAGGTGGTGCCTGG - Intronic
1062118412 9:134821364-134821386 TCCTGCAGGGACAAGGTGAAGGG + Intronic
1062141182 9:134959956-134959978 CCCTGCAGGCAGGAGGAGGACGG + Intergenic
1062197265 9:135281298-135281320 TCCTGCAGGCTGAGGCTGGGAGG - Intergenic
1062567763 9:137170880-137170902 TCCTGAGGGCAGCTGGGGGAGGG - Intronic
1185781141 X:2847914-2847936 TCCTGCCGGCATCTGGTGGGCGG - Intronic
1185872143 X:3673322-3673344 TCCTGTAGGGAGGTGGTGGCAGG + Intronic
1189257423 X:39651298-39651320 TCCTGCTGGGAGATGGTAGGAGG - Intergenic
1189287499 X:39861822-39861844 TCCTGCAGGGAGATGCTGCTTGG - Intergenic
1190537116 X:51440527-51440549 TCCTGCTGGGGGATGGGGGAGGG - Intergenic
1192152420 X:68720442-68720464 GCCTGCCGGGAGATGGTGCAGGG + Intronic
1192202151 X:69073225-69073247 TCCTGCAGGCAATGAGTGGATGG + Intergenic
1192837835 X:74820859-74820881 ACCTGAGGGCAGAGGGTGGAAGG + Intronic
1194587611 X:95755483-95755505 GCCTGCAGGGGGAAGGTGGATGG - Intergenic
1199618203 X:149675825-149675847 TCCTGCACACAGATGGTTAAAGG + Intergenic
1199624439 X:149727424-149727446 TCCTGCACACAGATGGTTAAAGG - Intergenic
1200154724 X:153969421-153969443 CCCTGCAGGCGGCTGGGGGAGGG - Intronic
1201243692 Y:11982719-11982741 TACTGCTGGCATCTGGTGGATGG + Intergenic
1201453913 Y:14147367-14147389 TCCTGGAGGAACATGGTGGGAGG - Intergenic
1201891306 Y:18946607-18946629 TCCTGCAGGCAGATGGCAGCTGG + Intergenic