ID: 1106118633

View in Genome Browser
Species Human (GRCh38)
Location 13:26838711-26838733
Sequence GTCCCTGCGGACGGAAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106118633 Original CRISPR GTCCCTGCGGACGGAAGTGT TGG Intergenic
902375017 1:16026517-16026539 GGCCCTGCAGAGGGAAGGGTGGG - Exonic
907296932 1:53461338-53461360 GGCCCAGCGGAAGGAAGTGCGGG + Intronic
907544450 1:55247269-55247291 GTCCCTGTGGATGGAAGACTTGG - Intergenic
1063162196 10:3426627-3426649 GCCCCTGGGGACTGAAGTGCAGG - Intergenic
1077318366 11:1929154-1929176 GTCCCTGCCGCCGGAGGTGCAGG + Intronic
1077353093 11:2101848-2101870 GTCCCAGTGGACGTCAGTGTGGG - Intergenic
1079136645 11:17779330-17779352 GTCCCTGAGGACGGAAAAGCGGG - Intronic
1080793402 11:35541038-35541060 GTCCCTGAGGGCAGAAGAGTGGG + Intergenic
1083438103 11:62656905-62656927 GGCCCTGAGAAGGGAAGTGTTGG - Intronic
1085306240 11:75487615-75487637 GTCTCTTGGGACAGAAGTGTTGG - Intronic
1095500311 12:42830307-42830329 GTCCCTGCGGTGGGGAGTGGAGG + Intergenic
1096633998 12:52947169-52947191 ATCCCTGCTGAATGAAGTGTTGG - Intronic
1104058270 12:125246760-125246782 GTTCCTGTGGACAGAAGTGATGG + Intronic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1113619168 13:111701339-111701361 GTCCCTGAGGACGGAAGGCAGGG + Intergenic
1113624697 13:111786600-111786622 GTCCCTGAGGACGGAAGGCAGGG + Intergenic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1132641346 16:979961-979983 GGCACTGCAGACGGAGGTGTGGG + Intronic
1133155690 16:3873957-3873979 GCCCCTGGGGAGGGAAGTGCTGG + Intronic
1136140991 16:28288626-28288648 GTCCCTCAGGACTGAAGGGTCGG - Intergenic
1148644814 17:49213645-49213667 GTCCCTGCGGACCTAACTTTGGG + Intronic
1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG + Intronic
1152070637 17:78132161-78132183 GTGCCTGCGGGCGGAAGGGGTGG - Intronic
1166052028 19:40266083-40266105 GTCCCTGAGGACAGAAGTGAAGG - Intronic
1168291493 19:55359725-55359747 GCCCCTGGGGATGGAAGAGTAGG + Exonic
1168658888 19:58150690-58150712 TTTCCTGCGGAGGGAAGTCTTGG - Intronic
925185102 2:1841855-1841877 GTGCCTGCAGACGGGAGAGTGGG + Intronic
927471253 2:23379350-23379372 CTCCCTGGAGATGGAAGTGTTGG - Intergenic
930372701 2:50524189-50524211 GTCCCTGAGGACGGGTGTGGTGG + Intronic
937096804 2:119240864-119240886 GTCCCTGCGGCCTGAGGTGAGGG - Intronic
937302056 2:120848584-120848606 GACCCTGGGGAGGGAAGAGTTGG + Intronic
948171409 2:235906406-235906428 ACCCCTGAGGACGGAAGTCTTGG - Intronic
1170417940 20:16164356-16164378 GTCCCTGGGGCCAAAAGTGTTGG - Intergenic
1173747163 20:45446624-45446646 AGCCCTGAGGAGGGAAGTGTGGG - Intergenic
1182961144 22:34476393-34476415 GTCCCTGTGGCTGGAAGTGCAGG + Intergenic
1185417898 22:50720165-50720187 TCCCCTGCGGACGGAAGGGCCGG - Intergenic
950397977 3:12748828-12748850 GTCCCTGGGGTGGGAAGGGTGGG - Intronic
959497373 3:107067224-107067246 GTCCATGTGGGTGGAAGTGTTGG + Intergenic
967891931 3:194369788-194369810 GTCACTGCAGAGGGCAGTGTTGG + Intergenic
974758273 4:66241874-66241896 GTCCCTGTAGTTGGAAGTGTAGG - Intergenic
979479483 4:121199829-121199851 GTACCTGAGGACGGTTGTGTAGG + Intronic
985949427 5:3212077-3212099 GTCCCTGCGGAAGTGTGTGTGGG + Intergenic
989161222 5:38393659-38393681 GTCCTTGCGGGAGGAAGAGTTGG + Intronic
990365855 5:55069648-55069670 CTCCCTGGGGATGAAAGTGTGGG - Intergenic
1003041720 6:2694232-2694254 GTCCCTGCAGAGGGAAAAGTAGG - Intronic
1008935888 6:56991830-56991852 GTACCTGTGGAGGGGAGTGTGGG - Intronic
1015371328 6:132456914-132456936 GCCACTGCAGACAGAAGTGTAGG + Exonic
1016974483 6:149793633-149793655 CTCCCTGAAGACAGAAGTGTTGG - Exonic
1019727556 7:2611444-2611466 GTCCCCGTGGACGGAAGCCTTGG - Exonic
1029457327 7:100677854-100677876 GCCCCTGAGGCAGGAAGTGTGGG - Intronic
1029494924 7:100891335-100891357 ATCCCTGCGGAAGGAAGGGAAGG + Exonic
1034268300 7:149791572-149791594 GGCCCTGCAGCCGGACGTGTGGG + Intergenic
1037861997 8:22412020-22412042 CTCCCTCCGCACGGCAGTGTGGG + Intronic
1037946493 8:22992902-22992924 GTCCCTGCTGGCAGAGGTGTGGG - Intronic
1039842862 8:41306509-41306531 GTCCCTGTGGAGGGGAGGGTGGG - Intronic
1044157340 8:88863779-88863801 GTCCCTACAGAAGGAAGTGTAGG - Intergenic
1044794652 8:95884788-95884810 TTCCCTGAGGACAGTAGTGTCGG + Intergenic