ID: 1106118848

View in Genome Browser
Species Human (GRCh38)
Location 13:26840663-26840685
Sequence TGCCTGGCTCGTTATGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106118848_1106118853 27 Left 1106118848 13:26840663-26840685 CCAGAATCATAACGAGCCAGGCA 0: 1
1: 0
2: 1
3: 12
4: 67
Right 1106118853 13:26840713-26840735 AAACATGAGCCAAAGTGTTCTGG 0: 1
1: 0
2: 0
3: 20
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106118848 Original CRISPR TGCCTGGCTCGTTATGATTC TGG (reversed) Intergenic
906357242 1:45117159-45117181 TACCTTGCTCCTTCTGATTCGGG - Intronic
906612933 1:47215846-47215868 TGCCTGGCTCTTAAGGATTGGGG - Intergenic
906824987 1:48969726-48969748 TGCTTGTCTAGTTATCATTCTGG - Intronic
907300302 1:53482736-53482758 TGCCTGGCTCGTCCTCATTCTGG + Intergenic
907544015 1:55243576-55243598 TGCATGTCTTGTTATCATTCAGG + Intergenic
910439831 1:87240840-87240862 TTCCTGGTTCGTTGTGACTCAGG + Intergenic
920012805 1:202881790-202881812 TCCCCGGCTCATTATGCTTCAGG + Intronic
920705924 1:208250457-208250479 TGCCTGATTCGTGATGAGTCTGG - Intergenic
922565329 1:226597864-226597886 TGCCTGGTTTGCTCTGATTCTGG - Intronic
923864091 1:237920171-237920193 TGCCTGGCTCCTTATTAATCAGG + Intergenic
1074240306 10:111632178-111632200 TGCCTGGCTCTTAATGACCCTGG - Intergenic
1087174389 11:95082661-95082683 TGCTTGGCTCTCTATTATTCAGG - Intergenic
1088629726 11:111763148-111763170 TGGCTGGCTCCTTGTCATTCAGG - Intronic
1090828001 11:130401441-130401463 TCCCTGGCTCGTTCTTCTTCAGG - Intergenic
1091347219 11:134863604-134863626 TTCCGGGCTCGTGATGACTCTGG - Intergenic
1105545230 13:21346395-21346417 TGCATGGACAGTTATGATTCTGG + Intergenic
1106118848 13:26840663-26840685 TGCCTGGCTCGTTATGATTCTGG - Intergenic
1109699395 13:66005960-66005982 TTCCTGGCTCATTGTGTTTCTGG - Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1120855947 14:89212607-89212629 TGGCTGGCTCCTTAGGATTCTGG + Intronic
1125006292 15:34821542-34821564 TGTCTGGCTCCTTAGCATTCTGG + Intergenic
1126168273 15:45672227-45672249 TGTCTGGTTCTTTAAGATTCTGG + Intronic
1126696350 15:51329311-51329333 TGCCTGGCTCCTGCTGAGTCTGG - Intronic
1128817986 15:70628443-70628465 TGCCAGGCTCGTGATCATGCAGG - Intergenic
1129450475 15:75648438-75648460 GGCCTGGCTCGTTGTGAAGCCGG + Exonic
1131971327 15:97896347-97896369 TGACTTGCTCTTTAAGATTCTGG - Intergenic
1135091417 16:19521224-19521246 TGCCTGGCTCCTTATAATTCCGG + Intronic
1139074097 16:63422095-63422117 AGACTGGGTCTTTATGATTCAGG + Intergenic
1139434227 16:66926845-66926867 GGCCTGGCTCGGTAAGATTAGGG + Intergenic
1149370430 17:55988762-55988784 CTCCTGGTTCTTTATGATTCAGG - Intergenic
1153628995 18:7050966-7050988 TGCCTGGCTTGTATTGATTCTGG - Intronic
1157054539 18:44210945-44210967 TCCCTGGCTAGTTATGTTCCTGG + Intergenic
1161149429 19:2699909-2699931 TGCCTGGGTCATTCTGATTAGGG - Intronic
1162580830 19:11529243-11529265 GGCCTGGCTCGTTATGAGGCGGG - Intergenic
1168087014 19:54055646-54055668 TGCCTGACTTGTAATGGTTCTGG + Intronic
929459939 2:42096112-42096134 TTCCTTGCTAGTTATGATTTTGG - Intergenic
931370711 2:61660160-61660182 TGCCTGGCTCTTTATCTTTCAGG + Intergenic
932766592 2:74474535-74474557 TCCCAGGCTCCTTAGGATTCAGG + Exonic
935671112 2:105557853-105557875 TGCCTGGCTACTCATGAGTCTGG + Intergenic
937434602 2:121870033-121870055 TGCCTGGATCTTTGTCATTCAGG + Intergenic
938063562 2:128269549-128269571 TGCCAGGCTCGCTATGACGCTGG + Intronic
944456047 2:199895831-199895853 TGCCTGATTCATTTTGATTCTGG + Intergenic
948635960 2:239337763-239337785 TGCCTGGCTCGCTCTGTTCCTGG - Intronic
1177602173 21:23329936-23329958 TGCCTCGCTCTTTAAGATTTGGG - Intergenic
1181325567 22:22043220-22043242 GGCCTGGCTCATTATGACTCTGG - Intergenic
1181920669 22:26317928-26317950 TGCCTGGCCCTTCATGATTTTGG - Intronic
1182426131 22:30273775-30273797 TGCCTGGCTCTGTAGGGTTCTGG - Intergenic
1183311471 22:37112187-37112209 TGTCAGGCTGGTTAGGATTCTGG + Intergenic
951644351 3:24871855-24871877 TGCCTCGCTAGTAATCATTCAGG + Intergenic
960356836 3:116663971-116663993 TGCCTGAATCATTAAGATTCAGG - Intronic
966834599 3:184039194-184039216 TCCCTGGCTCCTCAGGATTCAGG + Exonic
969298913 4:6285753-6285775 AGCCTGGCACGGTATGGTTCTGG + Intronic
976275218 4:83269903-83269925 TGCCTGCCTCTTTATTTTTCTGG - Exonic
981197950 4:141942687-141942709 TGAGTAGCTCTTTATGATTCTGG - Intergenic
984680283 4:182600087-182600109 TGTCAGACTCTTTATGATTCTGG + Intronic
991126299 5:63073368-63073390 TGGCTGGCTCCTTCTTATTCTGG + Intergenic
993167928 5:84382390-84382412 TGCCTGGCTGGGTCTGATTGAGG - Intronic
999464441 5:151788773-151788795 TGCCTGGCTCTTTTTTTTTCTGG + Intronic
1002124966 5:177036048-177036070 TGGCTGGATAGTTCTGATTCAGG + Intronic
1003279949 6:4682641-4682663 TGGCTGGCTCCTTATCATTCCGG - Intergenic
1003406405 6:5830124-5830146 TGCATGGACAGTTATGATTCTGG - Intergenic
1005971281 6:30763898-30763920 TGCATGGCTCTTTGTGATTTAGG + Intergenic
1008905352 6:56671769-56671791 TGACTTGCTCATTCTGATTCTGG - Intronic
1009836470 6:69007582-69007604 TGGCTGTCTCTTTATTATTCTGG + Intronic
1011499054 6:87967720-87967742 TTCCAGGCTCGTTATGATGAGGG - Intergenic
1014661548 6:124178790-124178812 TGACTGGCCAGTTTTGATTCAGG + Intronic
1021143349 7:17054316-17054338 TGACTGGCTCTTTATCATTCGGG + Intergenic
1023262744 7:38374447-38374469 TGCTTGGCTGTTTATGATTCAGG + Intergenic
1027701311 7:81473143-81473165 TGCCTGGATAGTTGTGCTTCTGG - Intergenic
1030295223 7:107918532-107918554 TGGCTGGCTCCTTATTATTCAGG + Intronic
1032480161 7:132239622-132239644 TGCCTGGCAAGGTATCATTCAGG + Intronic
1032490965 7:132323986-132324008 TGCCTAGCTCGGTATGGTCCAGG - Intronic
1033545271 7:142394023-142394045 TGCCTTTATCTTTATGATTCTGG - Intergenic
1037185935 8:16063680-16063702 TGCCTGGGTCATTATGGTTCTGG + Intergenic
1040643976 8:49377097-49377119 TGCCTGGCCCATTTTGACTCTGG - Intergenic
1040974021 8:53170052-53170074 TGACTGGGTCTGTATGATTCTGG - Intergenic
1050768815 9:9170876-9170898 AGGCTGGCTCATTATCATTCTGG - Intronic
1060240573 9:121898953-121898975 TGCCTGGCTCCTGATAACTCGGG + Intronic
1061398634 9:130356609-130356631 TGCCTAGCTCCTTATCTTTCAGG + Intronic
1061662959 9:132142513-132142535 TGTGTGGCTGGTTATTATTCGGG - Intergenic
1189205876 X:39238402-39238424 TGCCTGGACCATTATGATACTGG + Intergenic