ID: 1106119841

View in Genome Browser
Species Human (GRCh38)
Location 13:26851119-26851141
Sequence CTTGTTGGACACATCTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106119840_1106119841 -10 Left 1106119840 13:26851106-26851128 CCTCTTGGAGAGTCTTGTTGGAC 0: 1
1: 0
2: 1
3: 9
4: 87
Right 1106119841 13:26851119-26851141 CTTGTTGGACACATCTGACATGG 0: 1
1: 0
2: 2
3: 17
4: 113
1106119838_1106119841 -7 Left 1106119838 13:26851103-26851125 CCTCCTCTTGGAGAGTCTTGTTG 0: 1
1: 0
2: 0
3: 17
4: 114
Right 1106119841 13:26851119-26851141 CTTGTTGGACACATCTGACATGG 0: 1
1: 0
2: 2
3: 17
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106119841 Original CRISPR CTTGTTGGACACATCTGACA TGG Intergenic
901436409 1:9249731-9249753 CCTGCTGGCCACCTCTGACAAGG - Intronic
904583661 1:31566588-31566610 CTTGTTGGACGGATCTGACTGGG + Intergenic
907592867 1:55692397-55692419 CATATTAGACACAGCTGACAAGG - Intergenic
912014532 1:105016578-105016600 CTTCTTGGACTCATCAGAGATGG - Intergenic
917735424 1:177915734-177915756 CTTGTTGGACACAGAGGCCAAGG - Intergenic
919459027 1:197854806-197854828 CATGTTGGACAGAAATGACAAGG + Intergenic
919617041 1:199820741-199820763 ATTGTTGGTCACAACTGAAAGGG - Intergenic
921502119 1:215917613-215917635 CTTGTTGGATACATTCAACAAGG - Intronic
922881912 1:228987524-228987546 CATGATATACACATCTGACAGGG + Intergenic
1063248757 10:4251403-4251425 CTTCCTGGACACCTCTGACCAGG - Intergenic
1063551228 10:7035476-7035498 CTTTCTGGATACATCTGATACGG - Intergenic
1063919850 10:10921566-10921588 TCTTTTGGAAACATCTGACATGG - Intergenic
1066103895 10:32140295-32140317 CTTGTTGGGCACATGTCACCAGG - Intergenic
1066590132 10:36985653-36985675 CTTGTTCCACACATCTCTCAAGG + Intergenic
1067712487 10:48660922-48660944 CTTGTTGTACACAGCTAACATGG + Intergenic
1067941806 10:50662817-50662839 CTTGTTGAACTTCTCTGACATGG - Intergenic
1069039330 10:63678494-63678516 GTTATTTGACACATCTGCCAGGG - Intergenic
1070863053 10:79687775-79687797 CTTGTTGAACTTCTCTGACATGG - Intergenic
1071676622 10:87660894-87660916 CTTGCTGACCACATCTGACGTGG - Intronic
1075967837 10:126628184-126628206 CTTATTGGACAAATGAGACAAGG + Intronic
1076005678 10:126946811-126946833 CTTGATGGACACTTGTGACATGG + Intronic
1078118211 11:8477423-8477445 GATGTTTTACACATCTGACATGG - Intronic
1078559199 11:12356185-12356207 TTTTTTGGATACATCTGACAGGG - Intronic
1079146593 11:17857784-17857806 TTTGTAGGCCACAGCTGACAAGG - Intronic
1081162639 11:39768912-39768934 CTTGTTGTACACATTGTACATGG - Intergenic
1081699471 11:45144085-45144107 ATTGTTGGAAACATCTCAGAAGG - Intronic
1086345327 11:85890369-85890391 CTTGCTGGAGACAGCTGACTAGG + Intronic
1091026346 11:132144821-132144843 CTTGTTGGACACCTGTGCCAAGG + Intronic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1091308772 11:134558454-134558476 CTCGTTGGACTGATCTGAAATGG - Intergenic
1093428246 12:19053771-19053793 TTTTTTGGACACAGATGACAAGG - Intergenic
1094002942 12:25715914-25715936 CATGTTGGAAACACCTGTCAAGG - Intergenic
1095615894 12:44188023-44188045 CTTCTAGGACACATTTGAAAGGG + Intronic
1095988413 12:48016424-48016446 CTTGTTGGACCCAGCTAACTGGG + Intergenic
1098568181 12:71958569-71958591 GTTGTTGGGGACATCTGCCAGGG + Intronic
1098840561 12:75472721-75472743 CTTGTTAAACTCATCTAACAGGG - Intergenic
1104709343 12:130974517-130974539 CTCGCTGAACACATCTGAAAAGG - Intronic
1106119841 13:26851119-26851141 CTTGTTGGACACATCTGACATGG + Intergenic
1117627925 14:57659225-57659247 CTAGTTGGTCACATGTGAAAAGG + Intronic
1117775999 14:59185186-59185208 CTTGTTGGACTGGTCTGTCATGG - Intergenic
1118096736 14:62545813-62545835 CCTGTTGGAATTATCTGACAAGG + Intergenic
1120566090 14:86059184-86059206 CTTATTGGAAAAATCTGACCTGG - Intergenic
1125985334 15:44045238-44045260 CTTCCTGGACACATCTGACTGGG - Intronic
1127675815 15:61237788-61237810 CTTGTTGGAGAAATCAGAGAAGG + Intergenic
1129728528 15:77916339-77916361 CCTGTTGGTCACAGGTGACAAGG + Intergenic
1142542206 17:668618-668640 CTTTTTCGACACAGCTCACATGG + Intronic
1142733513 17:1879648-1879670 CTTGATGGACACATCCGGGAAGG + Exonic
1143384310 17:6518302-6518324 CATGTTGGACACATTCCACAGGG - Intronic
1149667199 17:58373329-58373351 ATTGTAGGATACCTCTGACAAGG + Intronic
1156445604 18:37234656-37234678 CCTTTTGAACACATCTGACCAGG + Intergenic
1158973766 18:62692279-62692301 CTTGTTGGATACCCCTGAAAAGG + Intergenic
1161786246 19:6327665-6327687 CTTGTGGGACACATGATACAAGG - Intronic
1162688286 19:12406515-12406537 CTTGTTGAACATATTTGAGACGG - Intronic
1166179403 19:41096205-41096227 CTTTTTGAACAAAGCTGACACGG - Intergenic
1167744407 19:51342182-51342204 CCTGTTGGACTCGTCTGACCCGG - Intergenic
925010466 2:481539-481561 CTTTATGGACAAATCTGACGGGG + Intergenic
928224384 2:29435402-29435424 CTTGTTGGTGGCATCTGGCAGGG - Intronic
928449001 2:31361244-31361266 CTTGAAGGCAACATCTGACATGG - Intronic
929742455 2:44617022-44617044 CACGTAGGACACATGTGACAAGG - Intronic
932209390 2:69914902-69914924 CTGGTTGGTCACACTTGACAAGG - Intronic
933674614 2:85043555-85043577 CATATTGGACAAATCTGAAATGG - Exonic
936433352 2:112482616-112482638 CTTGTCGGGCACATCAGAAACGG + Intronic
937528982 2:122806047-122806069 CTTATTGGACATATCTGATGGGG + Intergenic
940064237 2:149608960-149608982 CTTTTTGGTCACATCTCCCATGG + Intergenic
940345298 2:152622414-152622436 CTTCTTGGACACATTTCACAAGG - Intronic
941524623 2:166591897-166591919 CATATTAGACATATCTGACAAGG - Intergenic
946723995 2:222642993-222643015 CTTGTTTTAGACATCTGAGAAGG - Exonic
948080808 2:235203698-235203720 CATGTGGGACACAGGTGACATGG + Intergenic
1169709315 20:8543636-8543658 CCTGTTGGACACATCTGATACGG + Intronic
1172371210 20:34393613-34393635 CTTATTGGCAAAATCTGACATGG - Intronic
1174337320 20:49872213-49872235 CCTGTAAGACACACCTGACATGG - Intronic
1177218977 21:18166223-18166245 CTTGTGGGGCACATGTGGCAAGG - Intronic
1177295679 21:19171804-19171826 TTTGTTGAACTCACCTGACAGGG + Intergenic
1178120612 21:29466415-29466437 CTTATTTCACCCATCTGACACGG - Intronic
1181974994 22:26722608-26722630 CTGTTTGGACACATCTGGGATGG - Intergenic
1182059559 22:27387525-27387547 CTCATTGGCCACATATGACAAGG + Intergenic
1182208927 22:28657305-28657327 CTTGTTGAACACAGTTTACATGG + Intronic
1182706772 22:32287276-32287298 CTCCTTGGCCACATCTGAAATGG - Intergenic
1183226924 22:36556827-36556849 CTTGTGGGACTCATCTCAAAGGG + Intergenic
955451323 3:59070082-59070104 CTTCTTGGCCACATCTGAAAAGG + Intergenic
955907145 3:63818920-63818942 CCTGTGGGACACATATGACAAGG - Intergenic
956365397 3:68496551-68496573 CTGGATGGACACATCTAAGATGG - Intronic
956756464 3:72393013-72393035 CTTGTTGGAAACTTTTTACAAGG - Intronic
958057765 3:88435013-88435035 CTCCTAGGCCACATCTGACATGG - Intergenic
958632100 3:96698102-96698124 CTTGTTGGACAGATGTGGTATGG + Intergenic
960867404 3:122215825-122215847 CTTGTTGGTCACTTCTGACATGG - Intronic
962917766 3:139921045-139921067 CATGATGGCCAAATCTGACAAGG - Intergenic
970538486 4:17054341-17054363 GTTGGTGGAACCATCTGACAGGG + Intergenic
972335108 4:38100912-38100934 CTTGTTTGACATTTCTGACATGG + Intronic
974195469 4:58568867-58568889 CTTGAGGGCCACATCTTACATGG - Intergenic
978304609 4:107312233-107312255 CATGTTGGTCAAATCTGACATGG + Intergenic
978949727 4:114543500-114543522 CTGGTTGGGCAAATCTGAGAAGG + Intergenic
979693001 4:123580603-123580625 CTTGTAGGAAACATCTGATAAGG + Intergenic
981112425 4:140951116-140951138 CTTGTTGGATACATCTAGGAAGG - Intronic
981378767 4:144046972-144046994 TTTGTTATACACTTCTGACACGG + Intergenic
983448590 4:167882722-167882744 GATATTGGAAACATCTGACAAGG - Intergenic
984751710 4:183283958-183283980 CTTGTTGGACAGATATCACACGG + Intronic
988168376 5:27623938-27623960 CTTGTTGTGCACCTCTGTCATGG + Intergenic
988307688 5:29514264-29514286 CTTGTTGCACACGTCTTACCTGG + Intergenic
990406803 5:55499721-55499743 CTTCTTGGACATATATGAGAAGG - Intronic
993239652 5:85365717-85365739 ATTGATGGACATATCTGAAAGGG - Intergenic
993370004 5:87081333-87081355 TTTGTTGGATACAACTGAAAGGG - Intergenic
995598525 5:113772583-113772605 ATAGTTGGATACATCTGTCAAGG - Intergenic
997195652 5:131977454-131977476 CCTGCCGGACAGATCTGACAGGG + Intronic
999697637 5:154200424-154200446 CAGGTTGGAAACATCTGGCAGGG + Intronic
1002132302 5:177089051-177089073 CTGGGTGGTCACAACTGACAAGG - Intronic
1006806928 6:36794589-36794611 CCCGTTGGACACAGCTGGCATGG + Exonic
1008508154 6:52251179-52251201 CTCTTTGGTCACATCTGACATGG - Intergenic
1015273481 6:131360555-131360577 CTTGTTGTAGACATCTGTTATGG - Intergenic
1017088860 6:150740528-150740550 TTTATTGGACACTTCTTACAAGG + Intronic
1021577801 7:22120304-22120326 CTTGGTGGGCATATCTGACTTGG + Exonic
1022970285 7:35510794-35510816 CTTGATGGACAGATGTGGCAAGG + Intergenic
1024218649 7:47269599-47269621 TTTGCTGGACACAGCTTACATGG + Intergenic
1033332174 7:140425964-140425986 CGTTTTGGAGACATCTGCCAAGG + Exonic
1033585192 7:142769594-142769616 CTTGCTGGAGAAATCGGACATGG - Intergenic
1034843513 7:154421763-154421785 CTTGTTTGACTCAACTGACTGGG - Intronic
1035324633 7:158056967-158056989 CTTGATGGACACATCCGAGGTGG - Intronic
1039190333 8:34966418-34966440 CTCTTTGGACACATCTGAAAAGG + Intergenic
1042065663 8:64872794-64872816 CTTGTTTGTCACATTTAACAGGG - Intergenic
1046632059 8:116631128-116631150 CTTGTTGGTAACCTCTGCCATGG + Intergenic
1046681625 8:117177057-117177079 CTTGATTGACACTTCTGAAAGGG - Intergenic
1051962441 9:22784212-22784234 CTTCTTGGCCACATCTGAAAAGG - Intergenic
1056036667 9:82613690-82613712 CTGGCTGCCCACATCTGACAAGG + Intergenic
1056303756 9:85269181-85269203 ATTATTTGACACATCTCACATGG - Intergenic
1057388328 9:94623410-94623432 CTCTTTGGACACATGTGAAAGGG - Intronic
1058672914 9:107375751-107375773 CTTCTTGGACACCTCTGTCTGGG + Intergenic
1059936986 9:119321362-119321384 CTTGATAGACACATGTGACCAGG - Intronic
1062196417 9:135276616-135276638 CTGCTCGGAAACATCTGACAAGG + Intergenic
1194249257 X:91553420-91553442 CTTGTTTGACATAGCTAACAAGG + Intergenic
1195911245 X:109890429-109890451 CCTCTTGGACAGAGCTGACATGG + Intergenic
1197784198 X:130184554-130184576 CTTGTTTGAGACATCGGCCAAGG + Exonic
1199331221 X:146562021-146562043 TTTGTTGCCCACATCTAACAGGG - Intergenic
1200568213 Y:4794650-4794672 CTTGTTTGACATAGCTAACAAGG + Intergenic