ID: 1106120965

View in Genome Browser
Species Human (GRCh38)
Location 13:26859894-26859916
Sequence CCATGACCACACACAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106120965_1106120969 -2 Left 1106120965 13:26859894-26859916 CCACCCTCTGTGTGTGGTCATGG 0: 1
1: 0
2: 2
3: 20
4: 217
Right 1106120969 13:26859915-26859937 GGAATTGACCACAAAATCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106120965 Original CRISPR CCATGACCACACACAGAGGG TGG (reversed) Intergenic
900397803 1:2460364-2460386 CCATGCCCACACACAGCAGGTGG + Intronic
902632437 1:17713153-17713175 CATTGGCCACACACAGTGGGTGG - Intergenic
903284642 1:22268943-22268965 CAATGACCACAATCAGATGGTGG - Intergenic
904344669 1:29859969-29859991 CCATAACCACCCTGAGAGGGAGG - Intergenic
907243914 1:53095186-53095208 GCATGAGCACACACAGACGCAGG + Intronic
907427290 1:54388418-54388440 CCATGCCCACACACAGTGCCTGG + Intronic
907677512 1:56532278-56532300 CCAAGACCACCAACAGAGAGAGG - Intronic
908594996 1:65678452-65678474 CCTTGAACAAACACAGATGGTGG + Intergenic
911063905 1:93770605-93770627 CCATGAACATACAGAGGGGGTGG + Intronic
911094204 1:94042637-94042659 CAATGACTACACTCAGAAGGGGG - Intronic
911912231 1:103651400-103651422 CCCTGAGCAGACACAGAGGCAGG - Intergenic
911916223 1:103700548-103700570 CCCTGAGCAGACACAGAGGCAGG + Intronic
911919646 1:103745538-103745560 CCCTGAGCAGACACAGAGGCAGG - Intronic
912500509 1:110119031-110119053 CCCTGCCCACATTCAGAGGGAGG + Intergenic
916337342 1:163688016-163688038 CCATGGCCACACACTAATGGAGG + Intergenic
918530294 1:185512565-185512587 CCAGAACCACACACAGTGGAAGG - Intergenic
920070097 1:203296542-203296564 CCCTGACCACACAGCCAGGGTGG + Intergenic
920451045 1:206061459-206061481 CCTAGACCCCACACAGAGGGTGG + Intronic
921158308 1:212454887-212454909 CCATGGCATCACCCAGAGGGAGG + Intergenic
921311881 1:213852720-213852742 CAATGAACACACACAGAGAAAGG + Intergenic
923226103 1:231940178-231940200 TCTTTACCACACACAGAGAGAGG - Intronic
923601600 1:235408097-235408119 CCATTACCACAGACACAGGCTGG - Intronic
923959488 1:239061024-239061046 CCCTGAACAGAGACAGAGGGAGG - Intergenic
924364746 1:243280108-243280130 CCATGAAAACTCACAGAGGGAGG - Intronic
924931152 1:248733446-248733468 CCATGACAACCCATAGAGGTAGG - Intronic
1064121728 10:12624879-12624901 CCATGCCTACACACAATGGGTGG + Intronic
1065723975 10:28652661-28652683 CAATGAGCACACAGCGAGGGTGG + Intergenic
1067848078 10:49738698-49738720 CCATGACCACACAGCCAGGCAGG + Intronic
1070584104 10:77748082-77748104 CCATGATAACACACTGAGGATGG - Intergenic
1070628694 10:78069129-78069151 CCATGCCCCCACACAGAAGGTGG - Intergenic
1070636200 10:78130081-78130103 CCAGGACCACAGGCAGAGGTGGG + Intergenic
1075725116 10:124607026-124607048 ACACGGCCACACACGGAGGGAGG - Intronic
1076755896 10:132571457-132571479 CCAGAACCACACACAGCGGCAGG - Intronic
1076816846 10:132919250-132919272 CCCTTCCCACACCCAGAGGGCGG + Intronic
1077543103 11:3156914-3156936 CCATGGCCCCACACAGGGTGGGG + Intronic
1079098695 11:17527331-17527353 CCTTGACCACAGAGAGAGGCAGG + Exonic
1079227291 11:18618169-18618191 CTTTGACCACACACAAAGGCTGG + Intronic
1080752783 11:35166231-35166253 CCATGGCAACACACAGGGGTGGG + Intronic
1083651316 11:64206463-64206485 CCCTGAACACACACAGCCGGGGG + Intergenic
1083759464 11:64807774-64807796 CCATCACCACCCACATAGGAAGG - Intronic
1084686690 11:70700320-70700342 CCATGACCACCCAGGGAGTGGGG + Intronic
1085928215 11:81047804-81047826 CAATGACCAAACACAATGGGAGG + Intergenic
1086303985 11:85460081-85460103 CCAAGAGCACAGACAGGGGGTGG + Intronic
1088109936 11:106249509-106249531 CAGTGAACACACTCAGAGGGTGG + Intergenic
1089459681 11:118645271-118645293 GCAGCACAACACACAGAGGGAGG - Intronic
1091968224 12:4763698-4763720 CCATCACCACACACACAGGGAGG - Intronic
1092526297 12:9312230-9312252 CCATCACCACACACGTGGGGGGG - Intergenic
1092540975 12:9419560-9419582 CCATCACCACACACCTGGGGGGG + Intergenic
1096994383 12:55829772-55829794 CCATTCCCACACGCGGAGGGAGG - Intronic
1101073015 12:101096448-101096470 CCCTCCCCACACACACAGGGTGG - Intronic
1101480382 12:105090746-105090768 CCCTGAACAGAGACAGAGGGAGG - Intergenic
1103021461 12:117538067-117538089 CCATGACCACCCACACCTGGGGG - Intronic
1103023223 12:117553498-117553520 CAATGGCAACACACAGAGAGAGG - Intronic
1103659181 12:122500303-122500325 CCACGACCTCAAACAGAGGGGGG + Exonic
1104038719 12:125115732-125115754 CCATGACCTCACACAGGTGCAGG + Intronic
1106120965 13:26859894-26859916 CCATGACCACACACAGAGGGTGG - Intergenic
1106217715 13:27718121-27718143 TCATGACCACACTCAGAGACAGG + Intergenic
1107349772 13:39501734-39501756 CCATGACCACACTAAGAGCAGGG - Intronic
1109786460 13:67182010-67182032 CCATGCCCACATTCAGAGGCAGG - Intronic
1111532122 13:89551106-89551128 CCATGAACACACCCAAAGGAAGG + Intergenic
1111901009 13:94199818-94199840 CCTTGACCACACACAGAAACTGG + Intronic
1113237831 13:108300924-108300946 CTATTACCATAGACAGAGGGAGG - Intronic
1115731398 14:36273228-36273250 CAATGACCACACACCTACGGAGG + Intergenic
1117833643 14:59779444-59779466 CCATGACCACACACAGGTAATGG + Intronic
1118319366 14:64744034-64744056 CCATGGCCACAGCCAGATGGAGG + Exonic
1119201186 14:72754055-72754077 CAAAGGCCACACACACAGGGTGG - Intronic
1119647676 14:76360125-76360147 CCATGCTCACTCAGAGAGGGAGG - Intronic
1120395476 14:83962304-83962326 CCCTGTGCACAGACAGAGGGAGG + Intergenic
1120407730 14:84109803-84109825 CCTTGACCACTCACAGAGTAAGG + Intergenic
1122713616 14:103679392-103679414 CAATGTTCACAAACAGAGGGTGG + Exonic
1123800216 15:23811299-23811321 CCATGAGCTAAGACAGAGGGAGG - Intergenic
1124204230 15:27703604-27703626 CCATGACCAGAGGCAGAGGAAGG - Intergenic
1124584639 15:30993238-30993260 CCATGTCCTCACACAGTGCGGGG + Intergenic
1125396699 15:39256402-39256424 CAAGAACCACACACAGAGGAGGG - Intergenic
1127862662 15:63007269-63007291 TCATGGAGACACACAGAGGGAGG + Intergenic
1128765729 15:70250050-70250072 ACAAGCCCACACACAGAAGGGGG - Intergenic
1130017164 15:80196481-80196503 TCATGACCAGCCACAGAAGGGGG + Intergenic
1130111914 15:80972454-80972476 CCATGACCATCCAGGGAGGGTGG + Intronic
1131158779 15:90091047-90091069 CCATGAACGCACACACAGTGTGG + Intronic
1132648716 16:1010797-1010819 CCATGTGGACACACAGTGGGCGG - Intergenic
1134440743 16:14298442-14298464 CCAGGCCCGCACAGAGAGGGTGG - Intergenic
1134563058 16:15227330-15227352 CCATCTCCACACACAAAGAGAGG + Intergenic
1134923592 16:18138963-18138985 CCATCTCCACACACAAAGAGAGG + Intergenic
1135775475 16:25254189-25254211 CCAAGATCACAGACAGAAGGTGG + Intronic
1136298697 16:29318820-29318842 CCATGACCACAGCCAGCGGCTGG + Intergenic
1138091192 16:54176049-54176071 CCATGAGCAAACAGAGAGGGGGG - Intergenic
1139382676 16:66543522-66543544 CCAGGGGCACACACAGAGAGGGG + Intronic
1141759802 16:86020655-86020677 CCAGGGTCACACACAGAGTGTGG + Intergenic
1142060359 16:88025317-88025339 CCATGACCACAGCCAGCGGCTGG + Intronic
1142244046 16:88960740-88960762 ACATGACCAAACCCAGAGGCGGG - Intronic
1142268364 16:89076558-89076580 GCATGAGCACACACAGACAGTGG - Intergenic
1142289939 16:89189261-89189283 ACATGCCCACACACAGATGCCGG + Intronic
1146284742 17:31566841-31566863 CCATCACCAGACACAGAAGGAGG - Intergenic
1146946280 17:36875939-36875961 CCAAGACCAGACCCAGATGGAGG + Intergenic
1147545845 17:41401095-41401117 CCATGACCTCACACAGGCGAGGG + Intergenic
1147685964 17:42287136-42287158 CTGTGACCACACAGAGAAGGTGG + Intergenic
1148713126 17:49696426-49696448 CCATGACAAAACACAGAAGTGGG + Intergenic
1151896294 17:76982997-76983019 ACATGACCCCACCCAGGGGGTGG + Intergenic
1155275616 18:24184720-24184742 CCATCACCTCACAGAGAGAGGGG + Intronic
1155376347 18:25162118-25162140 TCATGATCACATACAGAGGAAGG - Intronic
1157272292 18:46285405-46285427 TCATGACCACACAGAGAGCATGG - Intergenic
1157465235 18:47938390-47938412 ACAGGACCACATACTGAGGGAGG + Intergenic
1157689608 18:49670338-49670360 CCATGACAACACTGTGAGGGAGG - Intergenic
1157786207 18:50485237-50485259 CCAGGACCACACACTGATAGAGG + Intergenic
1158622155 18:59042261-59042283 GCATGCCCACACACACAGCGAGG + Intergenic
1160715124 19:572947-572969 TCACGCCCACACACAGAGGCCGG - Intronic
1161664086 19:5564498-5564520 CCCTGACCACACACACAGCTGGG - Intergenic
1161767286 19:6214651-6214673 CTATGACCACACACAGAGCCTGG + Intronic
1162124059 19:8489968-8489990 CCCTGACCAAACACAAAAGGGGG - Intergenic
1162301677 19:9848310-9848332 CCAGGGCCACACAGGGAGGGGGG + Intronic
1163953552 19:20613179-20613201 CCAGGGCCACATCCAGAGGGGGG + Intronic
1164478867 19:28596212-28596234 CCATGACAACTGAAAGAGGGAGG + Intergenic
1164542123 19:29128985-29129007 ACATGAGGACACACAGAGGAAGG + Intergenic
1164542204 19:29129423-29129445 ACATGAGGACACACAGTGGGAGG + Intergenic
1165008839 19:32828427-32828449 TCATGGCCACACCCAGAGGCTGG + Intronic
1165016905 19:32887975-32887997 CCAGGCCCTCACACAGTGGGTGG - Intronic
925413658 2:3654962-3654984 CACTGACCACAGACACAGGGAGG - Intergenic
925426537 2:3753362-3753384 CCATAAACACACACACAGTGTGG - Intronic
925569049 2:5289349-5289371 CCATGCCCACACACATAGCTAGG + Intergenic
928136112 2:28688681-28688703 CCACAACCACACTCAGAGGTAGG - Intergenic
929037783 2:37711319-37711341 CCCTGAAGACACCCAGAGGGAGG + Intronic
929602347 2:43212331-43212353 CCAGGCCCTCACAAAGAGGGCGG - Intergenic
930019767 2:46994428-46994450 CCATGAACTCAGGCAGAGGGTGG - Exonic
930470619 2:51807374-51807396 CCATGACCACACCCAGCAGTCGG + Intergenic
934101484 2:88657373-88657395 TCATGACTACACAGAGTGGGTGG + Intergenic
934639660 2:96020104-96020126 CATTGACCACACACAGTGAGGGG + Intergenic
934793986 2:97085273-97085295 CATTGACCACACACAGTGAGGGG - Intronic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
935422896 2:102888001-102888023 CCATCACCACGCACAGAGTGTGG + Intergenic
937426007 2:121799433-121799455 CAATGACCAGACACAAAGGCAGG - Intergenic
938401610 2:130997182-130997204 CCATCAACACACACAAAAGGGGG - Intronic
938581682 2:132652087-132652109 TCATGACCAAGAACAGAGGGGGG + Intronic
940158555 2:150685685-150685707 GCATGACCAAAAACAGAGAGAGG - Intergenic
942510079 2:176688615-176688637 ACCTGTGCACACACAGAGGGTGG - Intergenic
946323459 2:218968338-218968360 GCATGCCCACACACAGAGCATGG + Intergenic
948133070 2:235615150-235615172 CTATGACAACCCACAGAGGTGGG + Intronic
948558764 2:238836319-238836341 CAAGGCCCACACACAGAGGGAGG + Intergenic
948665241 2:239530502-239530524 CAATGATCACAAACAGAGGATGG - Intergenic
948861147 2:240753124-240753146 CCAGGACCACACCCAGAGGGAGG + Intronic
948941914 2:241201009-241201031 CCCTCACCACACACAGGGTGGGG - Intronic
1169217714 20:3803092-3803114 CCATGACCTCCTACAGATGGTGG + Exonic
1169332819 20:4730024-4730046 CCCAGACCCCAAACAGAGGGTGG + Intergenic
1170914730 20:20611637-20611659 CCATGTCCACACAAACAGGCAGG + Intronic
1171969302 20:31553690-31553712 CTATAACTAGACACAGAGGGAGG + Intronic
1173892405 20:46522960-46522982 ACACGCACACACACAGAGGGTGG + Intergenic
1175641381 20:60633449-60633471 GGATGAACACACACACAGGGAGG + Intergenic
1176248303 20:64107881-64107903 CCATGTACACACACAGGGTGGGG - Intergenic
1178165290 21:29967742-29967764 CCATGCCTACACACACAGAGAGG - Intergenic
1179453435 21:41481027-41481049 CACTGACCGCACACAAAGGGAGG + Intronic
1179647148 21:42783008-42783030 CCATGGACCGACACAGAGGGTGG - Intergenic
1180971647 22:19819143-19819165 CCTTCACCACACTCAGAGGCAGG + Intronic
1183716926 22:39538514-39538536 CCTTGACCCCACACAGGGAGCGG - Intergenic
1184099308 22:42333734-42333756 CCACAGCCACACACAGAGGAAGG + Intronic
1184112296 22:42402444-42402466 GCAGGAGCACACACAGAGCGCGG + Intronic
1185061635 22:48610075-48610097 CCATAACAACACACAGTGGAGGG + Intronic
949700147 3:6747084-6747106 CCTTAACCAAAAACAGAGGGAGG - Intergenic
949819620 3:8102248-8102270 ACATGCAAACACACAGAGGGAGG + Intergenic
953477898 3:43221530-43221552 ACCTGACCATACACAGAGCGAGG - Intergenic
954562891 3:51573135-51573157 CCACGTCCATACACAGAGGGAGG + Intronic
956274555 3:67484050-67484072 GCCAGAGCACACACAGAGGGAGG - Intronic
957502810 3:81078644-81078666 CCATGACTACACAAATAAGGGGG + Intergenic
958740025 3:98057869-98057891 CCATCACAACACATAGAGGGAGG - Intergenic
960855801 3:122101003-122101025 CCATGATCTCACACAGAGCCAGG - Intronic
963141353 3:141948580-141948602 CCATAACCACACTGAGAGAGGGG - Intergenic
966740088 3:183224603-183224625 CGATGACCACAAGGAGAGGGTGG - Intronic
967813292 3:193778789-193778811 CCATGGTCACACGGAGAGGGCGG - Intergenic
969112093 4:4850510-4850532 CCATGGCCACACACAGGGATTGG + Intergenic
969490911 4:7498806-7498828 CCATGGACACCCGCAGAGGGAGG - Intronic
970592275 4:17569964-17569986 CCCTGAACAGAGACAGAGGGAGG + Intergenic
971342491 4:25783304-25783326 TCTTGACAACACACAGATGGAGG + Intronic
971678647 4:29668041-29668063 ACATGAACACACAAAGAGTGAGG - Intergenic
972214389 4:36878920-36878942 TCATCACCACTCACAGAGGTAGG - Intergenic
974904482 4:68038186-68038208 CCATGATCACAAAGAGAGGGAGG - Intergenic
976970006 4:91092847-91092869 CCCTGAGCAGACACAGAGGCAGG - Intronic
979671747 4:123366956-123366978 CCACGTACACACACAGAGAGAGG + Intergenic
979690854 4:123556702-123556724 CCAGGAATACACAAAGAGGGTGG + Intergenic
979981167 4:127257077-127257099 CCATAACCACAGCCAAAGGGAGG + Intergenic
982725021 4:158897036-158897058 CAATGACAACACACACAGGAAGG - Intronic
984270667 4:177545222-177545244 CCATGAAAACAAACAGAGGTAGG + Intergenic
985378892 4:189371627-189371649 ACATGAACACAGACCGAGGGAGG - Intergenic
987016686 5:13827422-13827444 CCATGCCTACACACAGCAGGGGG - Intronic
987188053 5:15445167-15445189 GAATGACCTAACACAGAGGGAGG + Intergenic
988359137 5:30212646-30212668 CCATGACAGCAGCCAGAGGGGGG + Intergenic
988803754 5:34721021-34721043 CCATGACAGCCCACAGAGAGGGG + Intronic
990348350 5:54890916-54890938 CTCTGACCACTCACAGAGTGAGG - Intergenic
992257172 5:74932810-74932832 CCAGGATCACTCACAGTGGGGGG - Intergenic
995050334 5:107696290-107696312 CCCTGACCAATCCCAGAGGGAGG + Intergenic
996728526 5:126694573-126694595 ACATTTCCACACACGGAGGGAGG - Intergenic
997578911 5:135005047-135005069 CCAGGACCACACAGGGAGGAGGG + Intronic
998175525 5:139899590-139899612 CCATGAACACTGACAGAGGAGGG - Intronic
999256788 5:150213963-150213985 CCAAGACCACACAGCCAGGGAGG - Intronic
1003790969 6:9547126-9547148 ACATGACAACATACAGAAGGTGG + Intergenic
1005295729 6:24424942-24424964 CCATGACCACACACAGGAGTGGG - Exonic
1005911482 6:30313724-30313746 CACTGACCACACTCAAAGGGAGG - Intergenic
1006132476 6:31877768-31877790 CCCTGAGTACACACACAGGGAGG + Intronic
1006257501 6:32843578-32843600 CCTTGTCCACACACAAATGGTGG - Intronic
1007576109 6:42926043-42926065 CCCTGACCTCTCACAGAGGTTGG - Intergenic
1011598506 6:89038744-89038766 CCATGACAACACTCATAGGAAGG - Intergenic
1015074258 6:129135379-129135401 CCATCACTACCCACAGAGGAAGG - Intronic
1015125853 6:129753601-129753623 CTATGACCACACTCTGAGGGAGG + Intergenic
1016353452 6:143192851-143192873 TAATGATGACACACAGAGGGTGG + Intronic
1016559837 6:145383491-145383513 ACATGACCAGAGACAGAGGATGG + Intergenic
1016904020 6:149131447-149131469 CCTGGACCACACACTGAAGGTGG + Intergenic
1017368364 6:153672417-153672439 CCATGTCCATACACAGTTGGAGG + Intergenic
1022369556 7:29757889-29757911 CCATGACCAAACACTCTGGGAGG - Intergenic
1023805593 7:43870568-43870590 CCATGACCACACTGAGAAGAGGG + Intronic
1026127707 7:67594149-67594171 CCATGTCCATAAACAGAGGAAGG + Intergenic
1028053686 7:86217333-86217355 CAATGACTACAAACACAGGGTGG + Intergenic
1028589273 7:92479099-92479121 CCCTGTACAGACACAGAGGGAGG - Intergenic
1032705641 7:134419284-134419306 TCATGCCCACACACAGGGGCTGG + Intergenic
1032785658 7:135197518-135197540 CCATGTGCCCACACAGTGGGAGG - Intronic
1033045686 7:137960407-137960429 ACATGCACACACACACAGGGGGG + Intronic
1033129441 7:138733360-138733382 TCATGCCCACACAGAGAGGGTGG + Intronic
1033713503 7:143974887-143974909 ACATGACCATACAGAGGGGGAGG + Intergenic
1034108697 7:148515106-148515128 CCCAGACCACTCAAAGAGGGTGG + Intergenic
1034949186 7:155285435-155285457 GCATGACAGCACACAGATGGAGG + Intergenic
1035027642 7:155836359-155836381 CCATGAACACACACAGCGCTTGG + Intergenic
1035070289 7:156139784-156139806 TCATGTCCCCACCCAGAGGGAGG + Intergenic
1035945011 8:3953457-3953479 CCATAAACACACACAGAGAGAGG + Intronic
1037653814 8:20865917-20865939 TCCTGCCCACACTCAGAGGGAGG - Intergenic
1038077208 8:24089851-24089873 AAATGACCCCACACAGAGTGGGG - Intergenic
1042348379 8:67750741-67750763 CCATAAACAAACACAGAGGAAGG - Intergenic
1047298188 8:123589391-123589413 CCATGATGACTCAGAGAGGGTGG - Intergenic
1049473941 8:142788291-142788313 CCATGCCCCCACCCAGAGAGAGG + Intergenic
1049514700 8:143047806-143047828 CCATGATTACTCACAGCGGGTGG - Intronic
1051760545 9:20458614-20458636 CCATGTCCTCACATAGAGGAAGG - Intronic
1051968680 9:22861751-22861773 CTATGTCCTCACACAGTGGGAGG + Intergenic
1055468838 9:76591736-76591758 CCCTGACCACAGACAGTGGGGGG + Intergenic
1056543725 9:87595783-87595805 CCAGAACAACACACAGAGGTAGG - Intronic
1056824063 9:89864603-89864625 TCAGGACCACACACACAGAGGGG + Intergenic
1057761049 9:97874621-97874643 CCATCAACACTTACAGAGGGTGG + Intergenic
1060818041 9:126645672-126645694 CCTTGAGCACACAAGGAGGGAGG + Intronic
1062448752 9:136606783-136606805 TCATGACTCCACACAGAGGGAGG - Intergenic
1193316484 X:80071563-80071585 CCATGAAAACAGACAGAAGGGGG - Intergenic
1196706704 X:118723366-118723388 CTATGAGCACACACACAGGAGGG + Intergenic
1197662371 X:129188170-129188192 CCCTGTACACAGACAGAGGGAGG + Intergenic
1199239985 X:145535320-145535342 GCATGACCACACCCAGAGGTAGG + Intergenic
1200822136 Y:7597422-7597444 CCATGTAAACACACAAAGGGTGG + Intergenic
1202048066 Y:20753990-20754012 CCCTGTACAGACACAGAGGGAGG + Intergenic
1202238165 Y:22736595-22736617 CCATGTAAACACACAAAGGGTGG - Intergenic