ID: 1106122518

View in Genome Browser
Species Human (GRCh38)
Location 13:26872478-26872500
Sequence GAGCAATCAAACCCCTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106122518 Original CRISPR GAGCAATCAAACCCCTGCTG TGG (reversed) Intergenic