ID: 1106124474

View in Genome Browser
Species Human (GRCh38)
Location 13:26889087-26889109
Sequence CTGGGAAGACAGAGGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1254
Summary {0: 1, 1: 0, 2: 13, 3: 134, 4: 1106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106124463_1106124474 26 Left 1106124463 13:26889038-26889060 CCTGTAGTCCACGCTACTCTGGA 0: 1
1: 49
2: 5368
3: 115671
4: 250983
Right 1106124474 13:26889087-26889109 CTGGGAAGACAGAGGTTGCAGGG 0: 1
1: 0
2: 13
3: 134
4: 1106
1106124465_1106124474 18 Left 1106124465 13:26889046-26889068 CCACGCTACTCTGGAGGCTGAGG 0: 34
1: 9619
2: 215189
3: 278286
4: 176998
Right 1106124474 13:26889087-26889109 CTGGGAAGACAGAGGTTGCAGGG 0: 1
1: 0
2: 13
3: 134
4: 1106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106124474 Original CRISPR CTGGGAAGACAGAGGTTGCA GGG Intergenic
900230905 1:1556921-1556943 CTGAGATGACAGAGGTAGAACGG - Intronic
900658277 1:3770834-3770856 GAGGGAAGACAGAGGATGGAGGG + Intronic
900892380 1:5458675-5458697 CTGGGAAGACAGTGACTGCATGG + Intergenic
901029214 1:6297112-6297134 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901110711 1:6792027-6792049 CCTGGAAGGCGGAGGTTGCAGGG - Intronic
901267711 1:7924549-7924571 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
901297688 1:8173252-8173274 CCTGGAAGGCGGAGGTTGCAGGG - Intergenic
901308303 1:8249542-8249564 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
901520875 1:9783915-9783937 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
901674800 1:10876919-10876941 CATGGGAGGCAGAGGTTGCAGGG - Intergenic
901824792 1:11854112-11854134 CCAGGGAGGCAGAGGTTGCAGGG + Intergenic
901870593 1:12136571-12136593 CCTGGGGGACAGAGGTTGCAGGG + Intronic
902061777 1:13650073-13650095 CCGGGGAGGCAGAGGTTGCAGGG - Intergenic
902211093 1:14905132-14905154 CCCAGAAGGCAGAGGTTGCAGGG - Intronic
902669785 1:17965055-17965077 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
902891075 1:19444080-19444102 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
903038822 1:20513070-20513092 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
903174586 1:21573359-21573381 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
903300563 1:22375765-22375787 CTGGGAACACAGTGGATGCTCGG + Intergenic
903329438 1:22589745-22589767 TTGGGAAGAAAGAGGTTCCGGGG - Intronic
903396536 1:23005928-23005950 ACCGGAAGGCAGAGGTTGCAGGG + Intergenic
903397730 1:23014916-23014938 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
903692053 1:25181385-25181407 CTTGGGAGGCGGAGGTTGCAGGG - Intergenic
903939187 1:26917180-26917202 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
904026040 1:27504339-27504361 CTGAGAAGCCAGAGGTTACAGGG + Intergenic
904122078 1:28205810-28205832 CCCAGGAGACAGAGGTTGCAGGG + Intronic
904496542 1:30890229-30890251 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
904525869 1:31133422-31133444 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
904640334 1:31922405-31922427 CCTGGGAGACAGAGGTTGCAGGG + Intronic
904668353 1:32142178-32142200 CCCCGGAGACAGAGGTTGCAGGG + Intronic
904779622 1:32935820-32935842 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
905444594 1:38018144-38018166 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
905557436 1:38898226-38898248 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
905573309 1:39023748-39023770 CTGGAGAGGCAGAGGTTGCAGGG - Intergenic
905825898 1:41025827-41025849 CTCGGGAGGCGGAGGTTGCAGGG + Intergenic
905991963 1:42345594-42345616 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
906062220 1:42956507-42956529 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
906384000 1:45351686-45351708 CTGGGAGCACGGAGGTTCCAAGG + Intronic
906412471 1:45589823-45589845 CCCAGAAGGCAGAGGTTGCAGGG + Intronic
906438342 1:45816751-45816773 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
906976650 1:50581567-50581589 CTGGGAAGACATATGTAGAATGG + Intronic
906982139 1:50642914-50642936 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
907024142 1:51098551-51098573 CCTGGAAGGCGGAGGTTGCAGGG + Intergenic
907150954 1:52287163-52287185 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
907377554 1:54056399-54056421 CCAGGGAGGCAGAGGTTGCAGGG - Intronic
907436672 1:54454069-54454091 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
907943116 1:59107834-59107856 GTGGGAAGAAAGAGATTCCAGGG + Intergenic
908342309 1:63194146-63194168 CAGGGAAGACATAGGATACATGG - Intergenic
908733084 1:67247378-67247400 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
910336766 1:86141774-86141796 CCCAGGAGACAGAGGTTGCAGGG - Intronic
910568508 1:88674581-88674603 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
910572794 1:88724645-88724667 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
910602521 1:89047389-89047411 CTGCAGAGGCAGAGGTTGCAGGG - Intergenic
910882955 1:91938947-91938969 CTTGGAAGGCTGAGGTTGGAGGG + Intergenic
911150788 1:94595443-94595465 CCCGGAAGGCAGAGGTTGCAGGG - Intergenic
912220767 1:107672191-107672213 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
912574026 1:110648105-110648127 CTGTGAATACAGAGATTACAAGG + Intergenic
912818921 1:112851257-112851279 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
912865420 1:113251919-113251941 ATGGGAAGAAATAGGTTGGAGGG - Intergenic
912886958 1:113484798-113484820 CCCGGGACACAGAGGTTGCAGGG - Intronic
913466007 1:119143399-119143421 CCAGGGAGACAGAGGTTGCAGGG + Intergenic
913543521 1:119844131-119844153 TTTGGAAGACAGAGGTAGCAAGG - Intergenic
914679217 1:149927431-149927453 CTGGGAAGAGAGAAGTTTAAGGG - Intronic
914726756 1:150334435-150334457 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
914893330 1:151648128-151648150 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
915174190 1:154001271-154001293 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
915480756 1:156183207-156183229 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
915615686 1:157036395-157036417 CCCGGGAGACAGAGGTTGCAGGG - Intronic
915873509 1:159587595-159587617 CTGGGAAGAGAGTCATTGCAGGG - Intergenic
916246845 1:162696797-162696819 CTGGGCAGACAGCGGGGGCAGGG - Intronic
916248163 1:162709082-162709104 GTGAGAAGACAGAGGTGCCAAGG + Intronic
916464483 1:165060571-165060593 CTCTGAAGAGAGAGGCTGCAGGG + Intergenic
917372149 1:174305458-174305480 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
917520139 1:175741597-175741619 CAGTGAAGTCAGAGGTTGTAAGG - Intronic
917782111 1:178409290-178409312 CTGGGAACACAAAGCTTGCAGGG + Intronic
917863085 1:179166699-179166721 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
918296088 1:183158715-183158737 CGGGCAAGACAGATGTTGCTGGG - Intergenic
918375921 1:183908943-183908965 CAGTGAAGACAGAGGATCCAGGG - Intronic
919153075 1:193724769-193724791 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
919176575 1:194026860-194026882 CTGGGAAGTAAGTGGTAGCAAGG - Intergenic
920186695 1:204163761-204163783 TGGTGAAGACAGTGGTTGCAGGG + Intronic
920234080 1:204491311-204491333 CCTGGGAGACGGAGGTTGCAGGG + Intronic
920841891 1:209562144-209562166 CTGGAAACACAGGGGGTGCAGGG + Intergenic
920859135 1:209690619-209690641 CCCGGAAGGCAGAGGTTGCAGGG + Intronic
921163954 1:212492743-212492765 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
922204187 1:223432244-223432266 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
922228009 1:223662371-223662393 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
922459344 1:225803090-225803112 CTGGGAAGACTGAGGTCACAAGG - Intergenic
922789493 1:228303362-228303384 CTGGGTAGGCAGAGGTAGGAAGG - Intronic
922916680 1:229263713-229263735 CCCGGGAGACAGAGTTTGCAGGG - Intergenic
923254114 1:232205287-232205309 CTCGGAAGACTGAGGTGGGAAGG - Intergenic
923301729 1:232647594-232647616 CACGGGAGACGGAGGTTGCAGGG - Intergenic
923653361 1:235894471-235894493 CCAGGGAGGCAGAGGTTGCATGG - Intergenic
923677230 1:236090477-236090499 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
923863445 1:237915612-237915634 CTGGGAAGACACCCGTTGCCAGG + Intergenic
924300358 1:242631850-242631872 CCTGGGGGACAGAGGTTGCAGGG - Intergenic
924600199 1:245482165-245482187 CTCAGGAGGCAGAGGTTGCAGGG - Intronic
1062772505 10:114029-114051 CCTGGGAGGCAGAGGTTGCAAGG + Intergenic
1063481355 10:6379483-6379505 CTGGGAAGAAAAAGGTTCAATGG + Intergenic
1063641580 10:7835914-7835936 CTGGGAAGAAAGTGGTAGCTGGG - Intronic
1063886675 10:10586978-10587000 TTTGGAAGAAAGAGGTTGCTAGG + Intergenic
1063989260 10:11542641-11542663 CCCGGGAGACAGAGTTTGCAAGG + Intronic
1064256420 10:13746284-13746306 CTTGGGAGTCGGAGGTTGCAGGG - Intronic
1064533912 10:16338641-16338663 CTCAGAAGACTGAGGTTGGAGGG + Intergenic
1064739795 10:18421371-18421393 ATTGGGAGGCAGAGGTTGCAGGG - Intronic
1064764498 10:18657687-18657709 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1064855677 10:19765342-19765364 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1064906623 10:20353505-20353527 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1065034105 10:21620764-21620786 CCTGGGAGACGGAGGTTGCAGGG - Intronic
1065212556 10:23418154-23418176 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1065387253 10:25146112-25146134 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1065970387 10:30801312-30801334 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1066061831 10:31730916-31730938 CTGGCCAGGGAGAGGTTGCAGGG - Intergenic
1066084374 10:31962243-31962265 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1066304600 10:34128543-34128565 TCGGGAAGTCAGAAGTTGCATGG + Intronic
1067078257 10:43200134-43200156 CTGGGCAGACAGGGCTGGCAGGG + Intronic
1067097574 10:43312544-43312566 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1067147726 10:43705840-43705862 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1067563080 10:47317553-47317575 CTTGGAACACAGAGGTTGCATGG + Intergenic
1067723028 10:48743889-48743911 CTGAGAAGACCGAGGCTGCCTGG - Intronic
1067768729 10:49108591-49108613 CTGGGACAACAGGGGTTGCTTGG + Intronic
1068009168 10:51426203-51426225 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1068307148 10:55226455-55226477 CCCAGGAGACAGAGGTTGCAGGG - Intronic
1068595197 10:58895674-58895696 CTGGAGAGACAGAGGTGGCCAGG + Intergenic
1068607021 10:59016851-59016873 CTGGGAACACAGTGGCTGCTTGG - Intergenic
1069294701 10:66829535-66829557 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1069425717 10:68287051-68287073 CTTGGGAGATAGAGGTTGCAGGG + Intronic
1069477816 10:68751101-68751123 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1069488760 10:68843631-68843653 CCCGGAAGGCAGAGGTTGCAGGG - Intronic
1069545612 10:69325908-69325930 CCTGGCAGGCAGAGGTTGCAGGG - Intronic
1069547800 10:69341235-69341257 CTGGGGAAGCAGAGGTTGCAGGG - Intronic
1070004454 10:72409613-72409635 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1070027730 10:72648220-72648242 CCCGGGAGGCAGAGGTTGCAAGG + Intergenic
1070055130 10:72927213-72927235 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1070233439 10:74596619-74596641 CCTGGGAGACAGAGGTTTCAGGG - Intronic
1070384993 10:75916383-75916405 CTGGCAAGAGAGAGGCAGCAGGG + Intronic
1070461408 10:76674102-76674124 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1071400182 10:85261170-85261192 CTGAGAAGAGAAAGGTTGAAGGG + Intergenic
1071715513 10:88091395-88091417 CTGGGAAGAGATAGATGGCAAGG + Intergenic
1072059372 10:91794697-91794719 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1072125196 10:92439384-92439406 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1072400919 10:95099160-95099182 ACGGGGAGGCAGAGGTTGCAGGG - Intergenic
1072569008 10:96642348-96642370 CTGGGGAGGCAGTGGTTACAGGG + Intronic
1072711986 10:97721857-97721879 CTTGGAAGACTGAGGTGGGAGGG - Intergenic
1072953360 10:99868195-99868217 TCCGGAAGGCAGAGGTTGCAGGG + Intergenic
1073202499 10:101747250-101747272 GTGTAGAGACAGAGGTTGCAGGG + Intergenic
1074264700 10:111889865-111889887 CAGGCAATAGAGAGGTTGCAAGG + Intergenic
1074370978 10:112900646-112900668 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1074578208 10:114690755-114690777 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1074581861 10:114726703-114726725 ACTGGGAGACAGAGGTTGCAGGG + Intergenic
1075168153 10:120087847-120087869 CCCAGGAGACAGAGGTTGCAGGG + Intergenic
1075432656 10:122401499-122401521 GAGGGAAGAGAGAGGTAGCAGGG + Intronic
1075767708 10:124907473-124907495 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1075964508 10:126599546-126599568 ATCGGAAGACAGAGGCTGCATGG + Intronic
1076061025 10:127413985-127414007 CTCGGGAGGCGGAGGTTGCAGGG - Intronic
1076601548 10:131660095-131660117 CTGGGAACCTAGAGGATGCAGGG + Intergenic
1076608229 10:131703115-131703137 CTGGGATGACACAGGGTTCAGGG + Intergenic
1077066891 11:645085-645107 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1077462064 11:2715626-2715648 CTGGGGAGTCACAGGTTCCAAGG - Intronic
1078101857 11:8334699-8334721 CAGGGAAGACAGAGGGTACAGGG - Intergenic
1078201093 11:9183973-9183995 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1078282515 11:9917405-9917427 CTCGGGAGGCGGAGGTTGCAGGG - Intronic
1078328348 11:10398417-10398439 CAGGGAGGCCAGAGGGTGCATGG + Intronic
1078530155 11:12130884-12130906 GTGGGAAGAGAGAGGTTTCTGGG + Intronic
1078937100 11:15961622-15961644 CCTGGAAGGCGGAGGTTGCAGGG - Intergenic
1079165944 11:18043527-18043549 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
1079323615 11:19472984-19473006 ATGAGAAGACAGAGGATCCATGG + Intronic
1079803934 11:24905450-24905472 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
1080185384 11:29477932-29477954 ATGGGAACACAGAGTTTGAAGGG - Intergenic
1080281736 11:30565101-30565123 CAGGGGAGACACAGGCTGCACGG - Intronic
1080689924 11:34548124-34548146 CTGGGAAGGTGAAGGTTGCAGGG - Intergenic
1081364416 11:42216891-42216913 CTGGACAGACAGTGGTTTCATGG - Intergenic
1081947435 11:47009719-47009741 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1082019058 11:47515990-47516012 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1083349392 11:62016633-62016655 CTGGGAAGACACCCGTTGCCAGG + Intergenic
1084222138 11:67688866-67688888 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1084330257 11:68425892-68425914 TTGGGAGGACAGAGGTTGACAGG - Intronic
1084720886 11:70904944-70904966 CTGGGAAGAAAAAGGTTTAATGG - Intronic
1084935032 11:72582340-72582362 CTGGGAAGACAGAGTCATCAAGG - Intronic
1084985407 11:72866343-72866365 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1085080173 11:73627492-73627514 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1085359350 11:75872462-75872484 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1085640841 11:78191679-78191701 CTGGGAACACCGAAGTGGCAGGG + Intronic
1085837304 11:79970834-79970856 CTGGGAAAGCAGAGGTTTAATGG - Intergenic
1086162081 11:83733163-83733185 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1087726840 11:101728186-101728208 CTCGGAAGGCTGAGGTTGAAGGG + Intronic
1087940156 11:104087099-104087121 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1088074198 11:105826199-105826221 GTGGGGAGAGAGAGGTTGCAGGG + Intronic
1088436440 11:109818298-109818320 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1088932872 11:114369783-114369805 CTTGGGAGCCAGAAGTTGCAGGG - Intergenic
1088935057 11:114391094-114391116 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1089129171 11:116198948-116198970 CTGGGTAGAAAGAAGTTGGAGGG + Intergenic
1089431986 11:118432903-118432925 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1089632124 11:119790289-119790311 CCGGCAAGACAGAGCTTGCCTGG + Intergenic
1089986964 11:122824004-122824026 CTTGGGAGGCGGAGGTTGCAGGG - Intergenic
1090343893 11:126051721-126051743 CTCGGGAGGCAGAGGTTGCAGGG - Intronic
1090375416 11:126284776-126284798 CGTGGGAGGCAGAGGTTGCAGGG + Intronic
1090574668 11:128087799-128087821 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
1090646236 11:128768611-128768633 CCGGGAAGGCGGAGGTTGCAGGG + Intronic
1091398382 12:168381-168403 CTGGGAGGACAGAGCCTGCCTGG - Intronic
1091452087 12:578830-578852 CTGGGAAGACAGGAGCTGCTGGG - Intronic
1091452224 12:579979-580001 CTGGGAAGACAGGAGCTGCTGGG + Intronic
1091898302 12:4122409-4122431 CCCGGGAGACGGAGGTTGCAGGG - Intergenic
1092265628 12:6978285-6978307 CTGGGAAGACAGTGGAAGGAAGG + Intronic
1092268895 12:7006292-7006314 CCTGGAAGACAGAGGTTGCAGGG - Intronic
1092340806 12:7674203-7674225 CTGGGGGGGCTGAGGTTGCAGGG - Intergenic
1092927319 12:13283078-13283100 CTGTGAAGACTGAGGCAGCAGGG + Intergenic
1092950197 12:13495783-13495805 CTGGGAAGAGGGAGCTTGTAGGG - Intergenic
1093051544 12:14510316-14510338 CCCGAAAGGCAGAGGTTGCAGGG + Intronic
1093166212 12:15806812-15806834 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1093180955 12:15966386-15966408 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1093643451 12:21554919-21554941 TTGGGAAGACTGAGGCTGGAAGG - Intronic
1093734906 12:22609713-22609735 CTGGAAAGACAGCGCTAGCAAGG - Intergenic
1093919925 12:24848497-24848519 CTGGGGACACAGAAATTGCAGGG - Intronic
1094110796 12:26860155-26860177 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1094131255 12:27078404-27078426 CCCAGGAGACAGAGGTTGCAGGG - Intergenic
1094174786 12:27530287-27530309 CTGGGAAGTGAGAGGGTGGAAGG + Intronic
1094554345 12:31483514-31483536 CTTGCGAGGCAGAGGTTGCAGGG - Intronic
1095311320 12:40700448-40700470 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1095800237 12:46264766-46264788 CTCAGAAGCCAGAGGTTGGAAGG - Intronic
1095943425 12:47740503-47740525 GTGGGAAGGCAGAGGCTCCAGGG + Intronic
1096216118 12:49798341-49798363 CTGGGCAGAGAGAGGTAGGAGGG - Exonic
1096236713 12:49933391-49933413 CTCGGGGGGCAGAGGTTGCAGGG - Intergenic
1096333912 12:50738557-50738579 CTGGGGAGATGGAGGTTGCAGGG - Intronic
1096911875 12:54992048-54992070 CTGTGAAGACAGAGGTTTGCAGG - Intergenic
1097013633 12:55970334-55970356 CTGAAAAGCCAGAGGTTGAAGGG - Intronic
1097078120 12:56410173-56410195 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1097121505 12:56736577-56736599 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1097251556 12:57635607-57635629 CTTGGGAGGCAAAGGTTGCAGGG + Intergenic
1097482311 12:60144322-60144344 GTGGGAAGTCAGAGGTGGCAGGG + Intergenic
1097890993 12:64777833-64777855 CCTGGTAGGCAGAGGTTGCAGGG - Intergenic
1098125152 12:67283505-67283527 CCTGGAAGGCGGAGGTTGCAGGG + Intronic
1098328364 12:69326024-69326046 CTGGGGAGGCAGAGGTTGCAGGG + Intergenic
1098771725 12:74560778-74560800 CAGGGAAAACAGAGTGTGCAGGG + Intergenic
1098780070 12:74676195-74676217 CTGGTTAGACAGTGGGTGCAGGG + Intergenic
1100263680 12:92955705-92955727 CCTGGGAGACATAGGTTGCAGGG + Intergenic
1100275484 12:93068118-93068140 CTGGGAAGTCAGATGTGTCATGG + Intergenic
1100474921 12:94926491-94926513 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1100714549 12:97292117-97292139 CTGGAGAGACACAGTTTGCATGG + Intergenic
1100845259 12:98651888-98651910 CCCAGAAGGCAGAGGTTGCAGGG - Intronic
1100873019 12:98932023-98932045 CTGAGAAGACCGAGGTTGGTAGG - Intronic
1100893394 12:99151450-99151472 CTGGAAAGATGGAGGCTGCAGGG + Intronic
1101330423 12:103753376-103753398 CTGTGCAGACAGAGTCTGCAGGG + Intronic
1101507893 12:105363647-105363669 CCAGGGAGTCAGAGGTTGCAGGG + Intronic
1101728636 12:107408464-107408486 CTGGGAAGACAGTAGGGGCAGGG + Intronic
1102086409 12:110144584-110144606 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1102088402 12:110163689-110163711 CCCAGAAGGCAGAGGTTGCAGGG - Intronic
1102179367 12:110900673-110900695 CCAGGGAGTCAGAGGTTGCAGGG - Intronic
1102243002 12:111337097-111337119 CCCAGGAGACAGAGGTTGCAAGG + Intronic
1102478308 12:113203099-113203121 CCCAGAAGGCAGAGGTTGCAGGG - Intronic
1102500617 12:113349739-113349761 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1102934716 12:116886746-116886768 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1102941799 12:116949080-116949102 CTGAGAGGCCAGAGGTTTCATGG - Intronic
1103037381 12:117667415-117667437 CTGGGGAGAAGGAGGTGGCATGG + Intronic
1103448926 12:121014254-121014276 CTTGGGAGGCGGAGGTTGCAGGG + Intronic
1104117146 12:125760508-125760530 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1104396066 12:128434374-128434396 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1104589238 12:130070988-130071010 CACGGGAGGCAGAGGTTGCAGGG - Intergenic
1104807903 12:131601128-131601150 CAGGGAAGACAGTGTGTGCAGGG + Intergenic
1104906876 12:132218247-132218269 CTGGGAACACAGGGCTTGCTTGG - Intronic
1105372579 13:19814722-19814744 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1105515575 13:21087342-21087364 CTCGGCAGGCAGAGGTTGCAGGG - Intergenic
1106040859 13:26091488-26091510 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1106124474 13:26889087-26889109 CTGGGAAGACAGAGGTTGCAGGG + Intergenic
1106154135 13:27136420-27136442 CCGGGGAGGCGGAGGTTGCAGGG + Intronic
1106215965 13:27699769-27699791 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1106270366 13:28146897-28146919 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1106525472 13:30536987-30537009 CAGGGAAGACAGAGGACCCATGG - Intronic
1106631682 13:31480628-31480650 CTGGGAAGAAAAAGGTTTAATGG + Intergenic
1106761663 13:32874051-32874073 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1107246637 13:38304789-38304811 CCTTGAAGACAGAGGTTGGATGG - Intergenic
1107466908 13:40659237-40659259 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1107485838 13:40826873-40826895 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1107697853 13:43018261-43018283 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1107887198 13:44883387-44883409 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1107930546 13:45303753-45303775 CCAGGGAGGCAGAGGTTGCAGGG - Intergenic
1108300094 13:49064825-49064847 TTGGGAAAAAACAGGTTGCAAGG + Intronic
1108524993 13:51279024-51279046 CTTTGAAGACAGAAGTTACAAGG + Intronic
1108638690 13:52361689-52361711 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1109024480 13:57141231-57141253 TTAGGAAGACAGAGGTGACAAGG - Intronic
1109025467 13:57147801-57147823 TTAGGAAGACAGAGGTGACAAGG - Intronic
1109026457 13:57154374-57154396 TTAGGAAGACAGAGGTGACAAGG - Intronic
1109027449 13:57160945-57160967 TTAGGAAGACAGAGGTGACAAGG - Intronic
1109028435 13:57167510-57167532 TTAGGAAGACAGAGGTGACAAGG - Intronic
1109781948 13:67122696-67122718 CTCGGGAGGCAGAGGTTGCAGGG + Intronic
1110906402 13:80896322-80896344 CCAGGGAGGCAGAGGTTGCAGGG - Intergenic
1111394437 13:87646739-87646761 CAGGGAAGACAGTGGGTGAAGGG + Intergenic
1111880771 13:93954388-93954410 CCTGGAAGACAGAGGTTGCATGG - Intronic
1112150978 13:96763413-96763435 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1112344900 13:98581091-98581113 CCTGGGAGACAGCGGTTGCAGGG - Intergenic
1112497314 13:99915416-99915438 CTCGGAAGGCAGAGGTTGCAGGG - Intergenic
1112639222 13:101254295-101254317 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1113141612 13:107158347-107158369 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
1113153306 13:107288605-107288627 CTGAGGAGGCGGAGGTTGCAGGG - Intronic
1113439331 13:110315469-110315491 CTCAGGAGGCAGAGGTTGCAGGG - Intronic
1114165812 14:20217127-20217149 CTGGGAAGACACCCGTTGCCAGG - Intergenic
1114518180 14:23314287-23314309 CCCGGGAGACGGAGGTTGCAGGG + Intronic
1114641093 14:24221671-24221693 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1114994481 14:28331043-28331065 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1115229702 14:31146775-31146797 CCTGGAAGGCGGAGGTTGCAGGG + Intronic
1115598629 14:34934064-34934086 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
1116050562 14:39797688-39797710 CCTGGAAGGCAGAGGTTGCATGG - Intergenic
1116150700 14:41138264-41138286 CTGGGAAGATAGCTGTTGCATGG + Intergenic
1116693126 14:48135946-48135968 CCTGGGAGTCAGAGGTTGCAGGG + Intergenic
1116931701 14:50697200-50697222 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1117215427 14:53546834-53546856 CTGGGAAGATAGAGCTAGAATGG + Intergenic
1117215932 14:53551746-53551768 CTGGGAATAGAGAGGTTTCTGGG + Intergenic
1117302779 14:54444931-54444953 CTCGGGAGAGAGAGTTTGCAGGG + Intergenic
1117418887 14:55524041-55524063 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1117461465 14:55949410-55949432 ATGGGAAGACAGAGGTCAAAGGG - Intergenic
1117485527 14:56193182-56193204 CTGGGAAGACAGAGGCTCAGAGG - Intronic
1117761715 14:59035856-59035878 CTGGGAAAAAAGAGGTTTAATGG + Intergenic
1117779324 14:59216142-59216164 CTGGGAAGTCAGAGGAGGTATGG - Intronic
1118198253 14:63648327-63648349 CAGAGGAGCCAGAGGTTGCATGG + Intergenic
1118208401 14:63744596-63744618 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
1118211850 14:63772665-63772687 CCCGGGAGACAGAGGTTTCAGGG + Intergenic
1118528107 14:66668954-66668976 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1118708745 14:68502777-68502799 CAGGGAGGACAGCGGATGCAAGG - Intronic
1118717344 14:68569783-68569805 GTGGGAAGGCAGAGGCTGCTGGG - Intronic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1119504897 14:75164139-75164161 CCCGGGAGTCAGAGGTTGCAGGG - Intronic
1120024662 14:79569682-79569704 CCCGGGAGACGGAGGTTGCAGGG - Intronic
1120046115 14:79808159-79808181 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1120134958 14:80856804-80856826 CTCGGGAGGCAGAGGTTGTAGGG - Intronic
1120150050 14:81022743-81022765 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1120810784 14:88801278-88801300 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1121027832 14:90629589-90629611 CTGGGGAGCCAGAGGTTTCCAGG + Intronic
1121405251 14:93715804-93715826 CTGGGCAGGCAGGGGTTGCGTGG + Intergenic
1121624176 14:95372455-95372477 CTTGGGAGGCAGAGGTTGCAGGG - Intergenic
1121734688 14:96209918-96209940 CTCAGGAGGCAGAGGTTGCAGGG + Intronic
1121906431 14:97750428-97750450 CTCAGAAGGCAGAGGTTTCAAGG + Exonic
1122483247 14:102061247-102061269 CTCGGGAGGCGGAGGTTGCAGGG + Intergenic
1122568947 14:102680727-102680749 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1122657539 14:103272398-103272420 GAGGGGAGGCAGAGGTTGCAAGG + Intergenic
1122706109 14:103623021-103623043 CCTGGGAGACAGAGGTTGCAGGG - Intronic
1122710673 14:103655149-103655171 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1123686440 15:22800996-22801018 CTCGGGAGGCTGAGGTTGCAGGG + Intronic
1124059622 15:26277941-26277963 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1124083264 15:26520443-26520465 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1124391090 15:29258135-29258157 CTCGGGAGATGGAGGTTGCAGGG + Intronic
1124438345 15:29669467-29669489 CTGGGAAGTCCAAGGTTGAATGG - Intergenic
1124921386 15:34030176-34030198 CCCAGAAGGCAGAGGTTGCAGGG + Intronic
1124930241 15:34112665-34112687 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1125447850 15:39776999-39777021 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1125564358 15:40664755-40664777 CCCGGGAGACAGAGGTTGCAGGG + Intergenic
1125595345 15:40881867-40881889 CTCAGGAGGCAGAGGTTGCAGGG - Intergenic
1125703160 15:41706654-41706676 CCTGGGAGACAGAGATTGCAAGG - Intronic
1125869926 15:43091012-43091034 CCCGGGAGGCAGAGGTTGCATGG - Intronic
1125925295 15:43558301-43558323 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1125976461 15:43957269-43957291 CTTGGGAGGTAGAGGTTGCAGGG - Intronic
1126034065 15:44531228-44531250 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1126353970 15:47775422-47775444 CCCGGGATACAGAGGTTGCAGGG - Intergenic
1126694815 15:51317000-51317022 GTGGCAAGACAGAGGGAGCATGG + Intronic
1127103531 15:55589816-55589838 CTGGGACGACTGGGGTGGCAGGG + Intergenic
1127216691 15:56830742-56830764 CTGGGGAGATTGAGGCTGCAGGG + Intronic
1127246149 15:57177343-57177365 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1127266126 15:57363659-57363681 CTGAGAAGTCAGATGTTGCATGG - Intergenic
1127346531 15:58106609-58106631 CTTGGGAGGCTGAGGTTGCATGG + Intronic
1127436711 15:58964984-58965006 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1127672859 15:61212473-61212495 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1127962439 15:63899745-63899767 CTTGGGAGGTAGAGGTTGCAGGG - Intergenic
1128273297 15:66331077-66331099 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1128672264 15:69582720-69582742 CTGGGAAGGCCAAGGTTGAAGGG + Intergenic
1128687951 15:69700852-69700874 ATGGGAAAACAGAGGCTGTAGGG - Intergenic
1129012916 15:72439209-72439231 CCCGGAAGGCAGAGGTTGCGGGG + Intergenic
1129147583 15:73662904-73662926 CTGGGGCTTCAGAGGTTGCAGGG - Intergenic
1129326003 15:74800612-74800634 CTGGGATGACAGAGGCTGACTGG - Intronic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129478174 15:75801805-75801827 ATGCGAAAACAGATGTTGCATGG + Intergenic
1129923230 15:79338819-79338841 CTGGGAAGACACCCGTTGCCAGG + Intronic
1130063571 15:80586983-80587005 CTGGGGAGGAAGAGGGTGCATGG - Intronic
1130165687 15:81455623-81455645 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1130222653 15:82033651-82033673 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1130348640 15:83070906-83070928 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1131213227 15:90515843-90515865 CCCGGCAGGCAGAGGTTGCAGGG - Intergenic
1131892336 15:96985470-96985492 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1132052997 15:98625904-98625926 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1132094214 15:98970122-98970144 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1132526863 16:421157-421179 CTGGGAAGAGAGAGTTAGAATGG - Intergenic
1133010366 16:2907199-2907221 CTGGGAAGACACCCGTTGCCAGG - Intergenic
1133081540 16:3325055-3325077 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1133302570 16:4791761-4791783 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1133361431 16:5176962-5176984 CTGGGAACACAGAGGATCTAGGG + Intergenic
1133534454 16:6687714-6687736 CGGGGAGGACAGAGGATGGAAGG + Intronic
1133566744 16:7002634-7002656 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1133590115 16:7234046-7234068 ATGAGAAGAGAGGGGTTGCATGG + Intronic
1133654836 16:7851112-7851134 CTGGGGAGGCAGAGATTGCAGGG - Intergenic
1133702950 16:8326121-8326143 CTGGGAAGAGAGGGCTTGTAGGG + Intergenic
1133792755 16:9021952-9021974 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1133856686 16:9556306-9556328 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1134118530 16:11567464-11567486 ATGGGTGGACAGAGGTTGAAAGG + Intronic
1134191116 16:12121889-12121911 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1134353857 16:13462884-13462906 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1134430785 16:14203726-14203748 CCCAGGAGACAGAGGTTGCAGGG + Intronic
1134488221 16:14675861-14675883 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1134752815 16:16639721-16639743 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1134993243 16:18719355-18719377 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1135009437 16:18861606-18861628 CTGAGAAGCCAGTGGTTGCACGG - Intronic
1135032891 16:19052786-19052808 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1135035468 16:19073231-19073253 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1135257199 16:20950504-20950526 CTGGGAAGACAGAGGCTTAAAGG - Intronic
1135289089 16:21219196-21219218 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1135674998 16:24407712-24407734 CTTGGGAGGCTGAGGTTGCAGGG - Intergenic
1135697556 16:24603361-24603383 CAAGGAAGACAGAGTTTGTAGGG - Intergenic
1135789336 16:25379337-25379359 CTTGGAAGACTGAGGTGGGAGGG - Intergenic
1135989883 16:27211752-27211774 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1136504900 16:30696849-30696871 CCCGGGAGACAGAGGCTGCAGGG + Intergenic
1136558492 16:31024003-31024025 CTGGGGAGGCAGAGGCTGTAGGG - Intergenic
1136580793 16:31149732-31149754 CTGGAAAGACAGAGGTAGGCAGG + Intronic
1137258402 16:46798430-46798452 CTCGGGAGGCAGAGGTTGCAAGG + Intronic
1137555828 16:49469763-49469785 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1137621541 16:49879689-49879711 TTGGGATGACAGAGGAGGCAGGG + Intergenic
1138479978 16:57296234-57296256 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1138740623 16:59305348-59305370 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1138833804 16:60409049-60409071 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1138880417 16:61007610-61007632 CCAGGGAGGCAGAGGTTGCAGGG - Intergenic
1139283810 16:65792794-65792816 CAGGGAAGACAGAGCAAGCAAGG + Intergenic
1139725046 16:68890947-68890969 CTTGGGAGGCGGAGGTTGCAGGG + Intronic
1139765773 16:69228428-69228450 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1139780161 16:69344695-69344717 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1140149805 16:72351310-72351332 CAGGGAAGACAGAGGTGATAAGG - Intergenic
1140411204 16:74741534-74741556 CCCAGAAGACAGAGGTGGCATGG - Intronic
1140498524 16:75411333-75411355 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1140749145 16:78007680-78007702 CTGGGGAGGTGGAGGTTGCAGGG - Intergenic
1141150311 16:81560070-81560092 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
1141194666 16:81851586-81851608 CTCGGGAGGCGGAGGTTGCAGGG - Intronic
1141235849 16:82215577-82215599 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1141905348 16:87021666-87021688 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1141962220 16:87416678-87416700 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1142066534 16:88066039-88066061 GTGGGACGACAGAGGCTGCTCGG - Intronic
1142301198 16:89259113-89259135 CCCGGGAGACGGAGGTTGCAGGG - Intergenic
1142340140 16:89516473-89516495 CCTGGTAGGCAGAGGTTGCAGGG + Intronic
1142746616 17:1962431-1962453 CCCGGGAGACGGAGGTTGCAGGG - Intronic
1142885653 17:2910799-2910821 CCTGGGAGACGGAGGTTGCAGGG - Intronic
1143160429 17:4866389-4866411 CTAGGAAGTTGGAGGTTGCAGGG + Intronic
1143215191 17:5219550-5219572 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1143297064 17:5879161-5879183 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1143317365 17:6042547-6042569 CTGAGAAGCCAGAGGGTGTAAGG + Intronic
1143464432 17:7126599-7126621 CTGGGAAGACACCCGTTGCCAGG + Intergenic
1143761729 17:9109260-9109282 CTGGGAAGAAAGAAATTGAATGG - Intronic
1143899062 17:10159859-10159881 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1144264719 17:13556774-13556796 ACCGGAAGGCAGAGGTTGCAGGG + Intronic
1144305682 17:13967354-13967376 GTGGAAAGAGAGAGGTGGCAGGG + Intergenic
1144347255 17:14360388-14360410 CCCGGAAGGCAGAGGTTGCCCGG - Intergenic
1144494307 17:15736976-15736998 CTGGGAGGTCAGACCTTGCAAGG + Intronic
1144789380 17:17848913-17848935 ATGGGCAGACAGAGGTGGCTGGG - Intronic
1144905958 17:18639700-18639722 CTGGGAGGTCAGACCTTGCAAGG - Intronic
1145034708 17:19533141-19533163 CTGTGAAGACTGGGGTTGCCTGG - Intronic
1145281078 17:21467517-21467539 CTGAGAAGACACAGGCTTCATGG + Intergenic
1145396872 17:22503389-22503411 CTGAGAAGACACAGGCTTCATGG - Intergenic
1146085082 17:29820866-29820888 CTGGGAAGAGAGAGGTGACAAGG - Intronic
1146185586 17:30722251-30722273 CTGGGAAGGCTGAGGTGGGAGGG - Intergenic
1146599563 17:34202939-34202961 CTTGGAAGACAGTGGCTGCAGGG + Intergenic
1146883866 17:36458015-36458037 CTGGGAGGTCAGAACTTGCAAGG - Intergenic
1147008528 17:37424427-37424449 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1147113675 17:38282630-38282652 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1147192652 17:38747039-38747061 CTGGGGAGACTGAGGCAGCATGG + Intronic
1147403623 17:40195381-40195403 CTGGGAAGCCAGGGGCTGCAGGG - Exonic
1147537307 17:41328947-41328969 CTGGGAAGAGAGGGGTACCAGGG + Intergenic
1147542199 17:41369725-41369747 CTGGGCAGGCAGAAGTTGTAGGG + Exonic
1147545412 17:41397514-41397536 CTGGGCAGGCAGAAGTTGTAGGG + Exonic
1147613089 17:41812868-41812890 CTGGGAAGACTGAGCTGGCCTGG - Intronic
1147681421 17:42249734-42249756 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1147915945 17:43886030-43886052 CCCGGGAGGCAGAGGTTGCAAGG + Intronic
1148288139 17:46414978-46415000 CTGGGGAGGAGGAGGTTGCAGGG - Intergenic
1148310309 17:46632562-46632584 CTGGGGAGGAGGAGGTTGCAGGG - Intronic
1148323082 17:46769238-46769260 CTCGGGAGGCGGAGGTTGCAGGG + Intronic
1148370650 17:47097315-47097337 CCTGGGAGTCAGAGGTTGCAGGG + Intergenic
1148376229 17:47149001-47149023 CTCGGGAAGCAGAGGTTGCAGGG + Intronic
1148415935 17:47506555-47506577 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1149488488 17:57064468-57064490 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1149525955 17:57355946-57355968 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1149702850 17:58669656-58669678 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1149749140 17:59128548-59128570 CTCGGAAGGCGGAGGTTGCAGGG + Intronic
1149801438 17:59571664-59571686 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1149921532 17:60665045-60665067 CCCAGAAGGCAGAGGTTGCAGGG - Exonic
1150043811 17:61891217-61891239 CCCGGCAGACAGAGGTTGCAGGG + Intronic
1150356076 17:64485990-64486012 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1150377349 17:64692728-64692750 CCTAGGAGACAGAGGTTGCAGGG - Intergenic
1150561515 17:66299456-66299478 CTGGGAAGACAGAGGCCCAAAGG + Intergenic
1150677099 17:67254108-67254130 CCTGGAAGGCAGAGGTTGCAGGG - Intergenic
1151065868 17:71148974-71148996 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1151137141 17:71957611-71957633 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1151738969 17:75966052-75966074 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1151865984 17:76803078-76803100 CCCGGGAGGCAGAGGTTGCAAGG + Intergenic
1152017659 17:77762180-77762202 CTTGGGAGGCGGAGGTTGCAGGG + Intergenic
1152220634 17:79063309-79063331 CTGGGATGAAAGAGGATGCGGGG - Intergenic
1152376403 17:79920982-79921004 CTGAGAAAACAGAGGTGGCAAGG - Intergenic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152832172 17:82504100-82504122 CTCAGAACACAGAGGTTGCAGGG + Intergenic
1153530142 18:6037943-6037965 CTGGGAAGAAAGAAGTTGATAGG + Intronic
1154407671 18:14109029-14109051 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1154971096 18:21410577-21410599 CCCAGAAGGCAGAGGTTGCAGGG + Intronic
1155107782 18:22684709-22684731 CCGTGGAGGCAGAGGTTGCAGGG + Intergenic
1155150543 18:23119292-23119314 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1155151663 18:23127977-23127999 CCTGGGAGACGGAGGTTGCAGGG + Intergenic
1155154222 18:23144614-23144636 CTGAGAAGACTGAGGCTGGATGG + Intronic
1155278249 18:24211039-24211061 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1155973816 18:32107194-32107216 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1156273728 18:35561374-35561396 CCTGGGAGACAGAGATTGCAGGG + Intergenic
1156485047 18:37459908-37459930 CTTGGAAGGCAGAGTTTGAATGG + Intronic
1156894384 18:42229003-42229025 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1157208834 18:45723614-45723636 CTGGGAAGACAGACATTCCAGGG + Intergenic
1157230972 18:45915723-45915745 CTGATAAGACAGAGATTTCAAGG + Intronic
1157259675 18:46167238-46167260 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1157599294 18:48884369-48884391 GTGGAAAGACAGAGGCTCCAGGG + Intergenic
1157617355 18:48995107-48995129 CTGGGAAGGCAGGTCTTGCAGGG - Intergenic
1157716331 18:49890151-49890173 CTGGGAAGACTGGGGTTGGCTGG - Intronic
1158673033 18:59494038-59494060 CTGGGAAGAAAGAGGTTTGATGG - Intronic
1158708344 18:59814867-59814889 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1158843981 18:61420973-61420995 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1158959623 18:62578840-62578862 CCAGGGAGGCAGAGGTTGCAGGG - Intronic
1159019517 18:63131823-63131845 CTGGGAAACCGGAGGATGCAGGG + Intronic
1159041232 18:63324427-63324449 CCAGGAAGTCAGAGGTTGCAGGG + Intergenic
1159209826 18:65304142-65304164 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1159674517 18:71265330-71265352 CCAGGGAGTCAGAGGTTGCAGGG - Intergenic
1159785751 18:72712436-72712458 CTGGGAAGAAAGAGGTTTAATGG + Intergenic
1160071887 18:75636193-75636215 CTGGGATGACAGAGGTGGGAAGG + Intergenic
1160201943 18:76802857-76802879 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1160444778 18:78918882-78918904 CTGGGAAGCCATAGGCTACACGG - Intergenic
1160839837 19:1141288-1141310 CTCGGGAAGCAGAGGTTGCAGGG - Intronic
1160854351 19:1209664-1209686 ATGGGAAGACAGACGCTGGAGGG + Intronic
1160974033 19:1783726-1783748 CAGGGAGAACAGAGGTGGCAGGG + Intronic
1161023913 19:2026182-2026204 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1161052067 19:2169409-2169431 CTGGCCTGAAAGAGGTTGCAGGG + Intronic
1161173925 19:2828589-2828611 CACGGGAGGCAGAGGTTGCAGGG + Intronic
1161215299 19:3092111-3092133 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1161254718 19:3301440-3301462 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1161376679 19:3942658-3942680 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1161604500 19:5207158-5207180 CCCAGGAGACAGAGGTTGCAGGG - Intronic
1162087459 19:8257214-8257236 CCTGGAAGACAGAGGGGGCAGGG - Intronic
1162088952 19:8265406-8265428 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1162374105 19:10294979-10295001 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1162599796 19:11659352-11659374 CACAGAAGGCAGAGGTTGCAGGG - Intergenic
1162654889 19:12121174-12121196 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1162746286 19:12800474-12800496 CTGGGAAGACTGAGTTTGAGAGG + Intronic
1162801496 19:13113232-13113254 CTGGGGAAGCGGAGGTTGCAGGG - Intronic
1162933856 19:13970906-13970928 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG + Intronic
1163562004 19:18024928-18024950 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1163845663 19:19637030-19637052 CTGAGAAGACAGAAGTTTGAAGG + Intronic
1163911890 19:20203016-20203038 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1164634492 19:29782273-29782295 CTGGGGAGCCACAGGCTGCAGGG - Intergenic
1164650314 19:29886632-29886654 AGGGGCAGACTGAGGTTGCAGGG - Intergenic
1164865195 19:31598892-31598914 CTGGGAGGTCAGGGATTGCATGG + Intergenic
1164932735 19:32187829-32187851 CCTGGGAGACAGAGGTTGCAGGG - Intergenic
1165150600 19:33758086-33758108 CTGGCAATTCACAGGTTGCAGGG - Intronic
1165204927 19:34175304-34175326 CTTGGAAGGCAGAGGTTACAGGG - Intronic
1165407046 19:35637419-35637441 CTGTGGAGACAGAGGGTTCAAGG - Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165464867 19:35967993-35968015 CTTGGGAGACAGAGGCTACAGGG - Intergenic
1165585432 19:36911285-36911307 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1165696505 19:37905154-37905176 CCAGGGAGTCAGAGGTTGCAGGG + Intronic
1165767131 19:38358588-38358610 CTGGGGAGACAGAGTATGCCTGG - Intronic
1165874716 19:38998037-38998059 CCCAGGAGACAGAGGTTGCAGGG + Intronic
1166182113 19:41116426-41116448 GTAGGAAGACAGAAGTTACAGGG - Intronic
1166421978 19:42643660-42643682 CCCGGAAGACAGAGGTTGTAGGG + Intronic
1166456261 19:42942550-42942572 CTGGGAAGATGCAGGTTGCCAGG - Intronic
1166533975 19:43560318-43560340 CCCGGGAGGCAGAGGTTGCAAGG + Intronic
1166570296 19:43791632-43791654 CCTGGAAGGCAGAGCTTGCAGGG - Intergenic
1166611342 19:44200387-44200409 CCCGGGAGACAGAAGTTGCAGGG + Intergenic
1166664537 19:44671195-44671217 CTTGGGAGGCAGGGGTTGCAGGG - Intronic
1166983184 19:46643910-46643932 CTTGGGAGGCAGAGGTTGTAAGG - Intergenic
1167056820 19:47116410-47116432 CCCAGGAGACAGAGGTTGCAGGG + Intronic
1167151000 19:47709602-47709624 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1167167194 19:47806442-47806464 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1167256973 19:48436464-48436486 CGGGGGAGCCAGAGGCTGCATGG + Intronic
1167301769 19:48681850-48681872 CAGGGAAGACAGGATTTGCAGGG + Intergenic
1167335039 19:48879976-48879998 CTCGGGAGGCGGAGGTTGCAGGG - Intergenic
1167476433 19:49704245-49704267 TCGGGGAGGCAGAGGTTGCAAGG - Intronic
1167654869 19:50757052-50757074 CTGGGAGGTTGGAGGTTGCAGGG - Intergenic
1167688530 19:50971053-50971075 CTGGGAAGACTGAGGCGGGAGGG - Intergenic
1167939938 19:52938378-52938400 CCCAGGAGACAGAGGTTGCAGGG + Intronic
1167988365 19:53337454-53337476 CCTAGAAGACAGAGGTTGCAGGG - Intronic
1168052642 19:53840880-53840902 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1168108311 19:54177984-54178006 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1168241396 19:55090898-55090920 CTGGGAACACAGAGCTTGAGTGG + Exonic
1168328134 19:55548848-55548870 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1168454919 19:56499228-56499250 CTGGGGAGGCGGAGGTTTCAGGG + Intergenic
1168684192 19:58338082-58338104 CTTGGATGACAAAGGGTGCAGGG - Intronic
925867847 2:8244663-8244685 CTGGGAAGGGAGAGGTTGGTGGG - Intergenic
925915772 2:8604765-8604787 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
925979040 2:9162485-9162507 CTGGGAAGTCAGAGGTTGAGGGG - Intergenic
926107402 2:10160850-10160872 CAGGGCAGACAGAGGTGGCCAGG - Intronic
926326846 2:11792456-11792478 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
926398640 2:12471805-12471827 CCTGGAAGACAGAGGTTGCAAGG - Intergenic
926615185 2:14990346-14990368 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
927026854 2:19077198-19077220 CTGGGAAGGAAAAGGTTGTAGGG + Intergenic
927069684 2:19514604-19514626 CCAGGGAGGCAGAGGTTGCAGGG - Intergenic
927173608 2:20390378-20390400 CTGGAGAGGCAGAGGTTGCAAGG - Intergenic
928155044 2:28868926-28868948 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
928407639 2:31026837-31026859 CTGGGAAGACTGAGGAAGAAAGG - Intronic
928601313 2:32906450-32906472 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
928636536 2:33252189-33252211 CAGGGAAGTAAGAGCTTGCAGGG - Intronic
928975427 2:37082143-37082165 CCGGAAAGGCAGAGGTTGCAAGG - Intronic
929181775 2:39048474-39048496 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
929206664 2:39303612-39303634 CCCAGAAGGCAGAGGTTGCAGGG - Intronic
929489174 2:42381338-42381360 CCCGGGAGACAGAGGTTGCAGGG - Intronic
929518864 2:42629153-42629175 CCTGGGAGACAGAGATTGCAGGG - Intronic
929679146 2:43971022-43971044 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
929789910 2:45014540-45014562 CTGGGCACCCAGACGTTGCAGGG - Intergenic
929962804 2:46509027-46509049 GTGGGAAGACAGTGGCTGGAAGG - Intronic
930436991 2:51357064-51357086 CTTGGCAATCAGAGGTTGCAGGG - Intergenic
931160974 2:59689782-59689804 CTGGGAAGTCCGAGGTTGTGGGG - Intergenic
931307935 2:61050298-61050320 CCCGGGAGGCAGAGGTTGCAGGG + Exonic
931332175 2:61299050-61299072 GTGAGAAAACAGAGGTTTCATGG + Intronic
931352350 2:61503039-61503061 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
931957722 2:67446557-67446579 CTAGGATGACAGCTGTTGCAAGG - Intergenic
932150927 2:69371150-69371172 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
932181675 2:69652086-69652108 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
932207452 2:69895632-69895654 CAGGGGAGGCAGAGATTGCAGGG - Intronic
932218814 2:69984694-69984716 CCTGGGAGATAGAGGTTGCAGGG - Intergenic
932382272 2:71295851-71295873 CCCAGAAGGCAGAGGTTGCAGGG - Intronic
932595076 2:73088496-73088518 CCGGGAAGAGACAGCTTGCAAGG + Exonic
932715122 2:74095082-74095104 CTGGGCAGACAGGGCTTCCAGGG + Intronic
933345817 2:81084349-81084371 CCAGGAAGGCAGAGGTTTCAGGG + Intergenic
934070720 2:88381632-88381654 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
934076190 2:88430575-88430597 CCGGGGAGGCGGAGGTTGCAGGG + Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
934574163 2:95389988-95390010 CTGGGAACACAGCGCTTGGAAGG - Intergenic
934697541 2:96410854-96410876 CTTGGAAGAAACAGGCTGCAGGG - Intergenic
935035648 2:99369898-99369920 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
935058156 2:99585802-99585824 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
935142613 2:100366691-100366713 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
935226091 2:101054378-101054400 ATGGGAAGGCAGGGGGTGCAAGG + Intronic
935293183 2:101626948-101626970 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
935563587 2:104583944-104583966 CTGGGAACACAGAGGATACCAGG - Intergenic
935606347 2:104975336-104975358 CTGGGGAGGCGGAGCTTGCAGGG + Intergenic
935810369 2:106791522-106791544 CTGGGAAAACAGTGTTTGAATGG - Intergenic
935852258 2:107235605-107235627 CTGGGATGACAGAGCTTGGTGGG + Intergenic
936601672 2:113902673-113902695 CCCGGGAGAAAGAGGTTGCAGGG - Intronic
938603129 2:132863651-132863673 CAGGGAAGACAGAGGCTTTAGGG + Intronic
938884465 2:135629238-135629260 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
939300709 2:140333799-140333821 CTAGGTAGACAAAGGTTGGAAGG + Intronic
939444211 2:142287986-142288008 CCCGGGAGGCAGAGGTTGCAAGG - Intergenic
939825818 2:147014544-147014566 CTAGGAACTCAGAGGTTACAGGG - Intergenic
940864194 2:158800913-158800935 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
941395830 2:164971622-164971644 CTGGGAAGAAAGAGGAAGAAAGG - Intergenic
941640121 2:167978181-167978203 CTTGGCAGACAGAGGCTGCATGG + Intronic
941670759 2:168289743-168289765 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
941900803 2:170676387-170676409 CCTGGGAGACGGAGGTTGCAGGG + Intergenic
941915633 2:170811847-170811869 GTCGGGAGGCAGAGGTTGCAGGG - Intergenic
941929157 2:170923810-170923832 CCAGGAAGAATGAGGTTGCATGG + Intergenic
942185964 2:173425630-173425652 CCAGGGAGTCAGAGGTTGCAGGG - Intergenic
942656414 2:178218703-178218725 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
942663307 2:178289091-178289113 CCCAGAAGGCAGAGGTTGCAGGG - Intronic
943032365 2:182700839-182700861 TCTGGAAGGCAGAGGTTGCAAGG + Intergenic
943230826 2:185248923-185248945 CTGGGGAGGTAGAGGTTACAGGG + Intergenic
944125074 2:196283449-196283471 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
944232732 2:197412429-197412451 CCCGGGAGACAGAGGTTGCAGGG - Intronic
944557783 2:200905270-200905292 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
944695853 2:202200004-202200026 CCGGGGAGGCAGAGGTTGCAGGG - Intergenic
944733328 2:202536794-202536816 CCCGGGAGGCAGAGGTTGCAAGG + Intronic
945089547 2:206166055-206166077 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
945217783 2:207453096-207453118 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
945234590 2:207622981-207623003 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
945993731 2:216417994-216418016 CCCGGAAGCCAGAGGTTGCAGGG - Intronic
946615816 2:221508501-221508523 CCCGGGAGACTGAGGTTGCAGGG + Intronic
946625653 2:221609882-221609904 CTTGGAAGACTGAGGTGGGAGGG - Intergenic
946699045 2:222392729-222392751 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
946822752 2:223647263-223647285 CAGGAAAGACAGAGGCTGCAGGG - Intergenic
946891132 2:224278221-224278243 TTCGGAAGACAGAAGATGCAAGG + Intergenic
946988333 2:225300312-225300334 CTGGAAAGACTGAGGAGGCATGG + Intergenic
947267379 2:228298681-228298703 CTGGGGATACAGAAGTTGAAAGG - Intergenic
947511984 2:230764044-230764066 CGGAGGAGGCAGAGGTTGCAGGG + Intronic
947688185 2:232109363-232109385 CCAGGGAGGCAGAGGTTGCAGGG + Intronic
947756072 2:232566260-232566282 CTCGGGAGGCAGAGCTTGCAGGG - Intronic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
948171263 2:235905573-235905595 CCTGGGAGACAGAGATTGCAGGG - Intronic
948758711 2:240176390-240176412 CTTGGAAGGCAGAGGTGGAATGG - Intergenic
949055387 2:241925370-241925392 CTCGGAAGACCGATGTTGGAGGG + Intergenic
1168828561 20:831179-831201 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1169215000 20:3788059-3788081 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1169418545 20:5439657-5439679 CTTGGGAGGCAGAGGTTGCAGGG - Intergenic
1169450851 20:5709654-5709676 CTAGAAAAACAGAGGTGGCATGG + Intergenic
1169642667 20:7772125-7772147 TTGCCAGGACAGAGGTTGCATGG + Intergenic
1169843777 20:9967521-9967543 CTGGTAAGACAGTGGCTTCAAGG - Intergenic
1171240997 20:23566810-23566832 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1171292721 20:23991668-23991690 ACTGGAAGTCAGAGGTTGCAGGG - Intergenic
1172128001 20:32636674-32636696 CGGGGAGGACAGAGGTTCCATGG - Intergenic
1172212011 20:33206686-33206708 CTCTGGAGGCAGAGGTTGCAGGG - Intergenic
1172427018 20:34862439-34862461 TTTGGAGGACAGAGGGTGCAAGG + Intronic
1172427539 20:34865258-34865280 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1172575616 20:36006102-36006124 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1172716617 20:36968977-36968999 CCCGGAAGGCAGAGGTTGCAGGG + Intergenic
1172849020 20:37947295-37947317 ATCTGAAGACAGAGGATGCAAGG - Intergenic
1172977001 20:38913685-38913707 GGAGGAAGACAGAGGCTGCAAGG + Intronic
1173019489 20:39255258-39255280 CCTGGGAGCCAGAGGTTGCAGGG - Intergenic
1173461528 20:43246952-43246974 CTGGGAAGACACAGGCAGTATGG + Intergenic
1173573312 20:44092579-44092601 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1173632665 20:44528339-44528361 CTGGGGAGGCAGAGGCTGCAGGG + Intergenic
1173797916 20:45875575-45875597 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1173856721 20:46255095-46255117 CCGGGGAGGCGGAGGTTGCAGGG - Intronic
1174055418 20:47795033-47795055 CCAGGAAGTCGGAGGTTGCAGGG - Intergenic
1174199055 20:48794387-48794409 CTGGGAAGACAGAGCTAACCAGG + Intronic
1174213655 20:48899576-48899598 CTCGGGAGGTAGAGGTTGCAGGG - Intergenic
1174369038 20:50073881-50073903 CTCGGGAGGCGGAGGTTGCATGG - Intergenic
1174834762 20:53846607-53846629 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1174863833 20:54116463-54116485 CTGGGGAGGGAGAGGTTGTAGGG + Intergenic
1175028607 20:55929859-55929881 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1175345979 20:58276337-58276359 CCCAGAAGACAGAGGTTGCAGGG + Intergenic
1175382806 20:58575372-58575394 CTAGGGAGGCAGAGGTTGCAGGG + Intergenic
1175405303 20:58722244-58722266 CTGAGAGGGCAGAGGGTGCAGGG - Intergenic
1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG + Intronic
1175786765 20:61716830-61716852 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1175811395 20:61860333-61860355 CAGGGAAGACAGGGATTGCCAGG - Intronic
1175853685 20:62107423-62107445 CTGGGAAGGCAGGGGGTGCCTGG + Intergenic
1175902599 20:62366026-62366048 CCGGGAAGGCAGAGGTACCAGGG + Intronic
1176138918 20:63536762-63536784 CAGGGAGGACAGAGGGTCCAGGG - Intronic
1176192500 20:63818780-63818802 ACTGGAAGGCAGAGGTTGCAAGG + Intronic
1176675765 21:9775847-9775869 CCAGGAAGTCAGAGATTGCAGGG - Intergenic
1178138772 21:29658336-29658358 CTCAGGAGGCAGAGGTTGCAGGG - Intronic
1178194905 21:30333444-30333466 CCCGGGAGACAGAGTTTGCAGGG + Intergenic
1178335544 21:31739436-31739458 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1178357511 21:31921074-31921096 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1178524992 21:33320176-33320198 CTGAGGAGGCAGAGGTTGCTGGG + Intergenic
1178576840 21:33800939-33800961 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1178861785 21:36295862-36295884 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1178972851 21:37196310-37196332 CTCGGGAGGGAGAGGTTGCAGGG - Intronic
1179676056 21:42982883-42982905 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1180065914 21:45412310-45412332 CCCGGAAGATGGAGGTTGCAGGG - Intronic
1180915822 22:19486095-19486117 CCCAGAAGACAGAGGTTGAAGGG - Intronic
1180937117 22:19633139-19633161 CTGAGAAGGCTGAGGTAGCAGGG + Intergenic
1180994135 22:19956450-19956472 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1181016755 22:20074422-20074444 CCCGGCAGGCAGAGGTTGCAGGG + Intergenic
1181083401 22:20428378-20428400 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1181084848 22:20435137-20435159 CAGGGAAGACTCAGGGTGCAAGG - Intronic
1181302779 22:21893248-21893270 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1181399276 22:22641565-22641587 ACTGGAAGTCAGAGGTTGCAGGG + Intergenic
1181492026 22:23266463-23266485 CCTGGGAGGCAGAGGTTGCAAGG - Intronic
1181679184 22:24479818-24479840 CCCAGGAGACAGAGGTTGCAGGG + Intergenic
1181707234 22:24656242-24656264 ACTGGAAGTCAGAGGTTGCAGGG + Intergenic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1182291230 22:29281410-29281432 CTTGGAAGACTGAGGTGGGAGGG - Intronic
1182299554 22:29330015-29330037 CTGGGAGGACAGTGGTTCCCAGG - Intronic
1182401851 22:30084287-30084309 CTGGTAAGACAGAGAGAGCAAGG + Intronic
1182472846 22:30559314-30559336 CCGGGGAGTCAAAGGTTGCAGGG - Intronic
1182497489 22:30720063-30720085 CAATGAGGACAGAGGTTGCACGG - Intronic
1182975946 22:34624214-34624236 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1183322085 22:37171057-37171079 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1183692619 22:39399463-39399485 GCCGGAAGGCAGAGGTTGCAGGG + Intergenic
1183995008 22:41626528-41626550 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1184239964 22:43206790-43206812 CTGGGGGGACAGAGATTGCGGGG + Intronic
1184435039 22:44467701-44467723 CTGGAGAGGCAGAGGTTGCAGGG - Intergenic
1184493456 22:44823852-44823874 CTGGCAACACTGAGGGTGCAGGG + Intronic
1184605435 22:45571043-45571065 CTTGGGAGGCGGAGGTTGCAGGG + Intronic
1185082678 22:48718508-48718530 CAGGGCAGACACAGGTCGCACGG - Intronic
1185133740 22:49056589-49056611 CAGGGCTCACAGAGGTTGCAGGG + Intergenic
1185379520 22:50501928-50501950 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
949624973 3:5855150-5855172 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
949639907 3:6024607-6024629 CTGGGAAGACAAAGATTGAGGGG + Intergenic
950181025 3:10913387-10913409 CTGGGAAGTCAGAGGTGGGGAGG + Intronic
950227185 3:11245275-11245297 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
950467136 3:13162244-13162266 CTTGGAAGACAGAGGGAGAAGGG + Intergenic
950468382 3:13169363-13169385 CTGGGAAGAAATAGGTTTAATGG - Intergenic
950645814 3:14376121-14376143 CCCGGGAGACGGAGGTTGCAGGG - Intergenic
950832107 3:15885219-15885241 CTGGGAAGAAAAAGGTTTAATGG + Intergenic
951000710 3:17556088-17556110 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
951072559 3:18349419-18349441 CTGGGCAGACAGAGTCTGGATGG + Exonic
951097513 3:18649134-18649156 CTCTGGAGGCAGAGGTTGCAGGG + Intergenic
951204977 3:19916437-19916459 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
951629354 3:24702321-24702343 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
951957251 3:28271004-28271026 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
952292881 3:32035484-32035506 CTTGGGAGGCAGAGGATGCAGGG + Intronic
952385647 3:32839766-32839788 CTGGCAAGTCAGAGGTTGCTGGG + Intronic
952716546 3:36485990-36486012 CTGGGTAGACAGGGCTTTCATGG - Intronic
952767434 3:36966642-36966664 CCCGGGAGGCAGAGGTTGCAAGG + Intergenic
953321234 3:41973791-41973813 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
953537702 3:43788649-43788671 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
953853248 3:46481673-46481695 CCTGAAAGGCAGAGGTTGCAGGG + Intronic
954014330 3:47673312-47673334 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
954184505 3:48906498-48906520 CTCGGGAGGCAGAGTTTGCAGGG - Intergenic
954205633 3:49057044-49057066 CTGGAAAGAGAGAGTTTGCAAGG + Exonic
954331897 3:49895632-49895654 CTGGGCAGAGAGAGGATGTAGGG + Intronic
954464205 3:50645253-50645275 CAGGGAAGACAAAGGCTCCATGG + Intronic
954676883 3:52320874-52320896 CCCGGGAGACAGAGGTTGCAAGG - Intronic
956277780 3:67521693-67521715 CATGGGAGGCAGAGGTTGCAGGG - Intronic
956546748 3:70411714-70411736 CTGGCAAGACAGTGCATGCAGGG - Intergenic
957399001 3:79684749-79684771 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
957739230 3:84241932-84241954 CTCGGGAGGCAGAGGTTGCAGGG + Intergenic
957837684 3:85618963-85618985 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
957893731 3:86391357-86391379 CCTGGGAGACGGAGGTTGCAGGG + Intergenic
959572413 3:107899190-107899212 CTGGTAAGGCAGAGCTGGCAGGG - Intergenic
959696259 3:109252297-109252319 CTCTCAAGTCAGAGGTTGCATGG + Intergenic
959705259 3:109333264-109333286 CTCGGGAGGCACAGGTTGCAGGG + Intronic
960630332 3:119724090-119724112 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
960638111 3:119803831-119803853 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
960794558 3:121471664-121471686 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
960994836 3:123333798-123333820 TTGGGAAGTCAGAGTTTGCAGGG - Intronic
961043521 3:123693694-123693716 CTGGGATGAGAGAGCTGGCAGGG - Intronic
961391087 3:126552729-126552751 GTGGGAAGCTTGAGGTTGCACGG + Intronic
961486983 3:127223503-127223525 CTGTGAAGACAGATGTGGGAGGG + Intergenic
961927668 3:130498511-130498533 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
962126493 3:132624760-132624782 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
963226827 3:142871057-142871079 CAGGGAAGACAGAGGTGGAGCGG - Intronic
963273409 3:143307633-143307655 CTGGGAACAGAAAGGCTGCAGGG - Intronic
963435761 3:145263544-145263566 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
964976728 3:162630319-162630341 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
965574812 3:170207033-170207055 CCTGGGAGACGGAGGTTGCAGGG + Intergenic
965688788 3:171333479-171333501 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
965910761 3:173772540-173772562 CCTGGGAGACGGAGGTTGCAGGG + Intronic
966203943 3:177387095-177387117 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
966729694 3:183140329-183140351 CACGGGAGGCAGAGGTTGCAGGG + Intronic
966773861 3:183527021-183527043 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
966852914 3:184175512-184175534 CTGGGGAGACAGAGCCTGCTTGG - Intronic
966883174 3:184361267-184361289 CTTGGAAGTCTGAGGCTGCAGGG - Intronic
967355733 3:188568862-188568884 GTGGGCAGACAGTGGCTGCAGGG + Intronic
967860489 3:194147786-194147808 ATGGGAAGAGAGAGGCCGCAGGG - Intergenic
968074324 3:195808289-195808311 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
968297305 3:197586646-197586668 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
968514031 4:1008975-1008997 CTGGGAAGACAGAGGTGGCCAGG - Intergenic
968614233 4:1570167-1570189 CTGGGTAGGAAGAGGGTGCAAGG + Intergenic
968821215 4:2853182-2853204 CCTGGGAGACAGAGGTTGCAGGG - Intronic
969081769 4:4624640-4624662 CTGGGAAGGCAGAAGGTGAAAGG + Intergenic
969084565 4:4646264-4646286 TTGGGAAGAAAGATATTGCATGG + Intergenic
969216673 4:5728653-5728675 CTGGGAAGACTGAGGTTCAGAGG + Intronic
969261150 4:6034723-6034745 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
969353492 4:6611716-6611738 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
969393556 4:6906794-6906816 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
970246019 4:14064382-14064404 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
970460272 4:16268194-16268216 CTGCGAAGACACAGGCTCCAGGG - Intergenic
970615003 4:17760749-17760771 CTGGTAAGCCAGAGTTTCCAAGG - Intronic
970708945 4:18839238-18839260 CCGGGGAGGCAGAGGATGCAGGG + Intergenic
970939611 4:21616082-21616104 CTGGGGAGCCAGAGCTTGTAGGG - Intronic
971482699 4:27128370-27128392 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
971604910 4:28646124-28646146 GTGTGAAGGCAGAGATTGCATGG - Intergenic
971915264 4:32862093-32862115 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
971981654 4:33759091-33759113 CCTGGAAGACGGAGCTTGCAGGG - Intergenic
972052682 4:34758817-34758839 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
972377760 4:38489073-38489095 CTGGGAAGGCTGGGGTTGCAGGG - Intergenic
972436120 4:39037176-39037198 CCTGGAAGGCGGAGGTTGCAGGG - Intergenic
972495408 4:39629697-39629719 CTGGGGAGGCTGAGGCTGCAGGG - Intronic
972820293 4:42694222-42694244 CCTGGGAGACAGAGGTTGCAGGG - Intergenic
972822589 4:42718807-42718829 CTGGGAAAACAGATGTTTCAGGG + Intergenic
972823248 4:42726702-42726724 CCCTGAAGGCAGAGGTTGCAGGG - Intergenic
972925070 4:43994343-43994365 ATGGGAAGAGTGAGGTTGGAGGG + Intergenic
973320239 4:48802643-48802665 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
973342492 4:49019653-49019675 CCCAGAAGGCAGAGGTTGCAGGG - Intronic
973765741 4:54160465-54160487 CTGGGAAGTCCAAGGTTGAAAGG - Intronic
973976807 4:56271027-56271049 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
974056232 4:56985474-56985496 CCCAGGAGACAGAGGTTGCAGGG - Intronic
974090505 4:57305817-57305839 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
974240108 4:59235861-59235883 CTGGGAAGACGCCTGTTGCAAGG - Intergenic
974493359 4:62595467-62595489 CTGGGAAGACACCTGTTGCCAGG + Intergenic
974874561 4:67687109-67687131 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
975056771 4:69943257-69943279 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
975280930 4:72561269-72561291 CCCAGAAGGCAGAGGTTGCAGGG + Intronic
975758925 4:77598881-77598903 CTCGGGAGGCAGAGGTTGCAGGG - Intronic
975882501 4:78927202-78927224 GTGGGAAGACAGAGCTCTCAAGG + Intronic
976048147 4:80977680-80977702 CCGGGGAGGCAGAGGTTGCAGGG - Intergenic
976291423 4:83422142-83422164 CCCAGGAGACAGAGGTTGCAGGG + Intronic
976648776 4:87413045-87413067 CTGTGAAGACAGATGTTACATGG + Intergenic
976730825 4:88259188-88259210 CCCGGGAGGCAGAGGTTGCAGGG + Exonic
977872799 4:102113342-102113364 CCGGGGAGGTAGAGGTTGCAGGG - Intergenic
978061522 4:104345362-104345384 CTGGGAAGAATGAGGTTACATGG - Intergenic
979021088 4:115499065-115499087 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
979168865 4:117573496-117573518 CATGGGAGGCAGAGGTTGCAGGG + Intergenic
979237317 4:118415906-118415928 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
980134381 4:128845846-128845868 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
980693160 4:136321403-136321425 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
980693856 4:136330119-136330141 CCTGGGAGTCAGAGGTTGCAGGG + Intergenic
981057536 4:140380271-140380293 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
981093954 4:140759582-140759604 CACGGGAGACGGAGGTTGCAAGG + Intergenic
981312747 4:143312989-143313011 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
981999772 4:151011520-151011542 CTCAGGAGGCAGAGGTTGCAGGG + Intronic
982329888 4:154169687-154169709 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
982394644 4:154903317-154903339 CAGGAAAGACAGAGAATGCAGGG + Intergenic
982472023 4:155804119-155804141 CTGGGGAGATAGAGATTTCATGG + Intronic
982631647 4:157838014-157838036 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
982687345 4:158506808-158506830 CCTGGGAGGCAGAGGTTGCAAGG + Intronic
982979569 4:162115592-162115614 CTGTGAAGATGGAGGTTACAAGG - Intronic
983011267 4:162550576-162550598 CTGGGAAGACACCCGTTGCTAGG + Intergenic
983018677 4:162647252-162647274 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
983608220 4:169614345-169614367 CCTGGAAGGCGGAGGTTGCAGGG - Intronic
983614204 4:169683817-169683839 CCTGGAAGGCAGAGGTTGCAGGG - Intronic
983739974 4:171118055-171118077 CTGGAAAGACAGATGTGACATGG + Intergenic
984021000 4:174484704-174484726 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
984243604 4:177248069-177248091 CTTGGGAGGCGGAGGTTGCAGGG - Intronic
984779090 4:183507174-183507196 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
984919954 4:184754765-184754787 CTTGGGAGGCAGAGGTTGCGGGG + Intergenic
984996350 4:185434109-185434131 CTCGGGAGGCGGAGGTTGCAGGG + Intronic
985066550 4:186127759-186127781 CTTGGAAGGCAGAGGTTGCAGGG - Intronic
985110695 4:186544082-186544104 GGGGGACGGCAGAGGTTGCAGGG - Intronic
985482360 5:122493-122515 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
986691869 5:10319949-10319971 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
987836726 5:23171984-23172006 CTGGCAAGAGAGATGTTGGATGG - Intergenic
988006328 5:25416546-25416568 CTTGGGAGGCAGAGGTTGCAGGG - Intergenic
988150103 5:27365713-27365735 CTGGGAAGAAAGAGGTTTAATGG - Intergenic
988321150 5:29698322-29698344 TTGGGAAGAGTGAGGTTGTAAGG - Intergenic
988592294 5:32559068-32559090 CTCGGGAGGCAGAGGTTGCAGGG + Intronic
988856803 5:35234965-35234987 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
989060804 5:37409578-37409600 CCCAGAAGTCAGAGGTTGCAGGG - Intronic
989107507 5:37877663-37877685 CTGGGAGGGAAGAGGTTCCAGGG - Intergenic
989571356 5:42948894-42948916 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
990063084 5:51676326-51676348 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
990294885 5:54390940-54390962 CTGGGAAGAAAAAGGTTTAATGG - Intergenic
990407530 5:55505979-55506001 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
990540544 5:56768596-56768618 TTGAGTAGACAGAGGTTGTATGG + Intergenic
990574162 5:57108651-57108673 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
991042275 5:62188292-62188314 CTGGGAAACCAGAGCCTGCAGGG + Intergenic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
991698633 5:69297139-69297161 CTTGGGAGGCAGAAGTTGCAGGG - Intronic
992172925 5:74121972-74121994 CTGGGAAGAGAGAGTTTGCTGGG - Intergenic
992432147 5:76719511-76719533 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
992911294 5:81398473-81398495 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
994217376 5:97153092-97153114 CTGGGGAGACTGAGGTGGGAGGG - Intronic
994351422 5:98750672-98750694 TTCGGGAGGCAGAGGTTGCAGGG + Intergenic
994382211 5:99084869-99084891 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
994415093 5:99459676-99459698 CTTGGAAGGCGGAGGTTACAGGG - Intergenic
996455977 5:123681395-123681417 CTGGGAAGATAGCTGTTGCATGG + Intergenic
997052782 5:130402313-130402335 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
997116657 5:131132462-131132484 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
997514412 5:134476504-134476526 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
997937945 5:138130848-138130870 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
998397016 5:141825242-141825264 CTGAGCAGAGAGAAGTTGCAGGG - Intergenic
998630370 5:143891592-143891614 GTGGGATGACAGAGGTTGAATGG - Intergenic
999045666 5:148466609-148466631 TAGGGAGGACTGAGGTTGCAAGG - Intronic
999208706 5:149869252-149869274 CTCGGGAGGCGGAGGTTGCAGGG + Intronic
999290392 5:150421741-150421763 CTCAGGAGGCAGAGGTTGCAGGG - Intergenic
999976777 5:156919684-156919706 ATGGGAAAACTGAGGCTGCAGGG + Intronic
1000317383 5:160105460-160105482 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1000385576 5:160671906-160671928 GTGGGAAGGCTGAGGCTGCAGGG - Intronic
1000505120 5:162107000-162107022 TTGGGAAGGCAGAGGTTGGGAGG - Intronic
1000757051 5:165174622-165174644 CTGGGAGGGCGGAGGTTGCAGGG - Intergenic
1001287099 5:170431680-170431702 CCTGGAAGACAGAGGTTGCCGGG + Intronic
1001523929 5:172415240-172415262 CTCAGAAGACAAAGGTTGCACGG + Intronic
1001802541 5:174556652-174556674 CCTGGAAGGCGGAGGTTGCAGGG + Intergenic
1002127947 5:177060730-177060752 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1002182306 5:177437028-177437050 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1002239852 5:177831147-177831169 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1002399863 5:178985625-178985647 CCCGGAAGGCAGAGCTTGCAGGG + Intronic
1003042253 6:2699365-2699387 CTCGGGAGATGGAGGTTGCAGGG - Intronic
1003101219 6:3177828-3177850 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1003289860 6:4771187-4771209 CCCGGGAGGCAGAGGTTGCAAGG - Intronic
1003310887 6:4968960-4968982 CTTGGGAGATGGAGGTTGCAGGG + Intergenic
1003636441 6:7835910-7835932 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1003906411 6:10704096-10704118 CTCAGAAGGCAGAGGTTGTAGGG - Intronic
1004215458 6:13699784-13699806 CTTGGGAGGCAGAAGTTGCAAGG + Intronic
1004227003 6:13794724-13794746 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1004394890 6:15239151-15239173 CCCAGGAGACAGAGGTTGCATGG - Intergenic
1004444033 6:15681394-15681416 CCCAGGAGACAGAGGTTGCAGGG - Intergenic
1004468050 6:15904029-15904051 CCTGGTAGGCAGAGGTTGCAGGG + Intergenic
1004726803 6:18318926-18318948 CCGGGGAGGCAGAGGTTGCGGGG - Intergenic
1004946495 6:20619252-20619274 ATAGAAAGCCAGAGGTTGCAAGG + Intronic
1004956591 6:20734071-20734093 CCTGGGAGATAGAGGTTGCAGGG + Intronic
1005354959 6:24973519-24973541 CCTGGAAGGCAGAGATTGCAGGG + Intronic
1005579130 6:27216970-27216992 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1005622074 6:27629312-27629334 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
1005756094 6:28926017-28926039 CCTGGGAGACAGAGGTTGCAGGG + Intergenic
1006080589 6:31563681-31563703 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1006125627 6:31836036-31836058 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1006450477 6:34103121-34103143 ATGGGGAGACAGAGGTGGCATGG - Intronic
1006695613 6:35928041-35928063 CCTGGGAGACAGAGGTTTCAGGG + Intergenic
1006765959 6:36507289-36507311 GTGTGAAGGCAGAGGTTGAAAGG - Intronic
1006847682 6:37074177-37074199 CTGGGAAGTGGGAGGTTGCTGGG + Intergenic
1006851866 6:37104286-37104308 CCCGGGAGGCAGAGGTTGCACGG - Intergenic
1006994464 6:38245471-38245493 GTGGGAAAACAGAGGATGCCAGG + Intronic
1007178478 6:39912214-39912236 ATGAGAACACAGAGGTGGCAAGG + Intronic
1007285688 6:40745875-40745897 CTGGGAAATGTGAGGTTGCAGGG - Intergenic
1007362635 6:41369772-41369794 CCCGGAAGGCGGAGGTTGCAGGG + Intergenic
1007393568 6:41564341-41564363 CCCGGGAGACGGAGGTTGCAGGG + Intronic
1007720898 6:43884917-43884939 CTGGGGAGACATGGGTTGGATGG - Intergenic
1007744835 6:44037237-44037259 CTCGGGAGGCGGAGGTTGCAGGG + Intergenic
1008063234 6:47020418-47020440 CCCGGTAGGCAGAGGTTGCAGGG + Intronic
1008355877 6:50552588-50552610 CTGGGAAGACACAGCATTCAAGG - Intergenic
1008504232 6:52213599-52213621 TTGGGAAGACAAAGGTAGAAAGG + Intergenic
1009959927 6:70506876-70506898 CTGGGAAGAGAATGGTCGCAAGG + Intronic
1010022142 6:71173209-71173231 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1010231516 6:73539364-73539386 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1010391208 6:75339870-75339892 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1010442921 6:75919041-75919063 CGCGGGAGGCAGAGGTTGCAGGG + Intronic
1010830947 6:80528252-80528274 ATTGGGAGACAGAGCTTGCAGGG + Intergenic
1011328350 6:86175292-86175314 CTGGGAAGACAACCGTTGCCAGG - Intergenic
1012384754 6:98667207-98667229 CTGGGAAGTCAAAGGCTGAAAGG - Intergenic
1012405392 6:98890841-98890863 CTAGGGAGGCGGAGGTTGCAGGG + Intronic
1012638090 6:101572922-101572944 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1013074520 6:106759491-106759513 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1013137580 6:107297456-107297478 CTTGGGAGGCGGAGGTTGCAGGG - Intronic
1013485896 6:110595658-110595680 CCTGGTAGGCAGAGGTTGCAGGG + Intergenic
1014011058 6:116476026-116476048 CCAGGGAGTCAGAGGTTGCAGGG + Intergenic
1014109773 6:117607538-117607560 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1014253080 6:119134810-119134832 CTGGGGAGAGAGAGGTTCCAGGG + Intronic
1014261638 6:119225049-119225071 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1015144266 6:129968024-129968046 CTGGAGAAACAGAGTTTGCAAGG + Intergenic
1015274145 6:131367124-131367146 CTCGGAAGGCTGAGGTGGCAGGG + Intergenic
1015284109 6:131465336-131465358 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1015917882 6:138236548-138236570 CTGGGAAGGTAGAGGCTACAAGG - Intronic
1016466297 6:144328857-144328879 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1016478334 6:144453196-144453218 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1016763117 6:147762279-147762301 ACTTGAAGACAGAGGTTGCAGGG - Intergenic
1017103585 6:150867871-150867893 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1017309010 6:152955051-152955073 CTTGGGAGGCTGAGGTTGCAGGG + Intergenic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1018087086 6:160312193-160312215 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1018379301 6:163243279-163243301 CTGTGAGGACAGAAGTTCCACGG + Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018701778 6:166432917-166432939 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1018868254 6:167761755-167761777 CTGGGTTGAGAGAGGCTGCATGG - Intergenic
1019503390 7:1376952-1376974 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1019773203 7:2896628-2896650 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1019920839 7:4162473-4162495 CACGGGAGGCAGAGGTTGCAGGG - Intronic
1019974595 7:4570576-4570598 CTGGGGATGCAGAGGTTGCAAGG + Intergenic
1020003043 7:4766375-4766397 CTGGGAAGACACTGGTGGCGGGG + Exonic
1020016761 7:4835906-4835928 CTGGGCAGATAGGGGTGGCATGG + Intronic
1020031367 7:4935108-4935130 CCCGGGAGGCAGAGGTTGCACGG + Intronic
1020058275 7:5133644-5133666 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1020063464 7:5169649-5169671 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1020169832 7:5836511-5836533 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1020176324 7:5885042-5885064 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020190871 7:5996477-5996499 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020460453 7:8424197-8424219 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1020705949 7:11544264-11544286 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020830588 7:13089842-13089864 CCCGGAAGGCAGAGGTTGCAGGG + Intergenic
1021484158 7:21148562-21148584 CCGGGAAGATGGAGGTCGCAAGG - Intergenic
1021679474 7:23115617-23115639 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1021696685 7:23282933-23282955 CTCGGCAGGCAGAGGTTGCAGGG + Intergenic
1023628090 7:42136682-42136704 CGGGGAGGGCAGAGGTAGCAAGG + Intronic
1023647165 7:42330092-42330114 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1023787480 7:43722473-43722495 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1023904890 7:44514935-44514957 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1024437966 7:49381454-49381476 CAGGGAAGACAGGGCATGCATGG + Intergenic
1025155915 7:56605849-56605871 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1025938210 7:66054008-66054030 CCCGAAAGGCAGAGGTTGCAGGG - Intergenic
1025988968 7:66480613-66480635 CCTGGGAGACAGAGGTTGCAGGG - Intergenic
1026131609 7:67625621-67625643 CGGGGAAGACGGAGGGTTCAAGG - Intergenic
1026286008 7:68963446-68963468 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1026452025 7:70537881-70537903 CTGGGAAGATGGAGAATGCACGG + Intronic
1026560685 7:71445612-71445634 TTGGGAAGAAACAGGCTGCAAGG + Intronic
1026739440 7:72969591-72969613 CTGGAACTACAGAGGTCGCACGG - Intergenic
1026748779 7:73033447-73033469 CCCGGGAGGCAGAGGTTGCAAGG + Intergenic
1026752427 7:73061592-73061614 CCCGGGAGGCAGAGGTTGCAAGG + Intergenic
1026756078 7:73089719-73089741 CCCGGGAGGCAGAGGTTGCAAGG + Intergenic
1026772563 7:73211678-73211700 CCTGGTAGGCAGAGGTTGCAGGG - Intergenic
1027005054 7:74685689-74685711 CCCGGAAGGCCGAGGTTGCAGGG + Intronic
1027013427 7:74765078-74765100 CCTGGTAGGCAGAGGTTGCAGGG - Intergenic
1027034975 7:74918713-74918735 CCCGGGAGGCAGAGGTTGCAAGG + Intergenic
1027074611 7:75180955-75180977 CCTGGTAGGCAGAGGTTGCAGGG + Intergenic
1027091327 7:75303710-75303732 CCCGGGAGGCAGAGGTTGCAAGG - Intergenic
1027094971 7:75331681-75331703 CCCGGGAGGCAGAGGTTGCAAGG - Intergenic
1027104291 7:75395482-75395504 CTGGAACTACAGAGGTCGCACGG + Intronic
1027202158 7:76070979-76071001 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1027211931 7:76156631-76156653 CCTGGGAGACAGAGGTTGCAGGG - Intergenic
1027220419 7:76210392-76210414 CAGGGAAGAGAGAGGTTTCTGGG - Intronic
1027324368 7:77035993-77036015 CCCGGGAGGCAGAGGTTGCAAGG + Intergenic
1027390838 7:77702039-77702061 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1028035713 7:85979131-85979153 CTCAGAAGACAGAGGTGGGAGGG + Intergenic
1028558903 7:92151871-92151893 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1028933781 7:96443049-96443071 CCTGGAAGGCAGTGGTTGCAAGG + Intergenic
1028989796 7:97036764-97036786 CTGAGGAGGCAGAAGTTGCAGGG - Intergenic
1029170110 7:98624583-98624605 GAGGGAAGGCAGAGGATGCAGGG - Intronic
1029244178 7:99186665-99186687 CCCAGGAGACAGAGGTTGCAGGG + Intronic
1029505898 7:100963960-100963982 CTGGAAGGAGAGAAGTTGCAGGG + Intronic
1029531424 7:101127768-101127790 CTGGGGAGGCGGAGGCTGCAGGG + Intronic
1030876314 7:114817656-114817678 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1031039884 7:116828422-116828444 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1031346364 7:120671741-120671763 CTGGCAAAACAGTGGTTGAAAGG - Intronic
1031622492 7:123951695-123951717 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1031936139 7:127737497-127737519 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1032200418 7:129818647-129818669 CCTGGGAGGCAGAGGTTGCAAGG - Intergenic
1032376745 7:131427627-131427649 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1032496749 7:132368532-132368554 CTGGGCAGACAGAGGGTGACAGG - Intronic
1032559460 7:132873487-132873509 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1032862536 7:135894102-135894124 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1033064918 7:138145475-138145497 CCCGGAAGGCAGAGATTGCAAGG - Intergenic
1033796881 7:144855965-144855987 CCTGGGAGACAGAGGTTGCAGGG - Intergenic
1034052516 7:147998185-147998207 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1034066716 7:148144024-148144046 CTGGAAACACAGAGATTCCAGGG + Intronic
1034119646 7:148615973-148615995 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034641506 7:152607678-152607700 CATGGGAGACGGAGGTTGCAGGG - Intergenic
1034761415 7:153675377-153675399 CTGGGACGCCAGAGGATCCAGGG + Intergenic
1035289035 7:157825374-157825396 CTGGGACCTCAGAGGCTGCAAGG + Intronic
1035772259 8:2156968-2156990 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1035987115 8:4446469-4446491 CTTGGGAGACTGAGGCTGCAGGG + Intronic
1036181949 8:6593428-6593450 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1036399269 8:8393699-8393721 CTGAGAAGGTGGAGGTTGCAGGG + Intergenic
1036462153 8:8962986-8963008 CTGGGCAAAGAGAGGATGCATGG + Intergenic
1036911673 8:12762469-12762491 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1036965325 8:13290982-13291004 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1037079437 8:14765880-14765902 CTTGGAGGAGAGAGGTTGCCAGG + Intronic
1037254579 8:16938901-16938923 CCCAGGAGACAGAGGTTGCAGGG + Intergenic
1037342499 8:17861424-17861446 CTGGGGAGGTGGAGGTTGCAGGG - Intergenic
1037475849 8:19256939-19256961 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
1037805733 8:22057127-22057149 CTGGGAAGAGGTAGGTGGCAGGG + Intronic
1037806807 8:22062508-22062530 CAGGAAAGACTGAGGCTGCAGGG - Intronic
1038141558 8:24850585-24850607 CCCAGGAGACAGAGGTTGCAGGG + Intergenic
1038231905 8:25708375-25708397 CAGGGAAGAAAGAGATTGGAAGG + Intergenic
1038234493 8:25738808-25738830 CTGGGAAGAGAATGGGTGCAAGG - Intergenic
1038575270 8:28699582-28699604 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1038672434 8:29592995-29593017 CTCAGAAGGCAGAGGCTGCAGGG + Intergenic
1039194066 8:35010560-35010582 CATGGTAGGCAGAGGTTGCAGGG + Intergenic
1039417482 8:37408133-37408155 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1039425487 8:37481945-37481967 CAGAGAAGGCGGAGGTTGCAGGG - Intergenic
1039495013 8:37974070-37974092 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1039991822 8:42494920-42494942 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1040538079 8:48327027-48327049 CTGGGGACACAGAGGTTGCCTGG - Intergenic
1040762289 8:50863540-50863562 CTGGGAAGACAAAGATTTCCTGG - Intergenic
1040859197 8:51981928-51981950 CCGGGAGGGCAGAGGTTGCAGGG - Intergenic
1041246893 8:55896812-55896834 CCCGGAAGGCAGAGGTTGCGGGG - Intronic
1041266363 8:56069372-56069394 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1041382487 8:57265350-57265372 CTGGGAAGTCCAAGGTTACAGGG + Intergenic
1041502666 8:58555547-58555569 CTGGGCAGACACAGATTTCACGG - Intronic
1042078083 8:65018008-65018030 CAGGGAAAACAGAGGTAGCTAGG + Intergenic
1042182699 8:66107824-66107846 CTGGGAGGAAGGAGGTTGAAAGG - Intergenic
1042242791 8:66681698-66681720 CTGGGGAGGCGGTGGTTGCAGGG - Intronic
1042579223 8:70258023-70258045 CTGGGGAGACTGAGGTGGGAGGG - Intronic
1042810992 8:72824779-72824801 CTGGGAAGAGAGAGAGTGGATGG + Intronic
1043253241 8:78102075-78102097 CTTGGGAGGCGGAGGTTGCAGGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043511699 8:80956609-80956631 CTGGGAACACTGAGGGTGGAGGG + Intergenic
1043755402 8:83997526-83997548 AGAGGGAGACAGAGGTTGCAGGG + Intergenic
1043968226 8:86503274-86503296 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
1044649575 8:94480398-94480420 CCCGGAAGGCAGAGGTTGCAGGG + Intergenic
1045230393 8:100300543-100300565 CTTGGAAGGCTGAGGTGGCAGGG + Exonic
1045341334 8:101257358-101257380 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1045941705 8:107746225-107746247 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1046461061 8:114536770-114536792 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1046641494 8:116736584-116736606 CCGGGGAGGCAGAGTTTGCAGGG + Intronic
1047236019 8:123042442-123042464 GTGGGAAAACAGTGGTTGCCTGG + Intronic
1047269816 8:123345604-123345626 CCCGGAAGGCGGAGGTTGCAGGG + Intronic
1047322195 8:123796983-123797005 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1047497933 8:125421822-125421844 ACCGGAAGGCAGAGGTTGCAGGG + Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1048223348 8:132563231-132563253 CTGGGGAGAGGGATGTTGCAGGG + Intergenic
1048255436 8:132901633-132901655 CTGGGAAGGCAGGGGTGGGAGGG + Intronic
1048334930 8:133495573-133495595 CTGGGTAGACAAAGAATGCAAGG + Intronic
1048611495 8:136027873-136027895 CAGGAAAGACAGAGGTGGCTTGG + Intergenic
1048891745 8:138954399-138954421 CTAGGGAGGCTGAGGTTGCAGGG + Intergenic
1049250667 8:141587254-141587276 CTGGGGACACAGAGGTTGGCAGG + Intergenic
1049401655 8:142430337-142430359 CAGGGGAAACACAGGTTGCAGGG - Intergenic
1049516270 8:143058781-143058803 CTGGGAAGACGCCGGTTGCCAGG - Intronic
1049793978 8:144488104-144488126 CTGGAAAGACAGAGGCTGTCAGG - Intronic
1049860386 8:144894291-144894313 CTGGGCAGACAGACGGTGCTGGG - Intronic
1050342706 9:4656361-4656383 CACAGGAGACAGAGGTTGCAGGG + Intronic
1050798912 9:9584221-9584243 AAGGGGAGACAGAGGTTGCAGGG - Intronic
1050847831 9:10245749-10245771 GGGGGAAGACAGATGTGGCAGGG + Intronic
1051293060 9:15565162-15565184 CTCGGGAGGCGGAGGTTGCAGGG - Intronic
1051651644 9:19332430-19332452 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1052832768 9:33229402-33229424 CTGGGAAGAAAGAGGTGGGCAGG + Intronic
1053259258 9:36647562-36647584 CTCGGGAGGCGGAGGTTGCAGGG - Intronic
1053514770 9:38721578-38721600 TTGGGAAGACAGAGGCCGCATGG + Intergenic
1053534365 9:38911605-38911627 CTGGCAAGACTGAGGTTGACAGG - Intergenic
1054206588 9:62136024-62136046 CTGGCAAGACTGAGGTTGACAGG - Intergenic
1054631768 9:67452322-67452344 CTGGCAAGACTGAGGTTGACAGG + Intergenic
1054722288 9:68616081-68616103 CCTGGAAGGCGGAGGTTGCAGGG + Intergenic
1054866914 9:70012323-70012345 CTGGGGTCACAGAAGTTGCAAGG + Intergenic
1055243894 9:74217703-74217725 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1055317018 9:75043745-75043767 CCTGGAAGGCAGAGGTGGCAGGG + Intergenic
1055395445 9:75869016-75869038 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1055491748 9:76812186-76812208 CTGGGAAGACAGGGCTTCCAAGG + Intronic
1055795782 9:79973476-79973498 ATGGGAAGAAGGAGGTAGCAAGG + Intergenic
1055868948 9:80850956-80850978 CTGGAGAGACAGAGGTTACATGG + Intergenic
1056089962 9:83195736-83195758 CTGGGAGGACAGAGGTGGTAAGG + Intergenic
1056216557 9:84410344-84410366 CTGGGGAGACAGAGGCTATAGGG + Intergenic
1056412324 9:86342231-86342253 CTCGGGAGACTGAGGTTGGAGGG - Intronic
1056585356 9:87924365-87924387 CTAGGAAGTCAGAGCCTGCAAGG + Intergenic
1056611525 9:88128575-88128597 CTAGGAAGTCAGAGCCTGCAAGG - Intergenic
1056706505 9:88956460-88956482 GGGGGAAGACAGAGGTAGAAGGG - Intergenic
1057175119 9:92991152-92991174 CTAGGGAGGCAGAGGTTGCAGGG - Intronic
1057326311 9:94067675-94067697 CTTGGGAGGCAGAGGTTACAGGG - Intronic
1057895675 9:98906852-98906874 CTTGGAAGAAACAGGCTGCAAGG + Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058059976 9:100484763-100484785 CCGGGGAGGCGGAGGTTGCAGGG - Intronic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058487674 9:105458419-105458441 CCAGGAAGAATGAGGTTGCATGG + Intronic
1058703421 9:107619749-107619771 CTGGGCAGACAGAGGAACCAGGG + Intergenic
1058817202 9:108695130-108695152 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1058988959 9:110236208-110236230 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1059115034 9:111593759-111593781 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1059213488 9:112537179-112537201 CCTGGAAGGCAGAGGTTCCAGGG - Intronic
1060275234 9:122177506-122177528 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1060478829 9:124005376-124005398 AGGGGAACACTGAGGTTGCAGGG - Intronic
1060651355 9:125329764-125329786 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1060691723 9:125667393-125667415 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1060736809 9:126071317-126071339 CTAGGATGACAGAGGAGGCACGG - Intergenic
1060962797 9:127693054-127693076 ACCGGGAGACAGAGGTTGCAGGG - Intronic
1061412366 9:130428525-130428547 CTGGAAACCCAGAGGTTGCCAGG + Intronic
1061610547 9:131742553-131742575 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1062024534 9:134334186-134334208 CTGGGAAAAAAGAGGCTGGATGG - Intronic
1062260551 9:135660821-135660843 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1062688210 9:137827314-137827336 CTGAGAAGTGAGAGGGTGCAGGG - Intronic
1203488320 Un_GL000224v1:78743-78765 CTGGGAAGGCTGAGGTGGGAGGG + Intergenic
1203500941 Un_KI270741v1:20639-20661 CTGGGAAGGCTGAGGTGGGAGGG + Intergenic
1185498287 X:576167-576189 GGAGGAAGACAGAGGTTTCAAGG - Intergenic
1185576428 X:1177067-1177089 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1185579255 X:1197924-1197946 CGTGGGAGACAGATGTTGCAGGG + Intronic
1185590482 X:1273385-1273407 CCTAGAAGACGGAGGTTGCAGGG - Intronic
1185892310 X:3832636-3832658 CTCGGGAGGCAGAGGTTTCAGGG - Intronic
1185897418 X:3871055-3871077 CTCGGGAGGCAGAGGTTTCAGGG - Intergenic
1185902537 X:3909487-3909509 CTCGGGAGGCAGAGGTTTCAGGG - Intergenic
1186222878 X:7367671-7367693 CTGGAAAGAAAGAGGTTTAATGG - Intergenic
1186360915 X:8840564-8840586 CTGAGAAGTCAGGGGTTGAAAGG + Intergenic
1186876520 X:13823593-13823615 CTCGAGAGGCAGAGGTTGCAGGG - Intronic
1187165475 X:16800638-16800660 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1187235700 X:17465017-17465039 CTGGGAAGAAAGATGTAGAACGG + Intronic
1187244788 X:17544585-17544607 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1187381614 X:18807103-18807125 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1187423052 X:19153319-19153341 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1187718472 X:22127872-22127894 CAGGGAAGACAGAGGTGGTGGGG + Intronic
1187838724 X:23462902-23462924 CTTGGAAGAAAAAGGTTGAAAGG - Intergenic
1187910115 X:24103970-24103992 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1189340904 X:40203940-40203962 CCCGGGAGGCAGAGGTTGCATGG - Intergenic
1189495081 X:41501369-41501391 CCTGGGAGACATAGGTTGCAGGG - Intergenic
1189809622 X:44769035-44769057 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1190179346 X:48178299-48178321 GTTGGGAGGCAGAGGTTGCAGGG - Intergenic
1190190049 X:48269448-48269470 CCTGGTAGGCAGAGGTTGCAGGG - Intronic
1190750638 X:53358658-53358680 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1190790021 X:53690353-53690375 CCAGGGAGGCAGAGGTTGCAGGG - Intergenic
1191103495 X:56758238-56758260 CTCAGGAGACAGAGGTTTCAGGG + Intergenic
1192119970 X:68446401-68446423 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1192481500 X:71490167-71490189 CTCACAAGACAGAGGTGGCAGGG - Intronic
1192505327 X:71677634-71677656 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1193176160 X:78396240-78396262 CTCGGAGGGCAGAGGTTGCAGGG + Intergenic
1194757794 X:97758154-97758176 CCTGGAAGGCCGAGGTTGCAGGG + Intergenic
1195088060 X:101431617-101431639 CCCGGAAGGCAGAGCTTGCAGGG - Intronic
1195160751 X:102168327-102168349 CTCGGAAGACTGAGGTGGGAGGG + Intergenic
1195722556 X:107880227-107880249 CTCGGGAGTCTGAGGTTGCAGGG - Intronic
1195803786 X:108739311-108739333 CCCGGGAGACCGAGGTTGCAGGG - Intergenic
1195914613 X:109924100-109924122 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1196027956 X:111062592-111062614 CTGGTAAGCCTGAGGTTGTATGG - Intronic
1196830766 X:119773783-119773805 GGAGGAAGACAGAGGTGGCAAGG + Intergenic
1197257467 X:124279135-124279157 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1197666394 X:129228708-129228730 CTGGGAAGCCAGAGGTGGGATGG - Intergenic
1197715383 X:129702586-129702608 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1197809307 X:130427386-130427408 CTTGGAACACAGAGGCAGCATGG + Intergenic
1198257850 X:134940562-134940584 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1198462359 X:136876197-136876219 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1198854267 X:140999881-140999903 CATGGGAGGCAGAGGTTGCAGGG + Intergenic
1198886269 X:141342109-141342131 TTGGGATTACAGAAGTTGCATGG + Intergenic
1199338392 X:146646195-146646217 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1200160919 X:154008402-154008424 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1200177988 X:154131505-154131527 CCTGAGAGACAGAGGTTGCAGGG - Intergenic
1200687280 Y:6267760-6267782 CTGGGAAGACTGAGGCTAGAGGG + Intergenic
1200809276 Y:7465363-7465385 CTGGAAGGACAGAGCTTGCCTGG - Intergenic
1200858423 Y:7964293-7964315 CCCGGGAGTCAGAGGTTGCAGGG - Intergenic
1201047993 Y:9906950-9906972 CTGGGAAGACTGAGGCTAGAGGG - Intergenic
1201063343 Y:10067943-10067965 CTGGGAAGACTGAGGCTAGAGGG - Intergenic
1201255949 Y:12108287-12108309 CTGGGAAGGCTGAGGTTCAAGGG + Intergenic
1201281170 Y:12343674-12343696 CCTGGGCGACAGAGGTTGCAGGG - Intergenic
1201284477 Y:12367586-12367608 CCCGGGAGACAGAGGTTTCAGGG + Intergenic
1201379872 Y:13363291-13363313 CTGGGAAGGCTGAGGTTGTGAGG - Intronic
1201381473 Y:13384585-13384607 ATTGGGAGGCAGAGGTTGCAGGG + Intronic
1201759426 Y:17520995-17521017 CTTGGAAGTCAGAAGTTGCAGGG - Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1201842128 Y:18384995-18385017 CTTGGAAGTCAGAAGTTGCAGGG + Intergenic
1202031717 Y:20582284-20582306 CTCGGGAGGCAGAGGTTGCAGGG - Intronic
1202327205 Y:23704303-23704325 CCCGGAAGGCAGAGGTTCCAGGG - Intergenic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1202543565 Y:25965749-25965771 CCCGGAAGGCAGAGGTTCCAGGG + Intergenic