ID: 1106127016

View in Genome Browser
Species Human (GRCh38)
Location 13:26909004-26909026
Sequence CAAGAGCACCACAGCCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106127016 Original CRISPR CAAGAGCACCACAGCCAGAA TGG Intergenic
900264096 1:1748825-1748847 CAAGAGCAGCACAACCCGGAAGG - Intergenic
900476460 1:2878604-2878626 CCAGGGCCACACAGCCAGAAGGG + Intergenic
901620322 1:10580185-10580207 CAAGAGCACAAAGGACAGAAGGG + Intronic
901852194 1:12022686-12022708 CAAGGGCACAAGAGCAAGAAGGG - Intronic
903539670 1:24089884-24089906 CAGGAGGGCCACAGCCAGATGGG + Intronic
904517299 1:31066059-31066081 CCCGAGCACCACAGCTAGCAGGG + Intergenic
904747113 1:32718130-32718152 CATGAGCTCCAGAGCCAGAAAGG - Intergenic
905693216 1:39957457-39957479 CATGAGCAACAGAGCCTGAAGGG + Intronic
907210565 1:52818036-52818058 CAAGATCAGCCCAGCCAAAATGG - Intronic
907362900 1:53934796-53934818 CAAGACCAGCACAGCCAACATGG + Intronic
907753684 1:57288455-57288477 CAAGAGCCCCACACTCACAATGG - Intronic
908607768 1:65818989-65819011 GAAGAGCACCACACTCACAATGG - Intronic
910855441 1:91690377-91690399 CAAGAGTACCACATTCAAAAGGG + Intronic
912063743 1:105707998-105708020 CAAGAGCAGCCCGGCCAGCATGG - Intergenic
913050089 1:115109855-115109877 CAAGAGCACTGCAGGCAGAGGGG - Intergenic
915447655 1:155983292-155983314 CATGACCAGCAGAGCCAGAATGG + Intronic
916245423 1:162682588-162682610 CAAGAATACCAGAGCCAGATTGG + Intronic
916642667 1:166747633-166747655 CAAAAGCACCCTGGCCAGAACGG - Intergenic
918076194 1:181173324-181173346 CAAGAGCTGCAGAGCCAGAAGGG - Intergenic
920071164 1:203304378-203304400 CAGGGGCAGCACAGCCAGACAGG + Intergenic
921339246 1:214118057-214118079 CCAGAGCATCAGAACCAGAATGG - Intergenic
922236214 1:223724468-223724490 CAAGTGCTCCACAGCCACACAGG - Intronic
924911708 1:248520670-248520692 CAAGAGCACCCTAGCCAACATGG + Intergenic
1063114861 10:3066684-3066706 CAGGAGCACCACAGCCCCCATGG + Intronic
1063298806 10:4833341-4833363 CAGGTGCACCACAGCTACAAAGG - Exonic
1063420672 10:5910554-5910576 CCAGAGCAAAACAGCCAGCAAGG - Intronic
1063462004 10:6220890-6220912 CAACCGCCCTACAGCCAGAACGG - Intronic
1064051352 10:12062401-12062423 CAAGAGCACCCCGGCCAACATGG - Intergenic
1065562874 10:26981019-26981041 CAAAAACTCAACAGCCAGAATGG - Intergenic
1065563915 10:26990077-26990099 CAAAAACTCAACAGCCAGAATGG - Intergenic
1068827271 10:61453514-61453536 AAGGTGCAGCACAGCCAGAAAGG + Intergenic
1069855818 10:71440458-71440480 CAGGAGAAACCCAGCCAGAAGGG + Intronic
1070850428 10:79558503-79558525 CAGGAGCCCCACAGACAGAGGGG - Intronic
1070856790 10:79612793-79612815 CAGGAGCCCCACAGACAGAGGGG + Intronic
1071354746 10:84783502-84783524 CAAGTGCACCACAAGCAGATGGG + Intergenic
1071969535 10:90889140-90889162 AAACAGCTCCACAGCCAGACTGG - Intronic
1072568504 10:96638257-96638279 CAAGAGCAGGAGAGCCAGAGAGG - Intronic
1073773274 10:106758857-106758879 CAAGAGCACCAGAGGGAGAGAGG + Intronic
1076308870 10:129487631-129487653 CAACAGAAACACAGGCAGAAAGG - Intronic
1076712488 10:132346111-132346133 CATGAGCACCCCAGACAGAGAGG + Intronic
1077613847 11:3661180-3661202 CATGAGCAGCAGGGCCAGAAGGG - Intronic
1077760851 11:5095582-5095604 CAATAGCAGCAGAGACAGAAAGG - Intergenic
1077899224 11:6476276-6476298 TAAGAGCACCAGATCCAGAGGGG - Exonic
1079144759 11:17840792-17840814 CAAGAACAGCAAAGCCAGATGGG + Intronic
1079271679 11:18992835-18992857 CAAGAGCACTAAACACAGAAAGG - Intergenic
1079383714 11:19960510-19960532 CAAGAGCACCAAAGTCACACTGG - Intronic
1080880969 11:36320150-36320172 CCAGGGCAACACAGCCAGTAGGG - Intronic
1081177162 11:39943102-39943124 CAAGAGAATAACAGCCACAAAGG - Intergenic
1083312342 11:61790528-61790550 CAAAAGCACCACGGTCAGATGGG + Exonic
1083410656 11:62490138-62490160 GAATAGCACCACAGCAAGAGGGG + Intronic
1083588294 11:63876490-63876512 AAAGAACCCCACAGCCATAACGG - Intronic
1084044875 11:66562744-66562766 CATGAGCACTAAAGCCAGGAGGG - Intronic
1084402400 11:68952355-68952377 CAAGAGCAGCCCAGCCAACATGG - Intergenic
1086562018 11:88178731-88178753 CAAGAGCACCACTGCCAAAGAGG + Intergenic
1086921956 11:92597479-92597501 CAAGAGCTCCCCAGCCATGAAGG - Intronic
1088233053 11:107692846-107692868 AAAGAAAACCACAGCCAGATGGG + Intergenic
1088988263 11:114928863-114928885 CAAGAAAACCACAGGCTGAATGG + Intergenic
1089370668 11:117953886-117953908 CAATAGCACCAGAGCAAAAAGGG + Intergenic
1089567660 11:119380530-119380552 CAAGTGCACCAAGGCCAGAGAGG - Intronic
1089847786 11:121471863-121471885 CCAGAGCACTACACCCAGACTGG - Intronic
1090106797 11:123862142-123862164 CAGGCGCAACACAGCCAGGAAGG + Intergenic
1092111314 12:5966781-5966803 CAGAAGCCCCACATCCAGAAGGG + Intronic
1092596675 12:10013448-10013470 CTCAAGCACCACAGCCACAAAGG + Intronic
1093046607 12:14453823-14453845 CAAGAGCAGCCTAGCCAAAATGG - Intronic
1094133046 12:27095286-27095308 CATGACCTGCACAGCCAGAATGG + Intergenic
1094182821 12:27610096-27610118 CATGACCTGCACAGCCAGAATGG + Intronic
1094465789 12:30753480-30753502 CAAGTGAACCACAGTCAGCATGG - Exonic
1095807087 12:46331502-46331524 CGAGACCACCCCAGCCAGCATGG - Intergenic
1096584017 12:52607859-52607881 AAAGAGCAGCACAGGCAGATTGG + Exonic
1096633483 12:52944522-52944544 CAACAGCACCAGGGTCAGAATGG + Intronic
1097772912 12:63609653-63609675 CAAAAGTACCACAGACAGGATGG - Intronic
1099237677 12:80101416-80101438 CAAGAGCCATAAAGCCAGAAAGG - Intergenic
1100924726 12:99531891-99531913 CAAGATCACCCTAGTCAGAATGG - Intronic
1101816867 12:108152172-108152194 CAAGTGCAGCACACTCAGAATGG - Intronic
1101831590 12:108262089-108262111 CTAGAGAACCAAAGCCAGAAGGG + Intergenic
1102324940 12:111972676-111972698 CAAGACCACCCTAGCCAAAATGG + Intronic
1103795196 12:123498560-123498582 CAGGGGGAGCACAGCCAGAATGG - Exonic
1104058766 12:125250411-125250433 CAAGAGGACCACAGACACGAGGG - Intronic
1104233073 12:126904160-126904182 AAAAAGCACCACACCAAGAAGGG - Intergenic
1105010186 12:132750484-132750506 CACGAGCATCAGAGCCAGCATGG + Intronic
1105313016 13:19230009-19230031 CAAGACCACCCCAGCCAACATGG - Intergenic
1106127016 13:26909004-26909026 CAAGAGCACCACAGCCAGAATGG + Intergenic
1107321795 13:39197063-39197085 CTAGAGCACAAGAGCCAGATGGG + Intergenic
1107644703 13:42481851-42481873 TAAGAGCAGTACATCCAGAAAGG + Intergenic
1113548595 13:111174500-111174522 CAAGAGCAAGACTGCGAGAAAGG - Intronic
1113821245 13:113215024-113215046 CAAGACGTCCACAGCCACAAAGG - Intronic
1115242537 14:31263909-31263931 CAAAAGAATCAGAGCCAGAAAGG + Intergenic
1117202328 14:53404229-53404251 CAATAGCACCACCGACAAAAAGG + Intergenic
1117310035 14:54512072-54512094 CAATAGTACCCCAGTCAGAAGGG + Intronic
1118630883 14:67701622-67701644 CGAGACCAGCACAGCCAAAATGG - Intergenic
1120840020 14:89077552-89077574 CACCCACACCACAGCCAGAAGGG - Intergenic
1120840231 14:89078927-89078949 CACCCACACCACAGCCAGAAGGG + Intergenic
1123019566 14:105391365-105391387 CAGAAGCACCACAGCAAGACTGG - Intronic
1123799436 15:23804919-23804941 CAAGGCCACCACAGCAAGAGAGG + Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1124267630 15:28251240-28251262 CAAGACCACCCCAGCCAACATGG + Intronic
1125493354 15:40166051-40166073 CAAGACCAGCACAGCCAACATGG - Intronic
1126539908 15:49810433-49810455 GAAGAGGAGCACAGGCAGAAAGG + Intergenic
1126906111 15:53367533-53367555 AAAGAGCAACAGAGCCAAAACGG - Intergenic
1129026914 15:72584822-72584844 GAAAAATACCACAGCCAGAATGG - Exonic
1129666708 15:77583253-77583275 CCACAGCACCAAAGCCAGGAAGG - Intergenic
1131003142 15:88954611-88954633 CAAAAGCAGCTCAGCCTGAAAGG - Intergenic
1133054447 16:3138520-3138542 CAGGAGCAGCACAGCCATAGCGG + Exonic
1138301775 16:55936426-55936448 AAAGAGCATCATGGCCAGAAGGG - Intronic
1138575154 16:57903017-57903039 CTAGAGCTCCACAGCCAGGTTGG - Intronic
1139314847 16:66059391-66059413 GAAGAGCACCCCTGGCAGAAGGG - Intergenic
1140834131 16:78777842-78777864 CAAGAGCATCCCGGCCAGCATGG + Intronic
1141541804 16:84728996-84729018 CAAGACCAGCCCAGCCAAAATGG - Intronic
1142405315 16:89885341-89885363 CAGGAGCACCAGAACTAGAAGGG - Intronic
1142690174 17:1601413-1601435 ACAGAGCCCCACAGCCAGAGAGG + Intronic
1143529733 17:7495870-7495892 CCAGAGCTCCCCAGCCACAAAGG + Intronic
1144107088 17:11995964-11995986 CAAGAGAAACAAAACCAGAAAGG + Intronic
1144548859 17:16221819-16221841 CAAGAGCAGCCCAGCCAACATGG - Intronic
1144997641 17:19281598-19281620 AAAGACCACCACAGGAAGAAAGG + Intronic
1146241810 17:31236477-31236499 CCAGTGCACCCCAGCCTGAATGG - Intronic
1147156281 17:38545986-38546008 CAAGAGCTTCACAGCTAGAAGGG + Intronic
1148461990 17:47844161-47844183 CCAGAGCCCCAAAGCCAGGAAGG - Intergenic
1149626759 17:58084928-58084950 CAACAGCAGCACAGGGAGAAAGG - Intronic
1150576339 17:66434025-66434047 CAGGAGCAGCAGAGCCAGGATGG + Intronic
1150678903 17:67268513-67268535 CAAGAGCAAGATTGCCAGAAAGG + Intergenic
1151587946 17:75022421-75022443 CAAGAGCAGCCCAGCCAACATGG - Intergenic
1152723806 17:81935576-81935598 CAAGAGCCCCACAGGTAGAATGG + Intronic
1153526940 18:6005510-6005532 GAAGAGAACCACAGACAGCAGGG - Intronic
1157499362 18:48179144-48179166 GCAGAGCGCCACAGCCAGATTGG - Intronic
1158186665 18:54779543-54779565 CAAGTGCAGCACAGCCAGGGAGG + Intronic
1158846747 18:61451965-61451987 TAAGACCACAACAGACAGAAAGG - Intronic
1159961105 18:74556345-74556367 CAGCAGCAGCACAGCCAGCAGGG - Exonic
1160879219 19:1311895-1311917 CAAGGGCCCCACAGGCAGGAGGG - Intergenic
1164226961 19:23254224-23254246 CAAGACCAGCCCAGCCAAAATGG - Intergenic
1164458308 19:28427078-28427100 TCAGAGCACCAGAGCCTGAAAGG + Intergenic
1164963468 19:32457689-32457711 CAAAAGCCCCAAAGCCAGACAGG + Intronic
1165718635 19:38063315-38063337 CCGGAACACCACAGCCAGGAAGG - Intronic
1168540038 19:57202536-57202558 CATGAGACCCACAGTCAGAAAGG - Intronic
924986341 2:273547-273569 CTAGAGCAGCACAGCCAGAGCGG + Intronic
925167730 2:1728681-1728703 TGAGGGCAGCACAGCCAGAACGG - Intronic
925388009 2:3476346-3476368 CAACAGCAGTACAGCCAGAGTGG + Intronic
925889519 2:8422169-8422191 CAAGGGGAACACAGCAAGAAGGG + Intergenic
926174322 2:10575768-10575790 CAGGAGCAGCACAGCCTGGAAGG - Intronic
926181106 2:10644047-10644069 CAAGACCACCCCAGCCAACATGG + Intronic
926740043 2:16103125-16103147 CCAGAGCAGCCCAGCCATAAAGG - Intergenic
927311646 2:21638489-21638511 CAACCTCATCACAGCCAGAAAGG - Intergenic
927383013 2:22500534-22500556 CAAGTGCACCACAGGGAGAAGGG + Intergenic
927586763 2:24314692-24314714 AAAGACCACCAGAGCCAAAATGG - Intronic
929043085 2:37764893-37764915 AAAGAGCTCGACAGACAGAAAGG + Intergenic
930633806 2:53783093-53783115 TAAAAGCACAACAGACAGAAAGG + Intronic
930719551 2:54626078-54626100 CAAGCGCATCACAGCGAGGAAGG + Exonic
932264656 2:70357274-70357296 CAAGAACAGCACAGCCAAGAAGG + Intergenic
934062636 2:88309659-88309681 CAAGAGCACCTCTGCCAGGATGG - Intergenic
936121713 2:109751824-109751846 CGAGAGCATCACAGCCACAGAGG - Intergenic
936222982 2:110619648-110619670 CGAGAGCATCACAGCCACAGAGG + Intergenic
936577739 2:113669727-113669749 CAAGGGTCCCACAGACAGAAGGG + Intergenic
937846860 2:126588158-126588180 CAACAGCACAACAGCCAGGAGGG + Intergenic
941786117 2:169500397-169500419 AAAGAGCACCTCTGACAGAATGG - Intronic
943056036 2:182981264-182981286 CAACAGCATCAAAGCCAGAAAGG + Exonic
943688979 2:190849732-190849754 CAAAAGAACCACACCCAGTATGG + Intergenic
944150683 2:196554928-196554950 CAACAGATCCACAGCCAAAAAGG + Intronic
947533141 2:230925336-230925358 CAAGAGCCCCTAAGCCAGACAGG - Intronic
1170877861 20:20267560-20267582 CAAGACCACCACATGCAGCAAGG - Intronic
1170929867 20:20759223-20759245 CAAGAGCAGCCCAGGCAGCATGG - Intergenic
1174243044 20:49153503-49153525 CAAGACCACCCCAGCCAACATGG + Intronic
1174502659 20:50996980-50997002 CAAAAGCACCCAAGGCAGAAAGG + Intergenic
1179142983 21:38743723-38743745 CAAGACCAGCCCAGCCAGTATGG - Intergenic
1179201511 21:39227029-39227051 TAAGAGTCCCACAGCCAAAAAGG + Intronic
1179201637 21:39228417-39228439 TAAGAGTCCCACAGCCAAAAAGG + Intronic
1180225969 21:46392628-46392650 CACGAGCACCACAGGTGGAAAGG - Intronic
1180896936 22:19342586-19342608 CAAGACCAGCACAGCCAACATGG - Intronic
1181278503 22:21702470-21702492 GAAGAACACCAGAGCCAGAATGG + Intronic
1184688896 22:46108623-46108645 CAAGGGCACTCCTGCCAGAATGG + Intronic
1203295257 22_KI270736v1_random:36410-36432 AAAGAGCTCGACAGACAGAAAGG + Intergenic
949228623 3:1724140-1724162 CAAGAGCACCAGAGACACAGAGG + Intergenic
949388084 3:3527289-3527311 CATGAGGACCATAGTCAGAATGG - Intergenic
950542569 3:13621067-13621089 CATGAGCAGCACAGGCAGAGGGG - Intronic
950578191 3:13845727-13845749 CCAGAGCACCACAGGCAGTAGGG - Intronic
952046215 3:29324313-29324335 CAAGAGCAGTACAAACAGAAAGG - Intronic
952889998 3:38033487-38033509 CAAGAGCACCCCAGCCAACATGG - Intergenic
953831786 3:46303803-46303825 AAAGGGCACAACAGCCACAATGG - Intergenic
956374612 3:68600966-68600988 CCAGAGAAACACAACCAGAAGGG + Intergenic
956724046 3:72142572-72142594 CAAGAGGAACCCAGCCAGACTGG + Intergenic
956813030 3:72883211-72883233 CAAGTGCTCCACAGCCACATGGG + Intergenic
959305135 3:104653866-104653888 CAAGAGCAGCCTAGCCAGCATGG - Intergenic
961861977 3:129924556-129924578 CAAGACCACCCCAGGCAGCATGG - Intergenic
963130729 3:141855459-141855481 CAAGACCTCTACAGCTAGAAGGG + Intergenic
965122505 3:164580133-164580155 CAAGAACATAACAGCCAGACAGG - Intergenic
966534250 3:181014267-181014289 CAAGAGAAACAGAGCCATAAAGG - Intergenic
967509814 3:190296960-190296982 CAGTAGGACCACAGTCAGAATGG + Intergenic
967988870 3:195116506-195116528 CAAGTGCACATCAGCAAGAAGGG + Intronic
968550730 4:1222390-1222412 CAAGATCACCACAGACAGAGGGG + Intronic
968826673 4:2903150-2903172 CTAGAGTACCACAGCCAGCAGGG + Intronic
969040637 4:4292879-4292901 AAAGAAAACAACAGCCAGAATGG - Intronic
969433057 4:7167235-7167257 CAGGAGCAGCACAGTCAGCAAGG - Intergenic
970820209 4:20203445-20203467 CAAAAGGACCAAAGGCAGAAAGG + Intergenic
971339190 4:25752214-25752236 CAAGACCAGCACAGCCAACATGG + Intronic
975625214 4:76338831-76338853 CAAGAGAACCCTAGCCAAAATGG + Intronic
976432084 4:84974099-84974121 CAAAAGCACAACAGCAAAAAAGG - Intergenic
976729525 4:88248035-88248057 CGAGAGCATCCCAGCCAAAATGG - Intergenic
980806795 4:137826007-137826029 CAAGAACTTCACAGACAGAATGG + Intergenic
981062482 4:140439924-140439946 CAAGAGCAACAGAGTGAGAATGG - Intergenic
981540378 4:145840296-145840318 CAAAAGCACCACATCTAGAGGGG + Intronic
982796437 4:159650846-159650868 CAAGAGCAACACAGCAAGCAGGG - Intergenic
983578559 4:169285072-169285094 TAAAAGCACAACAGCCAGCAAGG - Intergenic
985712527 5:1437566-1437588 GATGGGCACCACAGCCAGAGGGG - Intronic
986192400 5:5509571-5509593 GAAGAGAACCACATCCAGAATGG + Intergenic
988540117 5:32100888-32100910 CAGCAGCAACACAGCCAGGAGGG + Intronic
988942870 5:36163660-36163682 CAAGAGCAGCTCATCCGGAAGGG - Exonic
990064423 5:51695490-51695512 CAAGGGAACCACAGACACAAGGG + Intergenic
990224735 5:53636758-53636780 CAAGAACAGCACAGACAGGATGG - Intronic
990876900 5:60496042-60496064 CAGGAGCACAACAGCCAGTCAGG - Intronic
990953666 5:61322916-61322938 CAAGGGCACTTCAGCCAGACTGG - Intergenic
991638274 5:68728143-68728165 AAAGAGCACTCCAGCAAGAATGG + Intergenic
992553640 5:77882941-77882963 CATGATCAGCACAGGCAGAAAGG - Intergenic
993031000 5:82705685-82705707 CATGAGCATCACAGTCAGAGAGG - Intergenic
994143915 5:96371636-96371658 CAAGAACCCAACACCCAGAATGG - Intergenic
995530274 5:113085356-113085378 AAAGAGCAAAACAGCCAGATGGG + Intronic
996034223 5:118740014-118740036 CAGGGTCACCACAGCCAGATGGG + Intergenic
996066525 5:119085126-119085148 CAAGATCACCCTAGCCAGCATGG + Intronic
996180834 5:120418085-120418107 AAAGTGCTCCAGAGCCAGAAAGG - Intergenic
996351531 5:122548126-122548148 CAAGACCAACACGGCCAGGATGG + Intergenic
996700820 5:126448397-126448419 CAAGAGGTTCAAAGCCAGAAAGG + Intronic
997085811 5:130797078-130797100 CATGAGCACTCCATCCAGAAAGG - Intergenic
997507982 5:134433475-134433497 CAAGAGCAGCCCAGCCAACATGG - Intergenic
997866759 5:137470658-137470680 CAAGCCCACCAAAGCCAGAAAGG + Intronic
999380665 5:151118984-151119006 ACAGGGCCCCACAGCCAGAAGGG - Intronic
1000303528 5:159975797-159975819 CAAGAGCCCCTCAGGCAGACAGG + Intergenic
1001344349 5:170877460-170877482 CAAGACCACCACAGGCAACATGG - Intronic
1003795162 6:9593559-9593581 TGAGAGCTCCACAGCCAGGAAGG - Intergenic
1006838086 6:37011240-37011262 CCTGGGCACCACAGGCAGAATGG - Intronic
1007194033 6:40044444-40044466 CAAAACCACACCAGCCAGAATGG + Intergenic
1007677754 6:43611853-43611875 CAAGAGCACCCCAGCCAACATGG + Intronic
1011411325 6:87069512-87069534 CGAGACCAGCACAGCCAAAATGG + Intergenic
1012492390 6:99796771-99796793 CAAGAGCACCATAGACTGAGTGG + Intergenic
1012553937 6:100489783-100489805 CAAGAGGTCCACTGCCACAAAGG + Intergenic
1017395393 6:153992732-153992754 CAATGGCATCACAGGCAGAATGG + Intergenic
1017418853 6:154251510-154251532 TAATAGCACCTGAGCCAGAAAGG - Intronic
1017913648 6:158816468-158816490 AAAGAAAACCACACCCAGAAGGG + Intronic
1018648922 6:165974773-165974795 CAAGTTCCCTACAGCCAGAAAGG + Intronic
1020458319 7:8399533-8399555 CAAGAGCAGCAAGGCCAGGAGGG - Intergenic
1020780433 7:12510599-12510621 CAAAACCACCACAGTTAGAATGG - Intergenic
1021578823 7:22130467-22130489 CCTGAGCACCACGGCCAGAGCGG - Intronic
1022019757 7:26386969-26386991 CCAGAGCAGCACAGCCAGCAGGG + Intergenic
1022365320 7:29709011-29709033 CAAAAGTACCACAGACAGGATGG + Intergenic
1022403984 7:30069330-30069352 GTAGAGAACCAAAGCCAGAAAGG - Intronic
1023948419 7:44822032-44822054 CAATAGCACCAAATCCAGCATGG + Intronic
1024458797 7:49638489-49638511 CATGAGCAGCACAGCCATATAGG - Intergenic
1026821296 7:73551241-73551263 CAAAAGCACCACAGACAATAAGG + Intronic
1028841787 7:95436299-95436321 CAGGCTCACCACTGCCAGAAGGG - Intergenic
1029828403 7:103226137-103226159 CAAAAGTACCACAGACAGGATGG - Intergenic
1031984405 7:128153913-128153935 CACGAGCACTCCAGCCAGAGAGG - Intergenic
1035144647 7:156802181-156802203 CAAGAGCAGCCCAGCCAACATGG - Intronic
1036409875 8:8489466-8489488 GAAGAACACTCCAGCCAGAAAGG - Intergenic
1036687920 8:10924190-10924212 CAAGAGCACCACAGTTTAAAGGG + Intronic
1036707556 8:11056542-11056564 AAAGAGCACCACCCCCATAAAGG + Intronic
1038438607 8:27556106-27556128 AAAGAGGACCAGAGACAGAAGGG + Intergenic
1040443797 8:47472945-47472967 CCAGAAGACCACGGCCAGAAAGG - Intronic
1042000041 8:64111870-64111892 CTATAGTACCACAGCCAGAGTGG + Intergenic
1042118402 8:65457709-65457731 CCAGAGCCCCACACTCAGAAGGG + Intergenic
1046908361 8:119599099-119599121 AAAGAACACCAAAGCAAGAATGG - Intronic
1047668868 8:127122807-127122829 CCACAGCACCACGACCAGAAAGG + Intergenic
1047889463 8:129291730-129291752 ACAGAGCACCACAGACTGAATGG - Intergenic
1048705294 8:137146863-137146885 CAAGAGCACCACACCAGGAATGG - Intergenic
1049012649 8:139897669-139897691 CCAAAGCCACACAGCCAGAAAGG + Intronic
1049110079 8:140636625-140636647 CAGGAGCTCCGCAGCCAGCAGGG + Intergenic
1051286880 9:15506705-15506727 CAAGAGCACAACATCCAAAAGGG + Intronic
1051666871 9:19474080-19474102 CAAGAGCAAAACAGACAGGAAGG - Intergenic
1055812098 9:80161220-80161242 CAAGACCAGCCCAGCCAGCATGG - Intergenic
1056889634 9:90478742-90478764 CAGAAGCAGCACAGCCATAAAGG + Intergenic
1059484801 9:114618314-114618336 GAAAAGCACAACAGGCAGAAGGG - Intronic
1060377330 9:123128380-123128402 AATGAGAACCACTGCCAGAATGG + Intronic
1060658668 9:125389742-125389764 CAAGACCAGCACGGCCAGCATGG - Intergenic
1062141155 9:134959841-134959863 CCAGAGCATCACTGCCAGGAGGG + Intergenic
1062489558 9:136798761-136798783 CACGGGCCCCAAAGCCAGAATGG + Intronic
1186608948 X:11119994-11120016 CAAGAGGATCACAGGCAAAAAGG - Intronic
1186860402 X:13667239-13667261 GAAGAGCCCCACAATCAGAAGGG + Intronic
1188253230 X:27926045-27926067 GAAGAGCACTAAAGCCAGAGTGG + Intergenic
1189506971 X:41621463-41621485 GAAGAGGACCACAGCCAGTAAGG + Intronic
1189755878 X:44270872-44270894 AAGGAGAACCACAGACAGAAGGG - Intronic
1189977514 X:46477485-46477507 CAAGAGGAACAGATCCAGAAGGG + Intronic
1190292833 X:49004147-49004169 CAAGACCAGCCCAGCCAGCATGG + Intergenic
1190341682 X:49301787-49301809 CAAGAGCACCCCGGCCAAGATGG - Intergenic
1190343872 X:49320169-49320191 CAAGAGCACCCCGGCCAAGATGG - Intergenic
1190344966 X:49329713-49329735 CAAGAGCACCCCGGCCAAGATGG - Intergenic
1190346060 X:49339278-49339300 CAAGAGCACCCCGGCCAAGATGG - Intergenic
1190347313 X:49530309-49530331 CAAGAGCACCCCGGCCAAGATGG - Intergenic
1190348412 X:49539865-49539887 CAAGAGCACCCCGGCCAAGATGG - Intergenic
1190349513 X:49549421-49549443 CAAGAGCACCCCGGCCAAGATGG - Intergenic
1190350617 X:49558974-49558996 CAAGAGCACCCCGGCCAAGATGG - Intronic
1190351719 X:49568532-49568554 CAAGAGCACCCCGGCCAAGATGG - Intergenic
1190352819 X:49578081-49578103 CAAGAGCACCCCGGCCAAGATGG - Intergenic
1190353920 X:49587628-49587650 CAAGAGCACCCCGGCCAAGATGG - Intergenic
1190355022 X:49597152-49597174 CAAGAGCACCCCGGCCAAGATGG - Intronic
1191123826 X:56933204-56933226 CAAGAGCACTTCAGCCTTAAGGG + Intergenic
1191887721 X:65906132-65906154 CTGGAGCACCAGAGACAGAAGGG - Intergenic
1195399732 X:104448396-104448418 AATGACCAGCACAGCCAGAAAGG - Intergenic
1195711270 X:107775582-107775604 CCGGAGCAGTACAGCCAGAAGGG - Exonic
1198437217 X:136628960-136628982 CAAGAGCTCCAAAGCCTGGAGGG - Intergenic
1199532644 X:148867766-148867788 CCAGAGTACCACAGGCAGAGAGG - Intronic
1200887144 Y:8281238-8281260 CAAGACCACCACAGACACGAAGG + Intergenic
1201018172 Y:9625386-9625408 CAAGACCACCACAGCCGCGATGG + Intergenic
1201060126 Y:10037406-10037428 CAAGACCACCACAGCCTCGAAGG + Intergenic
1202023708 Y:20496183-20496205 CAAGAGCAGCCCAGCCAAAATGG + Intergenic
1202196939 Y:22306705-22306727 CAGGACCACCACAGCCGCAAAGG - Intergenic